Phenotypic Mutation 'Adendritic' (pdf version)
List |< first << previous [record 10 of 511] next >> last >|
AlleleAdendritic
Mutation Type nonsense
Chromosome7
Coordinate128,148,572 bp (GRCm38)
Base Change C ⇒ A (forward strand)
Gene Itgax
Gene Name integrin alpha X
Synonym(s) Cd11c, CD11C (p150) alpha polypeptide
Chromosomal Location 128,129,547-128,150,656 bp (+)
MGI Phenotype Mice homozygous for a targeted allele exhibit increased T cell proliferation, increased susceptibility to bacterial infection, and decreased susceptibility to EAE.
Accession Number

NCBI RefSeq: NM_021334; MGI:96609

Mapped Yes 
Amino Acid Change Tyrosine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000033053]
SMART Domains Protein: ENSMUSP00000033053
Gene: ENSMUSG00000030789
AA Change: Y1053*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Int_alpha 33 83 1.28e1 SMART
VWA 150 331 8.36e-43 SMART
Int_alpha 402 451 3.67e-3 SMART
Int_alpha 455 512 1.29e-7 SMART
Int_alpha 518 574 5.72e-14 SMART
Int_alpha 581 635 1.55e-1 SMART
transmembrane domain 1115 1137 N/A INTRINSIC
Pfam:Integrin_alpha 1138 1152 6.2e-7 PFAM
Predicted Effect probably null
Phenotypic Category decrease in CD11b+ DCs in CD11c+ cells, decrease in CD11c+ DCs, decrease in pDCs in CD11c+ cells
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(5) : Targeted(5)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Itgax APN 7 128135326 missense probably damaging 1.00
IGL00325:Itgax APN 7 128148309 missense probably benign 0.41
IGL01155:Itgax APN 7 128145035 missense probably benign 0.05
IGL01461:Itgax APN 7 128135018 missense probably damaging 0.96
IGL01508:Itgax APN 7 128144818 missense probably damaging 1.00
IGL01549:Itgax APN 7 128131206 splice acceptor site probably benign 0.00
IGL01864:Itgax APN 7 128133763 missense probably benign 0.00
IGL02094:Itgax APN 7 128131473 missense probably damaging 1.00
IGL02364:Itgax APN 7 128139982 missense possibly damaging 0.72
IGL02969:Itgax APN 7 128149123 missense probably benign 0.00
IGL03406:Itgax APN 7 128149198 missense probably damaging 1.00
R0366:Itgax UTSW 7 128149089 splice acceptor site probably benign
R0763:Itgax UTSW 7 128147940 splice site probably benign
R0892:Itgax UTSW 7 128148129 splice donor site probably benign
R1072:Itgax UTSW 7 128150144 missense probably damaging 0.96
R1659:Itgax UTSW 7 128130891 missense probably benign 0.15
R2019:Itgax UTSW 7 128148526 missense probably benign 0.00
R2127:Itgax UTSW 7 128140035 splice donor site probably benign
R2155:Itgax UTSW 7 128130391 splice donor site probably benign
R2396:Itgax UTSW 7 128148011 splice acceptor site probably benign
R2418:Itgax UTSW 7 128142333 missense probably damaging 0.98
R3027:Itgax UTSW 7 128148572 nonsense probably null
R3846:Itgax UTSW 7 128133767 missense probably damaging 1.00
R3938:Itgax UTSW 7 128136273 missense possibly damaging 0.73
R4021:Itgax UTSW 7 128133139 critical splice donor site probably null
R4027:Itgax UTSW 7 128141266 missense possibly damaging 0.75
R4163:Itgax UTSW 7 128144700 missense probably benign 0.00
R4923:Itgax UTSW 7 128148528 missense probably benign
R5259:Itgax UTSW 7 128148278 missense probably damaging 0.99
R5333:Itgax UTSW 7 128142283 missense probably damaging 1.00
R5347:Itgax UTSW 7 128141302 missense probably benign 0.08
R5679:Itgax UTSW 7 128134990 missense probably benign 0.00
R5725:Itgax UTSW 7 128147861 missense possibly damaging 0.63
R5733:Itgax UTSW 7 128140475 missense probably damaging 0.99
R5750:Itgax UTSW 7 128144706 missense probably benign 0.32
R5964:Itgax UTSW 7 128140447 missense probably damaging 1.00
X0061:Itgax UTSW 7 128129607 start gained unknown
Mode of Inheritance Autosomal Semidominant
Local Stock
Repository
Last Updated 05/17/2017 3:53 PM by Katherine Timer
Record Created 10/15/2015 12:55 PM by Bruce Beutler
Record Posted 09/16/2016
Phenotypic Description

