Phenotypic Mutation 'celina' (pdf version)
List |< first << previous [record 59 of 511] next >> last >|
Allelecelina
Mutation Type missense
Chromosome2
Coordinate11,283,849 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Prkcq
Gene Name protein kinase C, theta
Synonym(s) PKC theta, PKC-0, PKCtheta, PKC-theta, A130035A12Rik, Pkcq
Chromosomal Location 11,172,108-11,301,222 bp (+)
MGI Phenotype Homozygotes for targeted null mutations exhibit reduced T cell proliferative responses and interleukin 2 production and a lack of T cell receptor-initiated NF-kappaB activation in mature T lymphocytes.
Accession Number

NCBI RefSeq: NM_008859; MGI:97601

Mapped Yes 
Limits of the Critical Region 11172113 - 11301226 bp
Amino Acid Change Threonine changed to Alanine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000028118] [ENSMUSP00000100035]
PDB Structure
Identification of the Activator Binding Residues in the Second Cysteine-Rich Regulatory Domain of Protein Kinase C Theta [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000028118
Gene: ENSMUSG00000026778
AA Change: T538A

DomainStartEndE-ValueType
PDB:2ENJ|A 3 126 6e-83 PDB
C1 160 209 3.27e-15 SMART
C1 232 281 2.22e-17 SMART
S_TKc 380 634 1.17e-97 SMART
S_TK_X 635 698 2.6e-26 SMART
Predicted Effect possibly damaging

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)
(Using ENSMUST00000028118)
SMART Domains Protein: ENSMUSP00000100035
Gene: ENSMUSG00000026778
AA Change: T538A

DomainStartEndE-ValueType
PDB:2ENJ|A 3 126 2e-84 PDB
C1 160 209 3.27e-15 SMART
C1 232 281 2.22e-17 SMART
Pfam:Pkinase_Tyr 380 558 2.8e-27 PFAM
Pfam:Pkinase 380 560 2.2e-47 PFAM
Predicted Effect possibly damaging

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
(Using ENSMUST00000102970)
Phenotypic Category T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(5) : Targeted(5)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01654:Prkcq APN 2 11283843 missense probably benign 0.37
IGL01656:Prkcq APN 2 11226955 missense probably damaging 1.00
IGL01732:Prkcq APN 2 11260833 splice donor site probably benign 0.00
IGL02136:Prkcq APN 2 11260668 missense probably benign 0.00
IGL02161:Prkcq APN 2 11277076 missense probably benign 0.00
IGL02178:Prkcq APN 2 11277040 missense probably damaging 1.00
IGL03107:Prkcq APN 2 11260786 missense possibly damaging 0.57
IGL03149:Prkcq APN 2 11232545 missense probably benign 0.00
celina2 UTSW 2 11226986 critical splice donor site probably null
3-1:Prkcq UTSW 2 11300094 missense probably damaging 1.00
K3955:Prkcq UTSW 2 11246793 splice acceptor site probably benign
R0049:Prkcq UTSW 2 11283832 missense probably benign 0.01
R0049:Prkcq UTSW 2 11283832 missense probably benign 0.01
R0183:Prkcq UTSW 2 11253162 missense probably damaging 1.00
R0366:Prkcq UTSW 2 11246838 splice donor site probably benign
R0388:Prkcq UTSW 2 11254234 missense probably benign 0.00
R1385:Prkcq UTSW 2 11256286 missense probably damaging 1.00
R1687:Prkcq UTSW 2 11290533 missense probably damaging 1.00
R1693:Prkcq UTSW 2 11254199 missense probably damaging 0.99
R1760:Prkcq UTSW 2 11300070 missense probably damaging 1.00
R1764:Prkcq UTSW 2 11232631 missense probably damaging 1.00
R1968:Prkcq UTSW 2 11245397 missense probably damaging 1.00
R2020:Prkcq UTSW 2 11279521 missense probably benign 0.00
R2108:Prkcq UTSW 2 11232569 missense probably damaging 1.00
R2762:Prkcq UTSW 2 11232640 missense possibly damaging 0.75
R3402:Prkcq UTSW 2 11283849 missense possibly damaging 0.82
R3429:Prkcq UTSW 2 11246970 missense probably damaging 1.00
R3545:Prkcq UTSW 2 11283816 missense probably benign 0.11
R3547:Prkcq UTSW 2 11283816 missense probably benign 0.11
R3893:Prkcq UTSW 2 11226971 missense probably damaging 1.00
R3900:Prkcq UTSW 2 11260866 missense noncoding transcript
R4086:Prkcq UTSW 2 11283868 missense probably damaging 0.97
R4423:Prkcq UTSW 2 11256169 missense possibly damaging 0.66
R4541:Prkcq UTSW 2 11283812 missense possibly damaging 0.84
R4649:Prkcq UTSW 2 11279522 missense possibly damaging 0.83
R4652:Prkcq UTSW 2 11279522 missense possibly damaging 0.83
R4749:Prkcq UTSW 2 11248157 missense noncoding transcript
R4820:Prkcq UTSW 2 11226986 critical splice donor site probably null
R5197:Prkcq UTSW 2 11299416 missense probably damaging 1.00
R5470:Prkcq UTSW 2 11260721 missense noncoding transcript
R5653:Prkcq UTSW 2 11299993 nonsense probably null
R5655:Prkcq UTSW 2 11260830 missense noncoding transcript
R5786:Prkcq UTSW 2 11253212 missense noncoding transcript
R6008:Prkcq UTSW 2 11256286 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 11/08/2016 10:23 AM by Katherine Timer
Record Created 10/22/2015 11:43 PM by Jin Huk Choi
Record Posted 11/08/2016
Phenotypic Description
Figure 1.

