Phenotypic Mutation 'Copacabana' (pdf version)
List |< first << previous [record 75 of 511] next >> last >|
AlleleCopacabana
Mutation Type critical splice donor site (2 bp from exon)
Chromosome14
Coordinate20,530,942 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Ppp3cb
Gene Name protein phosphatase 3, catalytic subunit, beta isoform
Synonym(s) Calnb, PP2BA beta, Cnab, CnAbeta, 1110063J16Rik
Chromosomal Location 20,499,364-20,546,573 bp (-)
MGI Phenotype Homozygous null mice have small hearts and thymi, and reduced body weight. Cardiac function is normal, but mice lack a cardiac hypertrophic response to pressure overload, angiotensin II, or isopreteronol. Thymi are hypoplastic, with abnormal T cell development and reduced numbers of T cells.
Accession Number

NCBI RefSeq: NM_008914 (variant 1), NM_001310426 (variant 2), NM_001310427 (variant 3); MGI:107163

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000022355] [ENSMUSP00000125722] [ENSMUSP00000125630] [ENSMUSP00000125582]
SMART Domains Protein: ENSMUSP00000022355
Gene: ENSMUSG00000021816

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
PP2Ac 65 356 5.03e-166 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000125722
Gene: ENSMUSG00000021816

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
PP2Ac 65 356 5.03e-166 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000125630
Gene: ENSMUSG00000021816

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
PP2Ac 65 356 5.03e-166 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000125582
Gene: ENSMUSG00000021816

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
PP2Ac 65 356 5.03e-166 SMART
low complexity region 487 497 N/A INTRINSIC
Predicted Effect probably null
Phenotypic Category Circadian defect: decreased wheel revs/24H, decrease in CD4+ T cells, decrease in CD8+ T cells, decrease in T cells, DSS: sensitive day 10, increase in B:T cells, increase in CD44 MFI in CD8, increase in central memory CD8 T cells in CD8 T cells, increase in NK cells
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(28) : Gene trapped(25) Targeted(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00702:Ppp3cb APN 14 20528250 missense probably benign 0.00
IGL00844:Ppp3cb APN 14 20531686 missense probably benign 0.00
IGL01859:Ppp3cb APN 14 20509449 missense possibly damaging 0.80
IGL02490:Ppp3cb APN 14 20531658 splice site 0.00
IGL02546:Ppp3cb APN 14 20501554 missense probably benign 0.00
IGL02555:Ppp3cb APN 14 20530953 missense probably damaging 1.00
IGL02724:Ppp3cb APN 14 20523577 splice site 0.00
IGL02944:Ppp3cb APN 14 20528235 missense probably damaging 1.00
IGL03072:Ppp3cb APN 14 20531725 missense possibly damaging 0.80
IGL03301:Ppp3cb APN 14 20523984 missense probably damaging 0.99
everglades UTSW 14 20530948 missense possibly damaging 0.94
prokopios UTSW 14 20520652 missense probably benign 0.05
Redwood UTSW 14 20509440 missense probably damaging 1.00
R0026:Ppp3cb UTSW 14 20531768 missense probably benign 0.00
R0050:Ppp3cb UTSW 14 20531752 missense possibly damaging 0.82
R0050:Ppp3cb UTSW 14 20531752 missense possibly damaging 0.82
R0218:Ppp3cb UTSW 14 20523976 missense probably damaging 0.98
R0479:Ppp3cb UTSW 14 20503241 splice donor site probably benign
R1013:Ppp3cb UTSW 14 20524004 missense probably benign 0.00
R1061:Ppp3cb UTSW 14 20508614 splice donor site probably null
R1498:Ppp3cb UTSW 14 20509499 critical splice acceptor site probably null
R1508:Ppp3cb UTSW 14 20524424 missense probably damaging 0.99
R1719:Ppp3cb UTSW 14 20524063 missense probably benign 0.05
R1799:Ppp3cb UTSW 14 20524472 missense probably benign 0.10
R1883:Ppp3cb UTSW 14 20523845 missense possibly damaging 0.66
R2082:Ppp3cb UTSW 14 20508678 missense possibly damaging 0.66
R2176:Ppp3cb UTSW 14 20520652 missense probably benign 0.05
R2215:Ppp3cb UTSW 14 20531077 splice acceptor site probably benign
R3021:Ppp3cb UTSW 14 20523853 nonsense probably null
R3726:Ppp3cb UTSW 14 20530942 critical splice donor site probably null
R4085:Ppp3cb UTSW 14 20508543 missense possibly damaging 0.73
R4328:Ppp3cb UTSW 14 20530948 missense probably damaging 1.00
R4376:Ppp3cb UTSW 14 20523921 missense noncoding transcript
R4509:Ppp3cb UTSW 14 20515501 missense noncoding transcript
R4600:Ppp3cb UTSW 14 20520646 missense possibly damaging 0.60
R4601:Ppp3cb UTSW 14 20520646 missense possibly damaging 0.60
R4603:Ppp3cb UTSW 14 20520646 missense possibly damaging 0.60
R4610:Ppp3cb UTSW 14 20520646 missense possibly damaging 0.60
R4611:Ppp3cb UTSW 14 20520646 missense possibly damaging 0.60
R4694:Ppp3cb UTSW 14 20501515 missense probably benign 0.00
R4749:Ppp3cb UTSW 14 20524062 missense probably damaging 1.00
R4866:Ppp3cb UTSW 14 20523843 missense probably damaging 1.00
R4911:Ppp3cb UTSW 14 20509440 missense probably damaging 1.00
R5105:Ppp3cb UTSW 14 20509422 missense possibly damaging 0.84
R5219:Ppp3cb UTSW 14 20528195 nonsense probably null
R5479:Ppp3cb UTSW 14 20503281 missense noncoding transcript
R5586:Ppp3cb UTSW 14 20520690 missense noncoding transcript
R5740:Ppp3cb UTSW 14 20501596 missense possibly damaging 0.76
Mode of Inheritance Autosomal Semidominant
Local Stock
Repository
Last Updated 05/12/2017 11:17 AM by Anne Murray
Record Created 11/03/2015 8:56 AM by Bruce Beutler
Record Posted 01/20/2017
Phenotypic Description

