Phenotypic Mutation 'costume'

• Allele: costume
• Mutation Type: splice site (3 bp from exon)
• Chromosome: 1
• Coordinate: 86,475,248 bp (GRCm39)
• Base Change: T ⇒ C (forward strand)
• Gene: Pde6d
• Gene Name: phosphodiesterase 6D, cGMP-specific, rod, delta
• Chromosomal Location: 86,470,716-86,510,351 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the delta subunit of rod-specific photoreceptor phosphodiesterase (PDE), a key enzyme in the phototransduction cascade. A similar protein in cow functions in solubilizing membrane-bound PDE. In addition to its role in the PDE complex, the encoded protein is thought to bind to prenyl groups of proteins to target them to subcellular organelles called cilia. Mutations in this gene are associated with Joubert syndrome-22. Alternative splicing results in multiple splice variants. [provided by RefSeq, Mar 2014] ; PHENOTYPE: Homozygous null mice exhibit progressive retinal degeneration with progressive loss of rod and cone neurons. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000027444 ^†] [ENSMUSP00000137956] [ENSMUSP00000137820 ^†] † probably from a misspliced transcript
• AlphaFold: O55057
• SMART Domains: Protein: ENSMUSP00000027444; Gene: ENSMUSG00000026239

Domain	Start	End	E-Value	Type
Pfam:GMP_PDE_delta	9	149	1e-48	PFAM

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000137956; Gene: ENSMUSG00000026239; AA Change: T48A

Domain	Start	End	E-Value	Type
Pfam:GMP_PDE_delta	7	64	4e-9	PFAM

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
  (Using ENSMUST00000143674)
• SMART Domains: Protein: ENSMUSP00000137820; Gene: ENSMUSG00000026239

Domain	Start	End	E-Value	Type
Pfam:GMP_PDE_delta	7	124	6.9e-41	PFAM

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000137820; Gene: ENSMUSG00000026239

Domain	Start	End	E-Value	Type
Pfam:GMP_PDE_delta	7	124	6.9e-41	PFAM

• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9755
• Is this an essential gene?: Possibly nonessential (E-score: 0.385)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-09-04 9:44 PM by Anne Murray
• Record Created: 2015-10-26 4:56 PM by Zhe Chen
• Record Posted: 2018-02-23
• Science Writers: Anne Murray
• Illustrators: Katherine Timer
• Authors: Zhe Chen, Jianhui Wang, Ryan Solts, Noelle Hutchins, Takuma Misawa, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_008801; MGI:1270843

Alleles Listed at MGI

All Mutations and Alleles(14) : Chemically induced (other)(1) Gene trapped(7) Radiation induced(1) Targeted(5)

Phenotypic Description

Figure 1. Costume mice exhibit body weights compared to wild-type littermates. Scaled body weights are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The costume phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R3084, some of which showed reduced body weights compared to wild-type littermates (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced body weight phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 43 mutations (X-axis) identified in the G1 male of pedigree R3084. Scaled body weight data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 43 mutations. The body weight phenotype was linked to a mutation in Pde6d: an A to G transition at base pair 86,547,526 (v38) on chromosome 1, or base pair 35,283 in the GenBank genomic region NC_000067 encoding Pde6d. Linkage was found with a recessive model of inheritance, wherein four variant homozygotes departed phenotypically from 19 homozygous reference mice and 22 heterozygous mice with a P value of 1.572 x 10^-6 (Figure 2).

The effect of the mutation at the cDNA and protein level have not examined, but the mutation is predicted to result in skipping of the 89-nucleotide exon 2 (out of 5 total exons), resulting in a frame-shifted protein product beginning after amino acid 17 and coding of a premature stop codon at amino after 53 aberrant amino acids (at amino acid 70).

<--exon 1       <--exon 2 intron 2-->          exon 3-->         <--exon 4 499 ……GGCTTCAAACT ……GTGGAACATGAAG gtactttgcagccccttg…… CCCGTGTGCCCAA……TGTGATCCCTAA…… 37035 14  ……-G--F--K--L ……-V--E--H--E--                      --P--C--A--Q-……-C--D--P--*-   70         correct        deleted                                   aberrant

The donor splice site of intron 2, which is destroyed by the costume mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. 

Protein Prediction

Figure 3. Domain organization of PDE6δ. The location of the costume mutation is indicated. Domain information is from SMART and UniProt.

Figure 4. Crystal structure of human PDE6δ complexed with Arl2-GTP. Figure was generated using UCSF Chimera, and was adapted from PDB:1KSG and Hanzal-Bayer, et al. 2002.

Pde6d encodes cGMP phosphodiesterase (PDE6δ; alternatively, PDEδ, PrBP/δ, or PDE6D), a member of the phosphodiesterase superfamily. The members of the phosphodiesterase superfamily regulate the concentrations of cAMP and cGMP in the cell (1).