The celina phenotype was identified among G3 mice of the pedigree R3402, some of which showed diminished T-dependent antibody responses to OVA/alum.

Nature of Mutation
Figure 2.

Whole exome HiSeq sequencing of the G1 grandsire identified 36 mutations. The diminished T-dependent antibody response to OVA/alum was linked by continuous variable mapping to a mutation in Prkcq. The Prkcq mutation is an A to G transition at base pair 11,283,849 (v38) on chromosome 2, or base pair 111,946 in the GenBank genomic region NC_000068 for Prkcq. Linkage was found with a recessive model of inheritance, wherein four variant homozygotes departed phenotypically from eight homozygous reference mice and 12 heterozygous mice with a P value of 2.844 x 10-6 (Figure 2).  

 

The mutation corresponds to residue 1,700 in the mRNA sequence NM_008859 within exon 15 of 18 total exons.


 
1685 GATGCGAAGACAAATACTTTCTGTGGAACTCCT
533  -D--A--K--T--N--T--F--C--G--T--P-

 

The mutated nucleotide is indicated in red.  The mutation results in a threonine (T) to alanine (A) substitution at position 538 (T538A) in the PKCθ protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.753).

Protein Prediction
Figure 3. Domain organization of PKCθ. The celina mutation results in a threonine to alanine substitution at amino acid 538. C2 designates the C2-like pTyr-binding domain; C1a and C1b are cysteine-rich zinc fingers. This image is interactive; click to view the locations of additional mutations in PKCθ.

Prkcq encodes protein kinase C theta (PKCθ), a member of the PKC family of serine threonine kinases. At least 11 mammalian PKC proteins are known with a wide range of tissue distribution, subcellular localization, and function. The PKC family belongs to the AGC-type kinase (protein kinase A/protein kinase G/protein kinase C) superfamily. PKC kinases share certain structural features including a highly conserved catalytic domain consisting of motifs required for ATP-substrate binding and catalysis, and a regulatory domain that maintains the enzyme in an inactive conformation (Figure 3). The regulatory and catalytic domains are attached to each other by a hinge region. PKC kinases can be split into three groups: conventional (α, βI, βII, and γ), novel (δ, ϵ, η, θ), and atypical (ζ and ι/λ). These classifications are based on the structural motifs in the regulatory domain that account for cofactor dependence and interactions during induction of catalytic activity. PKCθ is novel PKC that requires diacylglycerol (but not calcium) to become activated.

 

PKCθ has a C2-like pTyr-binding domain (amino acids 8-123), a proline-rich motif in the V3 (hinge) domain that mediates CD28 interaction and immunological synapse translocation, two tandem cysteine-rich zinc finger C1 domains (amino acids 159-209 and 231-281) that bind diacylglycerol, and a kinase (C3/C4) domain (amino acids 380-634) (1).

 

The C2-like domain is approximately 130 amino acids long and binds to anionic phospholipids present in membranes in a Ca2+-dependent manner. Lck (see the record for iconoclast) phosphorylates PKCθ at Tyr90 upon antigen stimulation in T cells (2). Tyr90 phosphorylation is proposed to enhance PKCθ affinity for lipid membranes (3). PKCθ localization to the immunological synapse is dependent on its phosphorylation by Lck and germinal center kinase (GSK)-like kinase (GLK) as well as autophosphorylation (1;2;4).

