Phenotypic Mutation 'costume' (pdf version)
List [record 1 of 18] next >> last >|
Allelecostume
Mutation Type splice donor site (3 bp from exon)
Chromosome1
Coordinate86,547,526 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Pde6d
Gene Name phosphodiesterase 6D, cGMP-specific, rod, delta
Chromosomal Location 86,542,994-86,582,629 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the delta subunit of rod-specific photoreceptor phosphodiesterase (PDE), a key enzyme in the phototransduction cascade. A similar protein in cow functions in solubilizing membrane-bound PDE. In addition to its role in the PDE complex, the encoded protein is thought to bind to prenyl groups of proteins to target them to subcellular organelles called cilia. Mutations in this gene are associated with Joubert syndrome-22. Alternative splicing results in multiple splice variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous null mice exhibit progressive retinal degeneration with progressive loss of rod and cone neurons. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_008801; MGI:1270843

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000027444] [ENSMUSP00000137956] [ENSMUSP00000137820]
SMART Domains Protein: ENSMUSP00000027444
Gene: ENSMUSG00000026239

DomainStartEndE-ValueType
Pfam:GMP_PDE_delta 9 149 1e-48 PFAM
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000137956
Gene: ENSMUSG00000026239
AA Change: T48A

DomainStartEndE-ValueType
Pfam:GMP_PDE_delta 7 64 4e-9 PFAM
Predicted Effect probably benign

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
(Using ENSMUST00000143674)
SMART Domains Protein: ENSMUSP00000137820
Gene: ENSMUSG00000026239

DomainStartEndE-ValueType
Pfam:GMP_PDE_delta 7 124 6.9e-41 PFAM
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
Body Weight - decreased 17496142
Body Weight (Female) - decreased 17496142
Body Weight (Male) - decreased 17496142
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(14) : Chemically induced (other)(1) Gene trapped(7) Radiation induced(1) Targeted(5)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0879:Pde6d UTSW 1 86545801 missense probably benign 0.04
R1446:Pde6d UTSW 1 86546692 missense probably damaging 0.99
R2018:Pde6d UTSW 1 86546716 missense probably damaging 1.00
R2118:Pde6d UTSW 1 86545802 missense probably benign 0.10
R2119:Pde6d UTSW 1 86545802 missense probably benign 0.10
R2120:Pde6d UTSW 1 86545802 missense probably benign 0.10
R2122:Pde6d UTSW 1 86545802 missense probably benign 0.10
R3084:Pde6d UTSW 1 86547526 splice site probably null
R3085:Pde6d UTSW 1 86547526 splice site probably null
R6824:Pde6d UTSW 1 86545763 missense possibly damaging 0.49
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2018-09-05 8:43 AM by Anne Murray
Record Created 2015-10-26 4:56 PM by Zhe Chen
Record Posted 2018-02-23
Phenotypic Description

Figure 1. Costume mice exhibit body weights compared to wild-type littermates. Scaled body weights are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The costume phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R3084, some of which showed reduced body weights compared to wild-type littermates (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced body weight phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 43 mutations (X-axis) identified in the G1 male of pedigree R3084. Scaled body weight data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 43 mutations. The body weight phenotype was linked to a mutation in Pde6d: an A to G transition at base pair 86,547,526 (v38) on chromosome 1, or base pair 35,283 in the GenBank genomic region NC_000067 encoding Pde6d. Linkage was found with a recessive model of inheritance, wherein four variant homozygotes departed phenotypically from 19 homozygous reference mice and 22 heterozygous mice with a P value of 1.572 x 10-6 (Figure 2).

 

The effect of the mutation at the cDNA and protein level have not examined, but the mutation is predicted to result in skipping of the 89-nucleotide exon 2 (out of 5 total exons), resulting in a frame-shifted protein product beginning after amino acid 17 and coding of a premature stop codon at amino after 53 aberrant amino acids (at amino acid 70).

 

        <--exon 1       <--exon 2 intron 2-->          exon 3-->         <--exon 4
499 ……GGCTTCAAACT ……GTGGAACATGAAG gtactttgcagccccttg…… CCCGTGTGCCCAA……TGTGATCCCTAA…… 37035

14  ……-G--F--K--L ……-V--E--H--E--                      --P--C--A--Q-……-C--D--P--*-   70

        correct        deleted                                   aberrant

 

The donor splice site of intron 2, which is destroyed by the costume mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. 

Protein Prediction

Figure 3. Domain organization of PDE6δ. The location of the costume mutation is indicated. Domain information is from SMART and UniProt.

Figure 4. Crystal structure of human PDE6δ complexed with Arl2-GTP. Figure was generated using UCSF Chimera, and was adapted from PDB:1KSG and Hanzal-Bayer, et al. 2002.

Pde6d encodes cGMP phosphodiesterase (PDE6δ; alternatively, PDEδ, PrBP/δ, or PDE6D), a member of the phosphodiesterase superfamily. The members of the phosphodiesterase superfamily regulate the concentrations of cAMP and cGMP in the cell (1).