PDE6δ is structurally similar to Rho GTPase guanine nucleotide dissociation inhibitor (RhoGDI) and UNC119 in that it forms an immunoglobulin-like β-sandwich fold composed of two β-sheets that form a hydrophobic pocket [Figure 3 & 4; (2); reviewed in (3)]. The N-terminal region of PDE6δ is an α-helix (α1), and a short 3₁₀ helix occurs in one of the loop regions [Figure 4; (4;5); PDB: 1KSG]. One β-sheet of the immunoglobulin-like β-sandwich fold is formed by four β-strands, and the other β-sheet is formed by five β-strands (5). The loop connecting β7 and β8 is disordered. The immunoglobulin-like β-sandwich fold mediates farnesyl (C15) and geranylgeranyl (C20) lipid binding (6).

The costume mutation is predicted to result in a frame-shifted protein that encodes a premature stop codon after amino acid 70.

Expression/Localization

PDE6δ is ubiquitously expressed (3;4), but it is highly expressed in both the rods and cone photoreceptor cells of the retina (6;7).

Background

Figure 4. PDE6δ is a chaperone involved in protein transport in the cell and cilia. High-affinity cargo such as INPP5E can be specifically released from PDE6δ by Arl3·GTP in the cilium. Low-affinity cargo such as Rheb can be released by Arl2·GTP. As a consequence, PDE6δ-free INPP5E can be specifically retained and thus be enriched in the ciliary compartment. Figure and legend adapted from Fansa et al. 2016 .

PDE6δ is a chaperone involved in the transport of a number of prenylated proteins (Table 1) to several sites in the cell, but predominantly in the cilia (6;8;9). Prenylation is the covalent addition of farnesyl or geranylgeranyl isoprenoids to the cysteine of a CAAX (C = cysteine, A = aliphatic amino acid, X = any amino acid) box in target cytosolic proteins through a thioether bond by cytosolic prenyl transferases (10;11). The “X” in the CAAX box determines that nature of the lipid chain; a leucine at that residue specifies geranylgeranylation, while all other residues promote farnesylation.

Table 1. Known PDE6δ interacting proteins

Protein	Brief Description	References
INPP5E (inositol polyphosphate-5-phosphatase E)	Hydrolyzes the 5′-phosphate of phosphatidylinositols; localizes to primary cilia	(12-14)
GRK1 (G protein-coupled receptor kinase 1)/GRK7	Kinase that phosphorylates rhodopsin and initiates its deactivation	(6;15;16)
Tγ (transducin)	G-protein in rod photoreceptors that activates phosphodiesterase upon rhodopsin activation	(15)
Rod PDE (PDEαβ)	Facilitates the breakdown of cGMP in rod photoreceptors after rhodopsin activation	(7;15;16)
RPGR (retinitis pigmentosa GTPase regulator)	Protein in rod photoreceptor outer segments that maintains cell viability	(17-20)
ARL2/ARL3	Release factors for prenylated cargo	(5;18;19)
Rac, Rap, Rho, Rheb, RhoA, RhoB, and Rho6	Prenylated G proteins of the Ras superfamily	(21;22)
Rab13	Small GTPase associated with vesicles in fibroblasts and epithelial cells	(23)
IP	Prostacyclin receptor. G protein-coupled receptor.	(24)

During PDE6δ-mediated sorting of prenylated proteins, PDE6δ binds the cargo and sorts it into the appropriate cellular compartment. The high-affinity cargo is released by ARL3 in the cilia; low-affinity cargo is released by ARL2 into the entire cell. A retention signal facilitates the retention of the prenylated cargo at the appropriate location in the cell (12).

Mutations in PDE6D are associated with Joubert syndrome (OMIM# #615665), a ciliopathy caused by defects in ciliary biogenesis and/or function. One such mutation in PDE6D is a null allele that causes defective trafficking of INPP5E to cilia (14). Patients with the null PDE6D mutation exhibit polydactyly, microphthalmia (i.e., developmental disorder of the eye in which one or both eyes are abnormally small and have anatomic malformations), coloboma (i.e., congenital malformation of the eye causing defects in the lens, iris, or retina), and renal hypoplasia.

Putative Mechanism

Pde6d-deficient (Pde6d^-/-) mice were viable and fertile, but exhibited reduced body sizes early in life (15). The Pde6d^-/- mice exhibited defective transport of GRK1, cone PDE6, and Tβγ to the outer segments of rod and cone photoreceptor of the retina, which caused a slowly progressive form of retinitis pigmentosa [reviewed in (3)]. Similar to the Pde6d^-/- mice, the costume mice exhibit reduced body size/weights compared to wild-type littermates indicating that PDE6δ^costume is a loss-of-function allele. The costume mice have not been examined for abnormalities of the retina.