 

C1 domains function as hydrophobic switches to anchor PKCs to the membrane (5). The upper third of the C1 domain forms a hydrophobic structure; the positively charged residues that interact with anionic phospholipids are in the middle third of the C1 domain. The bottom third of the C1 domain has two zinc-coordinating sites required for C1 domain folding. The C1 domains have a HX12CX2CXnCX2CX4HX2CX7C motif, where H is histidine, C is cysteine, X is any other amino acid, and n is 13 or 14. Diacylglycerol interacts with high affinity to the PKCθ C1B (but not C1A) domain (3). The difference in C1B domain binding affinity for diacylglycerol is attributed to an invariant tryptophan residue that is conserved in the lipid-binding surface of novel PKCs. Met267 within the C1B domain facilitates PKCθ localization to the Golgi complex where it functions in apoptosis (6)

 

The PKCθ kinase domain has a smaller N-terminal lobe that is comprised mainly of β-sheets. The kinase domain has a glycine-rich ATP-binding loop with a GXGXXG sequence (amino acids 387-392) that is found in protein kinases and nucleotide binding proteins. An invariant Lys (Lys409) structures the enzyme for phosphoryl-transfer. The C-terminal lobe of the kinase domain is predominantly α-helical and contains the activation loop. A hydrophobic methionine residue (Met458) within the sequence connecting the two lobes controls access to a cavity in the ATP binding pocket. Within the C-terminal catalytic domain is an ATP-binding site (C3) and a substrate-binding domain (C4). The V5 domain is C-terminal to the C3 and C4 domains, and contains a conserved turn and hydrophobic phosphorylation motifs. The V5 domain determines PKCθ targeting.

 

Autophosphorylation of Thr219 regulates the function of PKCθ. Thr219 is not phosphorylated in resting T cells, but phorbol 12,13-dibutryrate, vanadate, and antigen receptor cross-linking induce Thr219 phosphorylation. Mutation of Thr219 to alanine (Thr219Ala) caused a reduction in the ability of PKCθ to promote signaling that leads to the activation of NF-κB, NF-AT, and AP-1. The Thr219Ala mutation also prevented recruitment of PKCθ to the membrane in activated T cells (7). The hinge region of PKCθ undergoes caspase 3-dependent cleavage at a DEVD354K site in responses to apoptogenic stimuli (8), which releases a catalytic domain fragment from autoinhibition.

 

The celina mutation results in substitution of a threonine for an alanine at amino acid 538 located in the kinase domain.

Expression/Localization

PKCθ is the major PKC isoform in hematopoietic (9-12) and skeletal muscle cells (13;14). PKCθ is expressed at neuromuscular junctions (15) and is highly expressed in platelets (16-18). In their inactive conformations, most PKC proteins are localized in the cytosol and often associate with cytoskeletal proteins (19).

Background
Figure 4. PKCθ-associated signaling. TCR engagment induces Src, Syk, Zap70, and Tec protein kinase activation. PLC-gamma, PI3K, and Vav are recruited to the membrane. After TCR stimulation, PKCθ redistributes to the cSMAC, where it transduces activation signals leading to IL-2 production. NF-κB and AP-1 are the primary targets of PKCθ. See the text for more details.

Many functions have been ascribed to PKC kinases due to their widespread expression and variety of substrates (see Table 1 for a list of PKCθ substrates). PKCs are involved in receptor desensitization, modulating membrane structure events, regulating transcription, mediating immune responses, regulating cell growth, and in learning and memory. PKCθ has roles in the regulation of migration, lymphoid cell motility, insulin signaling in skeletal muscle cells, insulin secretion and resistance, T cell activation, survival responses in adult T cells and T cell FasL-mediated apoptosis (see the record for riogrande), mast cell activation, neuronal differentiation and function, development of the peripheral and central nervous system (10;20-30). PKCθ also has putative functions in mitosis and the cell cycle (15;31-34).