Figure 1. Adendritic mice exhibit decreased frequencies of peripheral CD11c+ conventional dendritic cells (cDCs). Flow cytometric analysis of peripheral blood was utilized to determine DC cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Adendritic mice exhibit decreased frequencies of peripheral CD11b+ cDCs gated in CD11c+ cells. Flow cytometric analysis of peripheral blood was utilized to determine DC cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Adendritic mice exhibit decreased frequencies of peripheral plasmacytoid DCs (pDCs). Flow cytometric analysis of peripheral blood was utilized to determine DC cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Adendritic phenotype was identified among G3 mice of the pedigree R3027, some of which showed reduced frequencies of CD11c+ conventional dendritic cells (cDCs) (Figure 1) and CD11b+ cDCs gated in CD11c+ cells (Figure 2) as well as an increased frequency of plasmacytoid DCs (pDCs) (Figure 3), all in the peripheral blood.

Nature of Mutation

Figure 4. Linkage mapping of the reduced frequency of CD11b+ cDCs gated in CD11c+ cells using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 33 mutations (X-axis) identified in the G1 male of pedigree R3027. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 33 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Itgax:  a C to A transversion at base pair 128,148,572 (v38) on chromosome 7, or base pair 19,044 in the GenBank genomic region NC_000073 encoding the Itgax gene. The strongest association was found with an additive model of linkage to the normalized frequency of CD11b+ cDCs gated in CD11c+ cells, wherein four variant homozygotes and 21 heterozygotes departed phenotypically from 19 homozygous reference mice with a P value of 9.542 x 10-12 (Figure 4).  A substantial semidominant effect was observed in most of the assays. 

 

The mutation corresponds to residue 3,211 in the mRNA sequence NM_021334 within exon 27 of 30 total exons.

 
3194 ATCCTGGATGAGCTTTACTTCATTCTGAAGGGC
1048 -I--L--D--E--L--Y--F--I--L--K--G-

 

The mutated nucleotide is indicated in red.  The mutation results in substitution of tyrosine 1053 (Y1053) to a premature stop codon (Y1053*) in the CD11c protein.

Protein Prediction
Figure 5. Domain structure of CD11c. CD11c has a long extracellular domain, a transmembrane domain, and a short cytoplasmic domain. The extracellular domain of CD11c has several subdomains, including seven β-propeller repeats (designated as FG-GAP repeats. A 200-amino acid (amino acids 152-330) von Willebrand factor A (VWFA) domain (alternatively, integrin I-domain) is the major CD11c ligand-binding site. Amino acids 1-19 constitute a signal peptide. The Adendritic mutation results in substitution of tyrosine 1053 (Y1053) to a premature stop codon (Y1053*).
Figure 6. Crystal structure of a ligand-bound, metastable human αXβ2 integrin. The figure was modeled using UCSF Chimera and is based on PDB:4NEN. The image is interactive; click to rotate.

The Itgax gene encodes CD11c (alternatively, the integrin αX protein), which forms noncovalently linked dimers with CD18 (also called the integrin β2 protein; see the record for Joker) to form a functional integrin receptor, αXβ2. CD11c and CD18 are both type I transmembrane proteins. Similar to other α chains (i.e., CD11a and CD11b [see the record for invisible]), CD11c has a long extracellular domain, a transmembrane domain, and a short cytoplasmic domain (Figure 5).

 

CD11c and CD18 form the integrin head, with connections through upper and lower legs in each subunit to the cell membrane. Crystallographic analysis suggests that the extracellular domains of the integrins exist in a bent conformation in the latent, low-affinity state (Figure 6; PDB:4NEN, (1) and PDB:3K72, (2)). Destabilization of the interface between the α and β legs in the tailpiece results in shifting of the bent conformation and opening of the structure to an open high-affinity conformation where ligand may bind. On the cell surface, integrins equilibrate between the low- and high-affinity state; the equilibrium may be shifted by the presence of intracellular activators or extracellular ligands (3).