Figure 1. Copacabana mice exhibit an increased B:T cell ratio. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Copacabana mice exhibit a reduced frequency of peripheral blood T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Copacabana mice exhibit a reduced frequency of peripheral blood CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD4+ T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Copacabana mice exhibit a reduced frequency of peripheral blood CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD8+ T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Copacabana mice exhibit an increased frequency of peripheral blood central memory CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD8+ T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Copacabana mice exhibit an increased mean fluorescence intensity (MFI) of CD44 on peripheral blood CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD8+ T cell CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Copacabana mice exhibit increased frequencies of peripheral blood natural killer (NK) cells. Flow cytometric analysis of peripheral blood was utilized to determine NK cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Copacabana phenotype was identified among G3 mice of the pedigree R3726, some of which showed an increase in the B:T cell ratio (Figure 1) due to a reduced frequency of T cells (Figure 2) including CD4+ T cells (Figure 3) and CD8+ T cells (Figure 4), and an increased frequency of central memory CD8+ T cells (Figure 5), all in the peripheral blood. Some mice also showed increased expression of CD44 on CD8+ T cells (Figure 6) and an increased frequency of NK cells (Figure 7) in the peripheral blood.

Nature of Mutation

Figure 8. Linkage mapping of the reduced frequency of peripheral blood CD8+ T cells using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 53 mutations (X-axis) identified in the G1 male of pedigree R3726. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 53 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Ppp3cb:  a T to C transition at base pair 20,530,942 (v38) on chromosome 14, or base pair 15,632 in the GenBank genomic region NC_000080 encoding Ppp3cb. The mutation is within the donor splice site of intron 3, two base pairs from exon 3 (out of 14 total exons). The strongest association was found with an additive model of linkage to the normalized frequency of peripheral blood CD8+ T cells, wherein 12 variant homozygotes and 36 heterozygotes departed phenotypically from 17 homozygous reference mice with a P value of 2.435 x 10-9 (Figure 8). A substantial semidominant effect was observed in most of the assays. The effect of the mutation at the cDNA and protein level have not examined, but the mutation is predicted to result in use of a cryptic splice site in intron 3, resulting in a 67-base pair insertion of intron 3. The insertion would result in a frame-shifted protein product beginning after amino acid 137 of the protein, which is normally 525 amino acids in length, and terminating after the inclusion of seven aberrant amino acids.