 

Table 1. PKCθ substrates

PKCθ substrate

Brief description

References

SPAK kinase

AP-1 signaling in T cells

(35)

CARMA1 (see the record for king)

NF-κB signaling in T cells

(36)

Moesin

Cytoskeletal protein that links intracellular signaling proteins to the actin cytoskeleton

(37)

WASP-interacting protein (WIP)

Actin cytoskeleton remodeling in antigen-stimulated T cells; inhibits WASP Cdc42-mediated activation

(38)

Insulin receptor substrate 1 (IRS1)

Adaptor protein that links the insulin receptor to its downstream effector; regulates myogenic signaling and myoblast differentiation

(39;40)

ERK1/2

Regulates myogenic signaling and myoblast differentiation

(40)

MARCKS (myristoylated alanine-rich C-kinase substrate)

Regulates energy balance, insulin signaling, food intake, and body weight

(41)

PKCθ

Regulates PKCθ activity and/or localization

(2;7)

 

TCR clustering and the IS

Activation of the T cell receptor results in cell proliferation, differentiation, cytokine production, and activation-induced cell death. Signaling through the T cell receptor (TCR) plays a critical role at multiple stages of thymocyte differentiation, T-cell activation, and homeostasis [reviewed in (42;43)]. TCRs are responsible for the recognition of major histocompatibility complex (MHC) class I and II, as well as other antigens found on the surface of antigen presenting cells (APCs). Binding of these ligands to the TCR initiates signaling and T cell activation (Figure 4). The TCR is composed of two separate peptide chains (TCRα/β for most T cells), and is complexed with a CD3 heterodimer (CD3εγ or CD3εδ; see the record for tumormouse) and a ζ homodimer (44). Signaling by the TCR complex depends on the phosphorylation of immunoreceptor tyrosine-based activation motifs (ITAMS) present on the CD3 and ζ chains [reviewed in (45;46)].  One of the first steps in TCR signaling is the recruitment of the tyrosine kinases Lck and Fyn to the receptor complex where they phosphorylate ITAMS. In the case of Lck, recruitment to the TCR complex depends on association with CD4, which recognizes MHC class II, or CD8, which recognizes MHC class I (47). Phosphorylation of the ITAM motifs results in recruitment of the ZAP-70 (ζ-chain-associated protein of 70 kDa) and Syk (spleen tyrosine kinase), which trans- and auto-phosphorylate, forming binding sites for SH2 domain- and protein tyrosine binding domain-containing proteins. ZAP-70 and Syk phosphorylate the linker for activation of T cells (LAT) and SH2 domain-containing leukocyte protein of 76 kDa (SLP-76). LAT serves as a docking site for a number of proteins including the adaptor proteins Src homologous and collagen (Shc) and growth factor receptor-bound (Grb) 2, phosphatidylinositol 3-kinase (PI3K), and phospholipase C (PLC). A number of these proteins also associate with and are activated by Lck (48). Eventually, the tyrosine phosphorylation cascade initiated by Lck culminates in the intracellular mobilization of calcium (Ca2+) ions and activation of important signaling cascades within the lymphocyte necessary for T cell activation and proliferation (45). These include the critical transcription factors NF-κB, NFAT (nuclear factor of activated T cells) and AP-1 (activator protein 1), which regulate the production of multiple cytokines, most notably interleukin-2 (IL-2).

 

PKCθ functions in T cell signaling at the immunological synapse. TCR activation promotes the translocation of PKCθ to the center of the immunological synapse (termed the central supramolecular activation cluster (cSMAC)). A high concentration of diacylglycerol at the cSMAC is required for PKCθ recruitment, and signals from CD28 are essential for PKCθ localization to the cSMAC (49). Activation of Vav, Rac and/or Cdc42, results in actin polymerization and TCR capping, which promotes PKCθ translocation to the TCR in the immunological synapse (50;51). PKCθ phosphorylates effector molecules that transduce signals and activate NF-κB, NFAT, and AP-1 (25;52-54). Upon activation, PKCθ-deficient T cells showed impaired proliferation, IL-2 production, and CD25 expression (52;53). At the immunological synapse, PKCθ-induced phosphorylation of Wiskott–Aldrich syndrome protein (WASP)-interacting protein (WIP) induces dissociation of WASP from the CrkL-WIP-WASP adaptor complex (38). WASP is subsequently activated by binding to GTP-bound Cdc42. Binding to Cdc42 induces a conformation change in WASP, which facilitates binding and activation of the Arp2/3 complex, which initiates actin polymerization.

