Phenotypic Mutation 'set' (pdf version)
List |< first << previous [record 14 of 18] next >> last >|
Alleleset
Mutation Type splice donor site (6 bp from exon)
Chromosome11
Coordinate16,871,881 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Egfr
Gene Name epidermal growth factor receptor
Synonym(s) avian erythroblastic leukemia viral (v-erb-b) oncogene homolog, Wa5, 9030024J15Rik, Erbb, Errb1
Chromosomal Location 16,752,203-16,918,158 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane glycoprotein that is a member of the protein kinase superfamily. This protein is a receptor for members of the epidermal growth factor family. EGFR is a cell surface protein that binds to epidermal growth factor. Binding of the protein to a ligand induces receptor dimerization and tyrosine autophosphorylation and leads to cell proliferation. Mutations in this gene are associated with lung cancer. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mutations widely affect epithelial development. Null homozygote survival is strain dependent, with defects observed in skin, eye, brain, viscera, palate, tongue and other tisses. Other mutations produce an open eyed, curly whisker phenotype, while a dominant hypermorph yields a thickened epidermis. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_207655, NM_007912; MGI: 95294

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000020329] [ENSMUSP00000099948]
SMART Domains Protein: ENSMUSP00000020329
Gene: ENSMUSG00000020122

DomainStartEndE-ValueType
low complexity region 5 25 N/A INTRINSIC
Pfam:Recep_L_domain 57 168 1.4e-32 PFAM
low complexity region 182 195 N/A INTRINSIC
FU 228 270 6.07e-4 SMART
Pfam:Recep_L_domain 361 481 1.8e-29 PFAM
FU 496 547 8.25e-6 SMART
FU 552 601 4.38e-10 SMART
FU 614 654 4.05e1 SMART
low complexity region 677 694 N/A INTRINSIC
TyrKc 714 970 2.88e-129 SMART
low complexity region 1004 1017 N/A INTRINSIC
low complexity region 1027 1048 N/A INTRINSIC
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000099948
Gene: ENSMUSG00000020122

DomainStartEndE-ValueType
low complexity region 5 25 N/A INTRINSIC
Pfam:Recep_L_domain 57 168 5e-33 PFAM
low complexity region 182 195 N/A INTRINSIC
FU 228 270 6.07e-4 SMART
Pfam:Recep_L_domain 361 481 2e-29 PFAM
FU 496 547 8.25e-6 SMART
FU 552 601 4.38e-10 SMART
FU 614 654 4.54e0 SMART
Predicted Effect probably benign
Phenotypic Category
Phenotypequestion? Literature verified References
30 min GTT hypoglycemic (male)
skin/coat/nails 7618084
Penetrance 2/2 
Alleles Listed at MGI