 

The extracellular domain of CD11c has several subdomains, including seven β-propeller repeats (designated as FG-GAP repeats) that form a β-propeller fold. A 200-amino acid (amino acids 152-330) von Willebrand factor A (VWFA) domain (alternatively, integrin I-domain) is the major CD11c ligand-binding site and separates the second and third FG-GAP repeat (4). The VWFA has six major α-helices and a β-sheet composed of five parallel and one anti-parallel β-strand. There is a large interface between the β-propeller domain of the α-subunit (containing the VWFA domain) and the VWFA-like domain of the β subunit (5). Evidence suggests that the VWFA domain regulates the conformation of the VWFA domain when it is in both subunits of the integrin (6). Ligand binding depends on the integrity of the metal ion-dependent adhesion site (MIDAS), a part of VWFA and VWFA-like domains, which binds to divalent cations and coordinates to a glutamine or aspartate residue in the ligand. A DXSXS sequence is a key metal-binding motif of the MIDAS. Please refer to reference (7) for an excellent review of integrin receptor extracellular domains and structure.

 

CD11c has several putative phosphorylation sites. Phosphorylation of Ser1158 in CD11c is essential for its adherence and phagocytosis functions (8). Mutation of Ser1158 to alanine (Ser1158Ala) resulted in reduced binding to iC3b. Mutation of Ser1158 did not result in changes in outside-in signaling, but does inhibit inside-out activation (see the Background section for more information about integrin signaling).

 

The Adendritic mutation results in substitution of tyrosine 1053 (Y1053) to a premature stop codon (Y1053*).

Expression/Localization

The CD11c/CD18 integrin is expressed on monocytes, macrophages, granulocytes, neutrophils, dendritic cells, lymphocytes, and natural killer cells. Expression of CD11c/CD18 increases upon cytokine or phorbol ester treatment as well as antigen-mediated activation. CD11c expression on mouse and human myeloid DCs after Toll-like receptor (TLR3/4/9) activation resulted in downregulation of CD11c expression (9).

Background
Figure 7. Activation and signaling of integrin receptors. Left, Schematic of open, high-affinity conformation of an integrin receptor consisting of α and β integrin subunits. The I domain of the α subunit typically contains the ligand-binding site of the integrin, and its conformation is regulated by the β subunit I-like domain to which it binds directly. Center, Inside-out signaling, also called priming, occurs when intracellular proteins such as talin bind to the tails of β integrins, clustering the receptors at the cell membrane and thereby increasing avidity for ligand. (Kindlin-1 and Kindlin-2 proteins have also been found to interact with and activate integrins from inside the cell.) Right, Integrin ligands, also known as counter-receptors, activate integrins during outside-in signaling and induce clustering that permits the recruitment of signaling molecules to the cytoplasmic face of the receptor.

Integrins are adhesion molecules that mediate cell-cell, cell-extracellular matrix, and cell-pathogen interactions. They regulate cell migration and morphogenesis by coordinating regulatory signals from inside and outside the cell, with the physical machinery for cell movement. Most integrins, including β2-integrins, link to and regulate the actin cytoskeleton. Their ligands are diverse, but most possess a short peptide motif containing an acidic residue (aspartate or glutamate) positioned in a flexible loop. There are 24 distinct integrins formed by a combination of α and β subunits, and those containing the β2 subunit are leukocyte-specific [reviewed in (10)]. Each leukocyte class expresses a distinct pattern of integrins that changes in functional state, density and localization in response to intra- and extracellular cues, including protein modifications (e.g. phosphorylation), cytokines, chemokines, and other cell adhesion molecules. However, all leukocytes express one or more β2-containing integrin. The β2-containing integrins are αLβ2 (CD11a/CD18; also called leukocyte function-associated antigen 1, LFA-1), αMβ2 (CD11b/CD18; also called MAC-1), αXβ2 (CD11c/CD18; also called p150,95 or CR4) and αDβ2 (CD11d/CD18). The CD11/CD18 integrins are referenced collectively as the “leukocyte” integrins, and mediate leukocyte adhesion during inflammatory responses to infections and also during wound repair.