 

T cell activation

CARMA1 (see the record for king) belongs to the membrane-associated guanylate kinase (MAGUK) protein family, whose members function as molecular scaffolds for the localized assembly of multiprotein complexes at the immunological synapse. Upon T cell activation by TCR and costimulatory molecule engagement, CARMA1 associates with a complex containing Bcl10 and MALT1 (Mucosa-Associated Lymphoid tissue lymphoma Translocation-associated gene 1; also known as MLT or Paracaspase; see the record for mousebird) and recruits these proteins to lipid rafts of the immunological synapse, where they activate the IKK complex, leading to degradation of IκB and subsequent activation of NF-κB (55-58). Upon lymphocyte activation, the linker domain of CARMA1 is phosphorylated at several sites (including Ser552, 555, 564, 565, 649, and 657) by PKCβ or PKCθ. These phosphorylation events are required for release of the inhibitory intramolecular CARD domain-linker domain interactions within CARMA1, allowing CARMA1 to assemble the CARMA1/Bcl10/MALT1 complex required to activate NF-κB (36;59). TCR stimulation also leads to CARMA1-dependent activation of c-Jun N-terminal kinase 2 (JNK2) (60).

 

LFA-1 (CD11a/CD18) signaling

PKCθ also mediates LFA-1 (CD11a/CD18)-associated signal transduction to the actin cytoskeleton (see the record joker for more information about CD18). LFA-1 and its ligands ICAM-1, -2, and -3 on antigen-presenting cells stabilize antigen-specific interactions between the T cell and the antigen presenting cell (61). PKCθ association with RapGEF2, and subsequent RapGEF2 phosphorylation, promote Rap1 activation. Activated Rap1 increases LFA-1 adhesiveness to ICAM-1 and an overall increase in T cell adhesiveness to the endothelium and antigen presenting cell (62).

 

T cell polarity

PKCθ functions in the establishment of T cell polarity. During formation of the immunological synapse, the microtubule-organizing center polarizes adjacent to the synapse. Polarization of the microtubule-organizing center establishes the axis of polarization and facilitates directional release of cytokines and cytolytic factors toward the antigen presenting cell (63). Diacylglycerol-mediated recruitment of PKCϵ and PKCη promotes the recruitment of PKCθ to the immune synapse, which is required for proper microtubule organizing center reorientation (64). PKCθ also regulates the formation of the distal pole complex, which is an immune synapse membrane projection containing cytoskeleton components (e.g., ezrin and moeisin) that is formed during T cell—antigen presenting cell recognition (65). PKCθ phosphorylates moesin, which is required for interaction of the ezrin-moiesing-radixin proteins with actin (66).

 

Tregs

PKCθ is sequestered from the Treg immunological synapse, which inhibits suppressive function (67). Blockade of PKCθ results in increased Treg function, protected Tregs from TNF-α (see the record for Panr1)-associated inactivation, restored the activity of defective Tregs from rheumatoid arthritis patients, and increased protection from inflammatory colitis in mice. PKCθ-deficient mice exhibited reduced numbers of CD4+Foxp3+ Treg cells (12). The loss in Treg number was not due to changes in cell survival. PKCθ is proposed to promote the development of Treg cells by increasing Foxp3 expression through activation of the calcineurin/NFAT pathway.

 

Th17 cells

PKCθ stabilizes the Th17 cell phenotype by suppressing the STAT4/IFN-γ/T-bet axis at the onset of differentiation and upregulating STAT3 (68;69). PKCθ-deficient CD4+ T cells displayed defective Th17 differentiation; forced expression of STAT3 resulted in rescue of Th17 differentiation (69). The PKCθ-deficient CD4+ T cells had normal Th17 marker gene expression (i.e., IL17a and RORγt [see the record for chestnut]) with increased production of Th1-typical markers (e.g., IFN-γ [see the record for marigold] and T-bet) (68).

 

Platelet activation and aggregation

PKCθ positively regulates the ‘outside-in’ signal transduction pathway associated with the platelet αIIbβ3 integrin receptor (70). Upon fibrinogen binding to the αIIbβ3 receptor on platelets, the platelets are activated, aggregate, and adhere to the site of vascular damage. Fibrinogen binding promotes an ‘outside-in’ signal that promotes actin polymerization and cytoskeleton alterations that are necessary for efficient platelet aggregation and spreading (71). Upon fibrinogen binding to the αIIbβ3 receptor, PKCθ associates and activates the protein tyrosine kinases Btk and Syk (see the record for poppy). PKCθ-mediated phosphorylation of WIP facilitates the uncoupling of WASP from the WIP—WASP complex, and the subsequent WASP-induced stimulation of Cdc42 and the activation of the Arp2/3 complex (72;73). In PKCθ-deficient mice, platelet aggregation and secretion were impaired (11).