Primers

PCR Primer
costume_pcr_F: CTCTCTGTGCAGCTGTCAGA
costume_pcr_R: AGTTCATGTCTCAGATGTTATGTAAC

Sequencing Primer
costume_seq_F: CTCAATCTGCAAAGTGCTGG
costume_seq_R: TTAAAAACCTCTGGAGTCAGCTGG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 760 nucleotides is amplified (chromosome 1, - strand):

1   agttcatgtc tcagatgtta tgtaacatgg tgtagattaa aaacctctgg agtcagctgg
61  gcttggtggc gcatgccttt aatcccagca ctcaggaggc agaggcaggc cgatttctga
121 gttccaggcc agcctggtct acaaagtgag ttccaggaca gggattgttc tcagagcctc
181 agtctcctta atcatacttg atcagaaatt ggatgaacct tcgggatgcc gaaacaggga
241 agatactctg gcaaggaaca gaagacctgt ctgtccctgg tgtggaacat gaaggtactt
301 tgcagcccct tgagtgtaca aactatgccc actgccagaa cagaccctgg catcaaggag
361 ctaagtaagc acgcagctac tagacaggtg agccctgcag gtgaaccgag agaacacttc
421 ttgttccatt tttacatttc cttctctcac ttcccaaatc caccttagct ctggaccatc
481 cccagatctg gatgtgatgg catgttcctg taatcccagc actttgcaga ttgagacaga
541 aagatcagga gttcaaggcc agcctcagct atatagttaa tttaaagcca atctggacca
601 catgaaacct tgtctcaaaa aggaaagaaa agggaagtta taatatttca actttttcca
661 gaagaaaatt ttcattttta tctttctgga ggaaaaaagg aaaggtaaat catttcaaga
721 aatcagagca taaagcaggc tctgacagct gcacagagag 

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Conti, M., and Beavo, J. (2007) Biochemistry and Physiology of Cyclic Nucleotide Phosphodiesterases: Essential Components in Cyclic Nucleotide Signaling. Annu Rev Biochem. 76, 481-511.

  2. Hoffman, G. R., Nassar, N., and Cerione, R. A. (2000) Structure of the Rho Family GTP-Binding Protein Cdc42 in Complex with the Multifunctional Regulator RhoGDI. Cell. 100, 345-356.

  3. Baehr, W. (2014) Membrane Protein Transport in Photoreceptors: The Function of PDEdelta: The Proctor Lecture. Invest Ophthalmol Vis Sci. 55, 8653-8666.

  4. Zhang, H., Constantine, R., Frederick, J. M., and Baehr, W. (2012) The Prenyl-Binding Protein PrBP/delta: A Chaperone Participating in Intracellular Trafficking. Vision Res. 75, 19-25.

  5. Hanzal-Bayer, M., Renault, L., Roversi, P., Wittinghofer, A., and Hillig, R. C. (2002) The Complex of Arl2-GTP and PDE Delta: From Structure to Function. EMBO J. 21, 2095-2106.

  6. Zhang, H., Liu, X. H., Zhang, K., Chen, C. K., Frederick, J. M., Prestwich, G. D., and Baehr, W. (2004) Photoreceptor cGMP Phosphodiesterase Delta Subunit (PDEdelta) Functions as a Prenyl-Binding Protein. J Biol Chem. 279, 407-413.

  7. Florio, S. K., Prusti, R. K., and Beavo, J. A. (1996) Solubilization of Membrane-Bound Rod Phosphodiesterase by the Rod Phosphodiesterase Recombinant Delta Subunit. J Biol Chem. 271, 24036-24047.

  8. Ismail, S. A., Chen, Y. X., Rusinova, A., Chandra, A., Bierbaum, M., Gremer, L., Triola, G., Waldmann, H., Bastiaens, P. I., and Wittinghofer, A. (2011) Arl2-GTP and Arl3-GTP Regulate a GDI-Like Transport System for Farnesylated Cargo. Nat Chem Biol. 7, 942-949.

  9. Cook, T. A., Ghomashchi, F., Gelb, M. H., Florio, S. K., and Beavo, J. A. (2000) Binding of the Delta Subunit to Rod Phosphodiesterase Catalytic Subunits Requires Methylated, Prenylated C-Termini of the Catalytic Subunits. Biochemistry. 39, 13516-13523.

  10. Magee, T., and Seabra, M. C. (2005) Fatty Acylation and Prenylation of Proteins: What's Hot in Fat. Curr Opin Cell Biol. 17, 190-196.