All Mutations and Alleles(20) :  Chemically induced (ENU)(3) Spontaneous(2) Targeted (14) Transgenic (1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Egfr APN 11 16863020 missense probably damaging 1.00
IGL01529:Egfr APN 11 16863014 missense probably benign
IGL01556:Egfr APN 11 16905382 missense probably damaging 1.00
IGL02627:Egfr APN 11 16869346 missense probably damaging 1.00
IGL02862:Egfr APN 11 16883562 missense probably benign 0.25
IGL02945:Egfr APN 11 16752514 missense probably damaging 1.00
IGL02994:Egfr APN 11 16911811 missense probably damaging 1.00
IGL03395:Egfr APN 11 16910261
Velvet UTSW 11 16904399 missense probably damaging 1.00
PIT1430001:Egfr UTSW 11 16910214 missense probably benign 0.00
R0196:Egfr UTSW 11 16911746 missense probably benign 0.02
R0513:Egfr UTSW 11 16872855 missense probably damaging 1.00
R0567:Egfr UTSW 11 16872873 missense probably benign 0.01
R0629:Egfr UTSW 11 16869333 missense probably damaging 1.00
R0961:Egfr UTSW 11 16862964 missense probably damaging 1.00
R1163:Egfr UTSW 11 16883546 missense probably benign 0.02
R1454:Egfr UTSW 11 16889920 missense probably benign
R1456:Egfr UTSW 11 16863065 missense probably benign 0.00
R1503:Egfr UTSW 11 16869301 missense possibly damaging 0.86
R1577:Egfr UTSW 11 16869241 missense probably benign 0.04
R1595:Egfr UTSW 11 16906847 missense probably damaging 0.99
R1699:Egfr UTSW 11 16859019 missense probably benign 0.14
R2172:Egfr UTSW 11 16911562 missense probably benign 0.00
R3690:Egfr UTSW 11 16871881 splice site probably benign
R3922:Egfr UTSW 11 16881495 missense probably damaging 1.00
R4444:Egfr UTSW 11 16871027 missense probably benign 0.00
R4685:Egfr UTSW 11 16858980 missense probably damaging 1.00
R4737:Egfr UTSW 11 16869231 missense probably damaging 0.99
R4814:Egfr UTSW 11 16869354 missense probably damaging 1.00
R4841:Egfr UTSW 11 16911607 missense probably benign 0.05
R4842:Egfr UTSW 11 16911607 missense probably benign 0.05
R4903:Egfr UTSW 11 16908949 missense probably damaging 1.00
R4964:Egfr UTSW 11 16908949 missense probably damaging 1.00
R4985:Egfr UTSW 11 16859029 nonsense probably null
R4998:Egfr UTSW 11 16881493 missense possibly damaging 0.58
R5001:Egfr UTSW 11 16904434 missense probably damaging 0.98
R5304:Egfr UTSW 11 16884260 missense probably benign
R5309:Egfr UTSW 11 16911703 missense probably benign 0.00
R5653:Egfr UTSW 11 16911617 missense probably benign 0.04
R5905:Egfr UTSW 11 16911494 missense probably damaging 1.00
R6051:Egfr UTSW 11 16883607 missense possibly damaging 0.87
R6052:Egfr UTSW 11 16911554 missense probably benign 0.16
R6114:Egfr UTSW 11 16904374 missense possibly damaging 0.46
R6261:Egfr UTSW 11 16889964 missense probably benign 0.11
R6434:Egfr UTSW 11 16869294 missense probably benign 0.25
R6475:Egfr UTSW 11 16891259 missense probably benign
R6799:Egfr UTSW 11 16896952 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice, gDNA
Repository
Last Updated 2016-05-13 3:09 PM by Anne Murray
Record Created 2015-11-04 6:01 PM
Record Posted 2016-04-28
Phenotypic Description
Figure 1. The set mice exhibited thickened skin and a rough coat.

The set phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R3690, some of which exhibited thickened skin as well as a rough coat with individual hair shafts projecting in different directions relative to neighboring shafts (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the coat phenotype using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 62 mutations (X-axis) identified in the G1 male of pedigree R3690. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 62 mutations. The coat/skin phenotype was linked to a mutation in Egfr:  a T to C transition at base pair 16,871,881 (v38) on chromosome 11, or base pair 119,679 in the GenBank genomic region NC_000077 for the Egfr gene. Linkage was found with a recessive model of inheritance (P = 4.95 x 10-4), wherein two variant homozygotes departed phenotypically from 19 heterozygous and 17 homozygous reference mice (Figure 2). The mutation is located within the donor splice site of intron 10, six nucleotides from the previous exon. Two Egfr protein-coding transcripts are displayed on Ensembl; the transcripts encode proteins with distinct C-termini. The mutation in the set mice occurs within intron 10 of both transcripts.

 

The effect of the mutation at the cDNA and protein level is unknown. One possibility, shown below, is that the mutation may disrupt the splice donor site, but it is judged unlikely to do so by splicing prediction programs. In the instance that the mutation affects splicing, the most likely aberrant splicing result is that a cryptic site in intron 10 could be used, resulting in a 12 nucleotide insertion in intron 10. As a result, an in-frame insertion of four aberrant amino acids after amino acid 403 of the protein may occur.

 

               <--exon 10 intron 10-->         exon 11-->       <--exon 28

119494 ……GTAAAGGAAATAACAG gtttgtactcgggtgtgc…… GCTTTTTGCTG…… ……ATTGGAGCATGA 159642
398    ……-V--K--E--I--T-- G--L--Y--S--         G--F--L--L-…… ……-I--G--A--*- 1210

             correct       aberrant                      correct

 

Genomic numbering corresponds to NC_000077. Protein numbering refers to the canonical EGFR variant 1. The donor splice site of intron 10, which is affected by the mutation, is indicated in blue; the mutated nucleotide is indicated in red. The putative cryptic donor site is indicated by bold italics.

Protein Prediction

Figure 3. Domain structure of EGFR. EGFR is composed of an extracellular ligand binding domain followed by a single transmembrane (TM) domain, a juxtamembrane (JM) domain, and a cytoplasmic domain containing a conserved protein tyrosine kinase (PTK) domain and its regulatory sequences. The position of the set mutation is indicated. This image is interactive; click to view the site of another Egfr mutation.