 

               <--exon 2         <--exon 3 intron 3-->            exon 4-->       <--exon 14
14899 ……GAAGCTCCAATTACAG ……TATTTTAGTATAGAG gtaataatcatatctgtcat…… TGTGTCTTATAT……AGTGCCCAGTGA 45090
91    ……-E--A--P--I--T-- ……-Y--F--S--I--E-                        -C--V--L--Y-……-S--A--Q--*-   525
                                              correct

 
               <--exon 2         <--exon 3 intron 3-->            exon 4--> 
14899 ……GAAGCTCCAATTACAG ……TATTTTAGTATAGAG gtaataatcatatctgtcat…… TGTGTCTTATATTTATGGGTCTTGA 18329
91    ……-E--A--P--I--T-- ……-Y--F--S--I--E-                        --V--S--Y--I--Y--G--S--*-   144

                      correct                                              aberrant

 

Genomic numbering corresponds to NC_000080. The donor splice site of intron 3, which is destroyed by the Copacabana mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. 

Protein Prediction
Figure 9. Domain structure of CnAβ. The location of the Copacabana mutation is indicated. Abbreviations: PP, poly-pro; the CnB-binding domains are indicated by a "1" and "2"; CaM, calmodulin-binding domain; Inh, inhbitory. This image is interactive; click to view other mutations.

Calcineurin (alternatively, PP2B) is a calcium- and calmodulin (CaM)-dependent serine/threonine protein phosphatase. Calcineurin has a catalytic subunit and a regulatory calcium-binding subunit, termed calcineurin A (CnA) and calcineurin B (CnB), respectively. Three genes (CnAα, CnAβ, and CnAγ) encode calcineurin catalytic subunits, while two genes (CnB1 and CnB2) encode calcineurin regulatory subunits in mammals. Ppp3cb encodes calcineurin Aβ (CnAβ), a calcineurin catalytic subunit isoform.

 

All of the CnA proteins (CnAα, CnAβ, and CnAγ) have a catalytic domain (amino acids 2-310 in CnAβ) that is highly homologous to other serine/threonine protein phosphatases (Figure 9). The CnAβ catalytic subunit has a poly-proline motif (amino acids 11-20 in CnAβ) within the catalytic domain (1). The CnA proteins have three C-terminal regulatory domains that include a CnB binding domain (amino acids 256-262 and 305-310 in CnAβ), a CaM-binding domain (amino acids 401-423 in CnAβ), and an autoinhibitory domain (amino acids 474-496 in CnAβ) (1;2). The CaM- and the CnB-binding domains are required for calcineurin association with tau, a neuronal protein that is associated with Alzheimer’s disease (3). CaM binding impairs the association between calcineurin and tau. The autoinhibitory domain binds in the active site cleft in the absence of Ca2+/CaM to inhibit the enzyme (4). Upon Ca2+/CaM binding, inhibition is removed due to a conformation change that exposes the active site. The CnA proteins differ at the N- and C-termini; the sequence differences are proposed to mediate substrate recognition and/or localization.

 

CnAβ can be phosphorylated by protein kinase C, casein kinase I, and casein kinase II (5-7). Ppp3cb can be alternatively spliced upon insulin-like growth factor 1 induction to generate a CnAβ1 isoform (8). The CnAβ1 isoform does not have an autoinhibitory domain, and contains a unique C-terminal domain to CnAβ (9). The CnAβ1 isoform improves cardiac function after myocardial infarction by reducing inflammation and scar formation (9). In skeletal muscle, the CnAβ1 isoform is essential for myoblast proliferation, stimulates regeneration, and accelerates the resolution of inflammation (8).

 

The Copacabana mutation is predicted to result in aberrant splicing leading to a frame-shift and coding of a premature stop codon after amino acid 144 within the catalytic domain of the encoded protein.

Expression/Localization

CnAβ, CnAα, and CnB1 are ubiquitously expressed, while CnAγ and CnB2 are expressed in the testis and portions of the brain (10;11). In the rat brain and heart, CnAα is more abundantly expressed than CnAβ. CnAβ is more abundantly expressed than CnAα in the spleen, thymus, and lymphocytes (12). CnAβ expression in the heart is increased by stress, agonist stimulation, or growth factor stimulation (13-15). CnAβ is also activated by high glucose (16).  