  11. Zhang, F. L., and Casey, P. J. (1996) Protein Prenylation: Molecular Mechanisms and Functional Consequences. Annu Rev Biochem. 65, 241-269.

  12. Fansa, E. K., Kosling, S. K., Zent, E., Wittinghofer, A., and Ismail, S. (2016) PDE6delta-Mediated Sorting of INPP5E into the Cilium is Determined by Cargo-Carrier Affinity. Nat Commun. 7, 11366.

  13. Humbert, M. C., Weihbrecht, K., Searby, C. C., Li, Y., Pope, R. M., Sheffield, V. C., and Seo, S. (2012) ARL13B, PDE6D, and CEP164 Form a Functional Network for INPP5E Ciliary Targeting. Proc Natl Acad Sci U S A. 109, 19691-19696.

  14. Thomas, S., Wright, K. J., Le Corre, S., Micalizzi, A., Romani, M., Abhyankar, A., Saada, J., Perrault, I., Amiel, J., Litzler, J., Filhol, E., Elkhartoufi, N., Kwong, M., Casanova, J. L., Boddaert, N., Baehr, W., Lyonnet, S., Munnich, A., Burglen, L., Chassaing, N., Encha-Ravazi, F., Vekemans, M., Gleeson, J. G., Valente, E. M., Jackson, P. K., Drummond, I. A., Saunier, S., and Attie-Bitach, T. (2014) A Homozygous PDE6D Mutation in Joubert Syndrome Impairs Targeting of Farnesylated INPP5E Protein to the Primary Cilium. Hum Mutat. 35, 137-146.

  15. Zhang, H., Li, S., Doan, T., Rieke, F., Detwiler, P. B., Frederick, J. M., and Baehr, W. (2007) Deletion of PrBP/delta Impedes Transport of GRK1 and PDE6 Catalytic Subunits to Photoreceptor Outer Segments. Proc Natl Acad Sci U S A. 104, 8857-8862.

  16. Zhang, H., Hanke-Gogokhia, C., Jiang, L., Li, X., Wang, P., Gerstner, C. D., Frederick, J. M., Yang, Z., and Baehr, W. (2015) Mistrafficking of Prenylated Proteins Causes Retinitis Pigmentosa 2. FASEB J. 29, 932-942.

  17. Lee, J. J., and Seo, S. (2015) PDE6D Binds to the C-Terminus of RPGR in a Prenylation-Dependent Manner. EMBO Rep. 16, 1581-1582.

  18. Watzlich, D., Vetter, I., Gotthardt, K., Miertzschke, M., Chen, Y. X., Wittinghofer, A., and Ismail, S. (2013) The Interplay between RPGR, PDEdelta and Arl2/3 Regulate the Ciliary Targeting of Farnesylated Cargo. EMBO Rep. 14, 465-472.

  19. Linari, M., Ueffing, M., Manson, F., Wright, A., Meitinger, T., and Becker, J. (1999) The Retinitis Pigmentosa GTPase Regulator, RPGR, Interacts with the Delta Subunit of Rod Cyclic GMP Phosphodiesterase. Proc Natl Acad Sci U S A. 96, 1315-1320.

  20. Rao, K. N., Zhang, W., Li, L., Anand, M., and Khanna, H. (2016) Prenylated Retinal Ciliopathy Protein RPGR Interacts with PDE6delta and Regulates Ciliary Localization of Joubert Syndrome-Associated Protein INPP5E. Hum Mol Genet. 25, 4533-4545.

  21. Chandra, A., Grecco, H. E., Pisupati, V., Perera, D., Cassidy, L., Skoulidis, F., Ismail, S. A., Hedberg, C., Hanzal-Bayer, M., Venkitaraman, A. R., Wittinghofer, A., and Bastiaens, P. I. (2011) The GDI-Like Solubilizing Factor PDEdelta Sustains the Spatial Organization and Signalling of Ras Family Proteins. Nat Cell Biol. 14, 148-158.

  22. Nancy, V., Callebaut, I., El Marjou, A., and de Gunzburg, J. (2002) The Delta Subunit of Retinal Rod cGMP Phosphodiesterase Regulates the Membrane Association of Ras and Rap GTPases. J Biol Chem. 277, 15076-15084.

  23. Marzesco, A. M., Galli, T., Louvard, D., and Zahraoui, A. (1998) The Rod cGMP Phosphodiesterase Delta Subunit Dissociates the Small GTPase Rab13 from Membranes. J Biol Chem. 273, 22340-22345.

  24. Wilson, S. J., and Smyth, E. M. (2006) Internalization and Recycling of the Human Prostacyclin Receptor is Modulated through its Isoprenylation-Dependent Interaction with the Delta Subunit of cGMP Phosphodiesterase 6. J Biol Chem. 281, 11780-11786.