Figure 4. Crystal structure of two EGFR extracellular domains complexed with two EGF molecules. In order to display the interactions between the two EGFR molecules, domain II is colored in cyan and orange. The other three domains are colored in the same for both EGFR extracellular domains. Domain I is in pink, domain III is in green and domain IV, which is mostly disordered, is in gray. The two EGF molecules are shown in purple. β-strands are represented by flat arrows and α-helices by coils. UCSF Chimera model is based on PDB 1IVO, Ogiso et al., Cell 110, 775-787 (2002). Click on the 3D structure to view it rotate.

The four members of the epidermal growth factor receptor family (EGFR/ErbB1/HER1, ErbB2/HER2, ErbB3/HER3, and ErbB4/HER4) are transmembrane receptor tyrosine kinases (RTKs) activated by ligand-induced dimerization. Like all RTKs, EGFR is composed of an extracellular ligand binding domain (aa 1-621) followed by a single transmembrane domain (aa 622-644), a juxtamembrane domain (aa 645-685), and a cytoplasmic domain containing a conserved protein tyrosine kinase (PTK) domain (aa 686-960) and its regulatory sequences (Figure 3) [(1); reviewed in (2)]. The extracellular domain of EGFR is composed of four subdomains (I-IV); subdomains II and IV are cysteine-rich (3) (Figure 4; PDB ID 1IVO). The set mutation is predicted to result in deletion of exon 10, which encodes amino acids 379-402 within the extracellular ligand-binding domain. The mutation is predicted to cause an in-frame insertion of four aberrant amino acids within subdomain III (amino acids 324-508) of the ligand-binding domain. The expression level of EGFRset has not been examined.

 

Please see the record Velvet for more information about Egfr.

Putative Mechanism

EGFR signaling is activated by a variety of ligands and activates several signaling pathways leading to gene transcription, cell proliferation and cell migration. The known ligands for EGFR include EGF, and the EGF-family hormones TGF-α, epiregulin, β-cellulin, heparin-binding (HB)-EGF and amphiregulin. Binding of adapter proteins (e.g., Grb2, Nck, Src, and PLC-γ) to activated EGFR homo- or heterodimers leads to substrate phosphorylation and the activation of multiple pathways, including the Ras-MAPK, Src and Abl family kinase, JNK, STAT and PLC-γ pathways. These in turn regulate transcriptional programs controlling cell proliferation, death and differentiation, as well as signaling cascades controlling cell adhesion, motility and migration.

 

Both the outer root sheath of hair follicles and the epidermal layer of the eyelid depend upon EGFR signaling for normal development, and in particular upon its function as a regulator of cell migration through the extracellular matrix, a process that is highly dependent upon interactions between epithelium and underlying mesenchyme. EGFR is linked to two pathways of particular importance in the promotion of cell motility: the PLCγ and the Ras-MAPK pathways. Mutations that disrupt signal transduction in these pathways can cause dysregulation of cell migration, an effect that may be manifested in defects of eyelid and hair development, as seen in mice with EGFR mutations.

 

EGFR null mice are growth retarded, have developmental defects in multiple systems, and die at different stages of embryogenesis, depending on the strain background (4-6). Egfr-/- mice exhibit abnormal craniofacial development, and develop narrow, elongated snouts, an underdeveloped lower jaw, and a high incidence of cleft palate (7). Mutants also display abnormal brain development, particularly in the cerebellum and cortex, which have abnormally few cells and show signs of impaired neuronal migration (6).

 

The coat phenotype observed in the set mice mimics that observed in the Velvet mice (8). In contrast to the Egfr null and Velvet mice, set mice are not embryonic lethal. This indicates that EGFRset may retain some function to sustain life, but loss-of-function in relation to epidermal function. Subdomain III is a major ligand-binding domain in EGFR (9). Therefore, the Egfr mutation in the set mice may be altering the ability of EGFRset to bind ligands.

Primers PCR Primer
set(F):5'- ATACTGCACTGCCATCAGC -3'
set(R):5'- CCGTGGCTTAAAGTGCTTTC -3'

Sequencing Primer
set_seq(F):5'- CCTTTAAGGGGTGAGTAACAGCTG -3'
set_seq(R):5'- TCAATTTGCATCAAGGGAAACTGG -3'
References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsJeff SoRelle, Zhe Chen, Jianhui Wang, Ryan Solt, Lyndon Lee, and Bruce Beutler
List |< first << previous [record 14 of 18] next >> last >|