Background
Figure 10. TCR signaling pathway. TCRs are responsible for the recognition of major histocompatibility complex (MHC) class I and II, as well as other antigens found on the surface of antigen presenting cells (APCs).  Binding of these ligands to the TCR initiates signaling and T cell activation. The TCR is composed of two separate peptide chains (TCRα/β), and is complexed with a CD3 heterodimer (CD3εγ or CD3εδ) and a ζ homodimer. One of the first steps in TCR signaling is the recruitment of the tyrosine kinases Lck and Fyn to the receptor complex. Lck and Fyn are regulated by the phosphorylation of two key tyrosine residues, an activating tyrosine located in the activation loop, and an inhibitory tyrosine located in the C-terminal tail.  CD45 dephosphorylates the C-terminal inhibitory tyrosine, thereby promoting the activation of Lck and Fyn. Once activated, they phosphorylate ITAMS present on the CD3 and ζ chains. Phosphorylation of the ITAM motifs results in recruitment of ZAP-70 and Syk, which trans- and auto-phosphorylate to form binding sites for SH2 domain- and protein tyrosine binding domain-containing proteins. The Syk family kinases phosphorylate LAT and SLP-76. LAT binds to the adaptor proteins growth factor receptor-bound 2(Grb2), Src homologous and collagen (Shc) and GRB2-related adaptor downstream of Shc (Gads), as well as phosphatidylinositol 3-kinase (PI3K) and PLC-γ1.  SLP-76 is then recruited to the complex via Gads and binds the guanine nucleotide exchange factor Vav1, Nck (non-catalytic region of tyrosine kinase adaptor protein), IL-2-induced tyrosine kinase (Itk), PLC-γ1, adhesion and degranulation-promoting adaptor protein (ADAP), and hematopoietic progenitor kinase 1 (HPK1).  This proximal signaling complex is required for PLC-γ1-dependent pathways including calcium (Ca2+) mobilization and diacylglycerol (DAG)-induced responses, cytoskeleton rearrangements, and integrin activation pathways.  Activated PLC-γ1 hydrolyzes the membrane lipid phosphatidylinositol-3,4-diphosphate (PIP2) to inositol-1,4,5-trisphosphate (IP3) and DAG resulting in Ca2+-dependent signal transduction including activation of nuclear factor of activated T cells (NF-AT), and activation of protein kinase Cθ and Ras, respectively.  PKCθ regulates nuclear factor-κB activation via the trimolecular complex composed of Bcl10, mucosa-associated lymphoid tissue translocation gene 1 (MALT1), and caspase recruitment domain family, member 11 (CARMA1). Ras initiates a mitogen-associated protein kinase (MAPK) phosphorylation cascade culminating in the activation of various transcription factors.

Calcineurin has functions in T cell activation, activation-induced cell death (AICD), T cell tolerance, ion channel regulation, cardiac myocyte hypertrophy, sperm motility, synaptic endocytosis, and Alzheimer’s disease (17-20). In lymphocytes, antigen engagement of lymphocyte receptors promotes the activation of phospholipase C-γ (PLC-γ) (Figure 10). Activated PLC-γ hydrolyzes phosphatidylinositol-4,5-bisphosphate into inositol-1,4,5-trisphosphate (IP3) and diacylglycerol. IP3 then binds to receptors on the endoplasmic reticulum and drives Ca2+ release from the endoplasmic reticulum into the cytoplasm, which triggers opening of Ca2+ release-activated Ca2+ channels. Calcineurin is activated by binding of CaM in response to sustained increased levels of intracellular calcium (11;21). Upon calcineurin activation, it dephosphorylates members of the nuclear factor of activated T cells (NFAT) family, promoting their translocation from the cytosol to the nucleus and subsequent induction of the transcription of NFAT target genes such as IL-2 growth factor, IFN-γ, and IL-4. The immunosuppressive drugs cyclosporine A and FK506 inhibit calcineurin, subsequently preventing NFAT nuclear translocation and the induction of cytokine gene expression (10;11;21). In addition to cytokine production, calcineurin-NFAT signaling mediates T cell maturation, synaptic transmission in neurons, vascular patterning in embryonic development, hypertrophic growth of the heart, and regulation of oxidative/slow fiber content in glycolytic/fast muscles (i.e., gastrocnemius, tibialis anterior, biceps, and triceps) (22;23). Calcineurin has a several functions including a role in apoptosis of T and B cells (24-26) and neuronal cells (27). In lymphocytes, calcineurin and NFAT function in apoptosis by mediating the induction of Fas (see the record for cherry) and FasL (see the record for riogrande), which transduce an apoptotic signal upon T cell activation (28;29). The specific functions of CnAβ are described in more detail, below.