 

Insulin resistance and obesity susceptibility

PKCθ mediates fat-induced insulin resistance in skeletal muscle (24). Accumulation of fat metabolites in skeletal muscle is proposed to activate PKCθ, and lead to defects in insulin signaling and glucose transport in the muscle. Loss of PKCθ expression prevented fat-induced defects in insulin signaling and glucose transport in skeletal muscle (24). A transgenic mouse expressing a muscle-specific dominant-negative PKCθ exhibited age- and obesity-associated glucose intolerance (74). PKCθ-deficient mice do not exhibit changes in body weight and food intake on normal chow diet (75). However, body fat content was increased with a corresponding decrease in body lean mass. PKCθ-deficient mice exhibited reduced energy expenditure and spontaneous physical activity. On a high fat diet, the body weight and fat content increased quickly in the PKCθ-deficient mice. After eight weeks on the high fat diet, the PKCθ-deficient mice exhibited insulin resistance.

 

Neuromuscular synapse

PKCθ-deficient mice did not exhibit defects in endplate morphology or the density of synaptic vesicles, but the myelin sheath in intramuscular nerve fibers was thinner than that in wild type mice (30). The PKCθ-deficient mice exhibited reduction in the size of evoked endplate potentials as well as in the frequency of spontaneous, asynchronous, miniature endplate potentials.

 

Myogenesis

PKCθ regulates cytoskeleton rearrangements during myogenesis. PKCθ also regulates myogenic signaling through IRS1 and ERK1/2 phosphorylation. During myogenesis, cytoskeletal actin is reorganized to promote the function of enzymatic and contractile apparatuses (76). PKCθ forms a complex with the transcription factor Nfix (NF one X-type) and MEF2A (myocyte-specific enhancer factor 2A). The PKCθ/Nfix/MEF2A complex controls the transcription of factors associated with fetal myogenesis, including MCK and β-enolase (77). PKCθ also promotes the phosphorylation of MARCKS (myristoylated alanine-rich C-kinase substrate 1), a protein that anchors the actin cytoskeleton to the plasma membrane (78;79). PKCθ-mediated phosphorylation of MARCKS modulates the interaction between MARCKS and the membrane, and indirectly affects the arrangement of the undermembrane actin cytoskeleton.

 

Mammary tumorigenesis

PKCθ activation inhibits the Foxo3a/ERalpha/p27 axis and induces c-Rel target genes to promote proliferation, survival, and more invasive breast cancer (80)

 

Human

Mutations in PRKCQ are linked to type 1 diabetes, rheumatoid arthritis, and celiac disease.

Putative Mechanism

B cell responses are classified as T-dependent (T-D) or T-independent (T-I) based on their requirement for T cell help in antibody production. T cell-dependent antigens are processed and presented to helper T cells via the MHC class II molecules, whereas T cell-independent antigens are typically polysaccharides that cannot be processed and presented by MHC molecules. These antigens are often expressed on the surface of pathogens in an organized, highly repetitive form that can activate specific B cells by cross-linking of antigen receptors. The formation of antigen receptor clusters can recruit and activate multiple Btk molecules, resulting in long-term mobilization of intracellular ionized Ca2+, gene transcription and B cell activation and proliferation. Toll-like receptor (TLR) engagement provides a second signal that allows the secretion of antibody in response to these antigens. The T-D B cell response is mediated by conventional (follicular B-2) B cells, while T-I B cell responses are mediated by peritoneal B-1 and marginal zone (MZ) B cells [reviewed by (81;82)]. The reduction of B cell antibody responses to OVA-alum in the celina mice suggests that the function of antigen processing may be impaired.

Primers PCR Primer
celina(F):5'- TGATGACACAGCTGCCACAC -3'
celina(R):5'- CACTCAAATGGAATCTAGTCACAG -3'

Sequencing Primer
celina_seq(F):5'- TGCCACACCCCATGAGAATTTC -3'
celina_seq(R):5'- TGTTAGTTGTAAAACTCAAAAGACCC -3'
References
Science Writers Anne Murray
Illustrators Katherine Timer
AuthorsJin Huk Choi, James Butler, Bruce Beutler
List |< first << previous [record 59 of 511] next >> last >|