 

PDE6δ is structurally similar to Rho GTPase guanine nucleotide dissociation inhibitor (RhoGDI) and UNC119 in that it forms an immunoglobulin-like β-sandwich fold composed of two β-sheets that form a hydrophobic pocket [Figure 3 & 4; (2); reviewed in (3)]. The N-terminal region of PDE6δ is an α-helix (α1), and a short 310 helix occurs in one of the loop regions [Figure 4; (4;5); PDB: 1KSG]. One β-sheet of the immunoglobulin-like β-sandwich fold is formed by four β-strands, and the other β-sheet is formed by five β-strands (5). The loop connecting β7 and β8 is disordered. The immunoglobulin-like β-sandwich fold mediates farnesyl (C15) and geranylgeranyl (C20) lipid binding (6).

 

The costume mutation is predicted to result in a frame-shifted protein that encodes a premature stop codon after amino acid 70.

Expression/Localization

PDE6δ is ubiquitously expressed (3;4), but it is highly expressed in both the rods and cone photoreceptor cells of the retina (6;7).

Background
Figure 4. PDE6δ is a chaperone involved in protein transport in the cell and cilia. High-affinity cargo such as INPP5E can be specifically released from PDE6δ by Arl3·GTP in the cilium. Low-affinity cargo such as Rheb can be released by Arl2·GTP. As a consequence, PDE6δ-free INPP5E can be specifically retained and thus be enriched in the ciliary compartment. Figure and legend adapted from Fansa et al. 2016.

PDE6δ is a chaperone involved in the transport of a number of prenylated proteins (Table 1) to several sites in the cell, but predominantly in the cilia (6;8;9). Prenylation is the covalent addition of farnesyl or geranylgeranyl isoprenoids to the cysteine of a CAAX (C = cysteine, A = aliphatic amino acid, X = any amino acid) box in target cytosolic proteins through a thioether bond by cytosolic prenyl transferases (10;11). The “X” in the CAAX box determines that nature of the lipid chain; a leucine at that residue specifies geranylgeranylation, while all other residues promote farnesylation.

 

Table 1. Known PDE6δ interacting proteins

Protein

Brief Description

References

INPP5E (inositol polyphosphate-5-phosphatase E)

Hydrolyzes the 5′-phosphate of phosphatidylinositols; localizes to primary cilia

(12-14)

GRK1 (G protein-coupled receptor kinase 1)/GRK7

Kinase that phosphorylates rhodopsin and initiates its deactivation

(6;15;16)

Tγ (transducin)

G-protein in rod photoreceptors that activates phosphodiesterase upon rhodopsin activation

(15)

Rod PDE (PDEαβ)

Facilitates the breakdown of cGMP in rod photoreceptors after rhodopsin activation

(7;15;16)

RPGR (retinitis pigmentosa GTPase regulator)

Protein in rod photoreceptor outer segments that maintains cell viability

(17-20)

ARL2/ARL3

Release factors for prenylated cargo

(5;18;19)

Rac, Rap, Rho, Rheb, RhoA, RhoB, and Rho6

Prenylated G proteins of the Ras superfamily

(21;22)

 

Rab13

Small GTPase associated with vesicles in fibroblasts and epithelial cells

(23)

IP

Prostacyclin receptor. G protein-coupled receptor.

(24)

 

During PDE6δ-mediated sorting of prenylated proteins, PDE6δ binds the cargo and sorts it into the appropriate cellular compartment. The high-affinity cargo is released by ARL3 in the cilia; low-affinity cargo is released by ARL2 into the entire cell. A retention signal facilitates the retention of the prenylated cargo at the appropriate location in the cell (12).

 

Mutations in PDE6D are associated with Joubert syndrome (OMIM# #615665), a ciliopathy caused by defects in ciliary biogenesis and/or function. One such mutation in PDE6D is a null allele that causes defective trafficking of INPP5E to cilia (14). Patients with the null PDE6D mutation exhibit polydactyly, microphthalmia (i.e., developmental disorder of the eye in which one or both eyes are abnormally small and have anatomic malformations), coloboma (i.e., congenital malformation of the eye causing defects in the lens, iris, or retina), and renal hypoplasia.

Putative Mechanism

Pde6d-deficient (Pde6d-/-) mice were viable and fertile, but exhibited reduced body sizes early in life (15). The Pde6d-/- mice exhibited defective transport of GRK1, cone PDE6, and Tβγ to the outer segments of rod and cone photoreceptor of the retina, which caused a slowly progressive form of retinitis pigmentosa [reviewed in (3)]. Similar to the Pde6d-/- mice, the costume mice exhibit reduced body size/weights compared to wild-type littermates indicating that PDE6δcostume is a loss-of-function allele. The costume mice have not been examined for abnormalities of the retina.

 

Primers PCR Primer
costume(F):5'- CTCTCTGTGCAGCTGTCAGA -3'
costume(R):5'- AGTTCATGTCTCAGATGTTATGTAAC -3'

Sequencing Primer
costume_seq(F):5'- CTCAATCTGCAAAGTGCTGG -3'
costume_seq(R):5'- TTAAAAACCTCTGGAGTCAGCTGG -3'
References
Science Writers Anne Murray
Illustrators Katherine Timer
AuthorsZhe Chen, Jianhui Wang, Ryan Solts, Noelle Hutchins, Takuma Misawa, and Bruce Beutler
List [record 1 of 18] next >> last >|