 

CnAβ has many anti-inflammatory functions including limiting spontaneous pro-inflammatory Th1 and Th17-cell generation, the control of Treg-cell generation from the thymus, and the generation of inducible Treg cells (20). CnAβ is required for the spontaneous survival of naïve T cells (30). Naïve T cells from CnAβ-deficient (Ppp3cb-/-) mice exhibited increased spontaneous apoptosis that was blocked by IL-7 and IL-15. Ppp3cb-/- mice exhibited a reduction in CD3+ T cells in the peripheral blood compared to that in wild-type mice (31). In addition, the frequency of both thymic and splenic CD4+ and CD8+ cells in the Ppp3cb-/- mice was reduced compared to that in wild-type mice. The numbers of single positive T cells increased in the Ppp3cb-/- mice with age to levels comparable to wild-type mice (20). Thymus cellularity was also reduced in the Ppp3cb-/- mice. Splenic T cells from Ppp3cb-/- mice exhibited reduced proliferation induced by CD3 cross-linking or PMA/ionomycin. CnAα is able to partially compensate for the function of CnAβ in T cell activation, but both are required for efficient cell activation. After calcineurin-induced activation, NFAT forms a complex with FOXP3 to induce regulatory T cell (Treg) cell generation through the induction of Il2ra (CD25) and Ctla4 (CD152) (32). Loss of CnAβ expression results in deficient Treg cell generation with a concomitant expansion of mature T cells with an activated phenotype (20).

 

Calcineurin and NFAT function in cardiac morphogenesis and the induction of cardiac hypertrophy (33;34). Calcineurin overexpression in a transgenic mouse model resulted in cardiac hypertrophy and heart failure (34). In the heart, microRNA-499 (miR-499) targets both the CnAα and CnAβ catalytic subunits to inhibit anoxia-induced cardiomyocyte apoptosis (35). Ppp3cb-/- mice exhibited a greater loss of viable myocardium, an increase in cell death, and loss of cardiac function after acute ischemia-reperfusion injury to the heart (36).

 

CnAβ is essential for lipid homeostasis. Ppp3cb-/- mice exhibit hyperlipidemia and develop age-dependent insulin resistance (37). The hyperlipidemia exhibited by the Ppp3cb-/- mice is due to increased β-adrenergic receptor signaling-associated lipolysis in adipose tissues. Ppp3cb-/- mice treated with STZ to induce type 1 diabetes exhibited increased sensitivity and higher glucose levels at one and two weeks than STZ-treated wild-type mice. At 3 weeks, the levels of hyperglycemia were comparable between the Ppp3cb-/- and wild-type mice. The two groups exhibited comparable renal function, glomerular filtration rate, urine excretion, and concentration. However, the Ppp3cb-/- mice exhibited more loss of albumin and total protein excretion in the urine than wild-type mice. Wild-type mice exhibited increased hypertrophy in the whole kidney as early as one week after diabetes induction. However, the Ppp3cb-/- mice did not display whole kidney hypertrophy. After 6 weeks of diabetes, wild-type and Ppp3cb-/- mice exhibited both whole kidney and glomeruli hypertrophy, with the Ppp3cb-/- mice exhibiting a lesser degree of hypertrophy than wild-type mice (38).

Putative Mechanism

The frequency of thymic and splenic CD4+ and CD8+ cells was reduced in Ppp3cb-/- mice compared to that in wild-type mice.  CnAβ is required for the spontaneous survival of naïve T cells (30). In addition, calcineurin has a role in apoptosis of T and B cells (24-26). In lymphocytes, calcineurin and NFAT function in apoptosis by mediating the induction of Fas and FasL, which transduce an apoptotic signal upon T cell activation (28;29). The reduced frequency of single positive T cells in the Copacabana mice indicates that CnAβCopacabana exhibits loss of function.

Primers PCR Primer
Copacabana(F):5'- CACAAGGAAAACTAATTGGATGGTC -3'
Copacabana(R):5'- TGATGACTCTTCATAGGCCAC -3'

Sequencing Primer
Copacabana_seq(F):5'- ACTAATTGGATGGTCTGAAAAAGAAG -3'
Copacabana_seq(R):5'- GGCCACTCCAGATATTTCTTGATAG -3'
References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsMing Zeng, Xue Zhong, and Bruce Beutler
List |< first << previous [record 75 of 511] next >> last >|