 

Leukocytes circulate in the blood in a quiescent state of low adhesiveness, becoming activated and migrating into tissues during microbial invasion in order to defend against infection. The β2-containing integrins are thus inactive when leukocytes are in a resting state, and must be rapidly activated during infection to mediate leukocyte adhesion to various cell types such as endothelial cells of vessel walls and antigen-presenting cells. Integrins transmit signals bidirectionally across the plasma membrane. “Outside-in” signaling occurs when ligands bind to integrins, and serves to mediate adhesion and to initiate downstream signaling. Ligand binding induces the clustering of integrins on the cell surface and enables the recruitment of signaling molecules to the cytoplasmic face of the receptor.

 

“Inside-out” signaling primes integrins for ligand binding (Figure 7). The adhesive state of integrins may be modulated by conformational changes in the integrin itself, or possibly by clustering of integrins on the cell surface to increase avidity (7)). The intracellular domain of the β2 chain has been shown to influence integrin adhesive activity in the case of LFA-1 (11;12). How this process is regulated is largely unknown, but Rho family GTPases and the cytoskeletal protein talin have been shown to play a role. Knockdown of the leukocyte-specific inhibitory RhoH in peripheral blood lymphocytes results in a constitutively adherent phenotype towards ICAM-1, demonstrating that RhoH promotes the nonadhesive state of LFA-1 (integrin αLβ2) (13). Conversely, knockdown of talin impairs TCR-induced adhesion to ICAM-1 (14). Another Rho GTPase, RhoA, promotes neutrophil adhesion through β2 integrin (15).

 

CD11c has proposed functions in phagocytosis, cell migration, cytokine production by monocytes/macrophages, and induction of T cell proliferation by Langerhans cells.

CD11c/CD18 has several functions, including monocyte and neutrophil binding to and transmigration through the endothelium (16), conjugate formation between cytotoxic T cells and target cells (16-19), phagocytic clearance of bacteria and apoptotic cells (19-21).  The ligands that mediate these functions are summarized in Table 1.

 

Table 1. CD11c/CD18 ligands

CD11c/CD18 ligand

Brief description

Effect

References

ICAM-1

Ig superfamily cell adhesion molecule

Leukocyte adhesion and emigration

(22;23)

ICAM-2

 

ICAM-4

Leukocyte adhesion and emigration; removal of sescent red cells

(24)

VCAM-1

Arrest and transmigration of monocytes through inflamed aortic endothelial cells

(25;26)

iC3b

Complement fragment

Cell adhesion and phagocytosis

(27)

Fibrinogen

Provisional matrix molecule

Mediates binding of fibrinogen to B cells and subsequent B cell activation; mediates binding of fibrinogen to neutrophils

(28-30)

Collagen

Structural protein in connective tissue

Promotes monocyte adhesion and activation

(31)

Heparin

Anticoagulant

 

(32;33)

Lipopolysaccharide

Component of the outer membrane of Gram-negative bacteria

Induces nuclear translocation of NF-kB

(34)

 

In a mouse model with inducible ablation of Itgax (CD11c-DTR), exposure to diphtheria toxin resulted in loss of CD11c+ cells (35;36). Constitutive deletion of CD11c resulted in loss of CD11c+ DCs. Itgax-deficient mice immunized with EAE exhibited increased T cell proliferation, increased IL-12 secretion, increased IL-2 secretion, reduced interferon-gamma secretion, decreased IL-17 secretion, and reduced TNF secretion compared to wild-type littermates (37). Furthermore, the Itgax-deficient mice exhibited increased susceptibility to pneumococcal infection compared to controls (38).

Putative Mechanism

The loss of CD11c DCs in the Adendritic mouse indicates that the CD11cAdendritic protein exhibits loss of function. Expression of the CD11cAdendritic protein has not been examined.

Primers PCR Primer
Adendritic(F):5'- TCTGCACCAGCTCTATCGAG -3'
Adendritic(R):5'- AATGTGATTTCAGCCTCACTCAG -3'

Sequencing Primer
Adendritic_seq(F):5'- AGCTCTATCGAGGCCTGCATG -3'
Adendritic_seq(R):5'- GGAGCAACACCTTTTTCTGCAATG -3'
References
Science Writers Anne Murray
Illustrators Peter Jurek, Katherine Timer
AuthorsMing Zeng, Xue Zhong, Bruce Beutler
List |< first << previous [record 10 of 511] next >> last >|