Phenotypic Mutation 'blaenka' (pdf version)
List |< first << previous [record 36 of 511] next >> last >|
Alleleblaenka
Mutation Type missense
Chromosome14
Coordinate63,384,002 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Blk
Gene Name B lymphoid kinase
Chromosomal Location 63,372,837-63,417,187 bp (-)
MGI Phenotype Homozygous mutation of this gene does not result in a phenotype.
Accession Number

NCBI RefSeq: NM_007549; MGI:88169

Mapped Yes 
Amino Acid Change Serine changed to Proline
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000014597]
PDB Structure
NMR ENSEMBLE OF BLK SH2 DOMAIN, 20 STRUCTURES [SOLUTION NMR]
NMR ENSEMBLE OF BLK SH2 DOMAIN USING CHEMICAL SHIFT REFINEMENT, 20 STRUCTURES [SOLUTION NMR]
SMART Domains Protein: ENSMUSP00000014597
Gene: ENSMUSG00000014453
AA Change: S93P

DomainStartEndE-ValueType
SH3 55 111 2.91e-18 SMART
SH2 116 205 1.32e-32 SMART
TyrKc 235 484 1.97e-127 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000014597)
Phenotypic Category increase in IgE response to a Cysteine Protease (Papain), increase in total IgE level
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(5) : Chemically induced (other)(1) Targeted(4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Blk APN 14 63380720 missense probably damaging 1.00
IGL02146:Blk APN 14 63374199 missense probably damaging 1.00
IGL02684:Blk APN 14 63379694 missense probably benign 0.25
R0254:Blk UTSW 14 63380804 missense probably benign 0.08
R0318:Blk UTSW 14 63374197 missense probably damaging 1.00
R1567:Blk UTSW 14 63380729 missense probably damaging 0.99
R1871:Blk UTSW 14 63375915 missense possibly damaging 0.72
R2161:Blk UTSW 14 63379613 splice donor site probably benign
R3719:Blk UTSW 14 63384002 missense probably damaging 1.00
R4606:Blk UTSW 14 63374203 missense probably benign 0.00
R4879:Blk UTSW 14 63375965 missense probably benign
R4935:Blk UTSW 14 63381262 missense possibly damaging 0.95
R5014:Blk UTSW 14 63379787 missense probably benign 0.00
R5352:Blk UTSW 14 63375971 missense probably damaging 1.00
R5406:Blk UTSW 14 63380731 missense probably damaging 1.00
R5514:Blk UTSW 14 63378481 missense probably damaging 0.99
R5518:Blk UTSW 14 63378507 missense possibly damaging 0.56
Mode of Inheritance Autosomal Recessive
Local Stock gDNA
Repository
Last Updated 01/06/2017 11:15 AM by Anne Murray
Record Created 11/10/2015 11:04 AM by Tao Yue
Record Posted 01/06/2017
Phenotypic Description

Figure 1. Blaenka mice exhibited increased amounts of IgE in the serum. IgE levels were determined by ELISA. Log data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The blaenka phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R3719, some of which showed increased levels of IgE in the serum (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of increased amount of IgE using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 31 mutations (X-axis) identified in the G1 male of pedigree R3719. Log phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 31 mutations. The IgE phenotype was linked to a mutation in Blk: a T to C transition at base pair 63,384,002 (v38) on chromosome 14, or base pair 33,186 in the GenBank genomic region NC_000080 encoding Blk. Linkage was found with a recessive model of inheritance, wherein five variant homozygotes departed phenotypically from 22 homozygous reference mice and 23 heterozygous mice with a P value of 1.033 x 10-4 (Figure 2).

 

The mutation corresponds to residue 697 in the NM_007549 mRNA sequence in exon 5 of 13 total exons. 

 

682 TGGTGGTTGGCCAGGTCACTCGTCACAGGAAGA

88  -W--W--L--A--R--S--L--V--T--G--R-

 

The mutated nucleotide is indicated in red.  The mutation results in a serine (S) to proline (P) substitution at position 93 (S93P) in the BLK protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction
Figure 3. Domain organization of BLK. BLK has several domains, including a 'unique' region, an SH3, SH2, linker, and kinase domains. The blaenka mutation results in a serine (S) to proline (P) substitution at position 93 (S93P)
Figure 4. Crystal structure of inactive Src. The unique domain is not part of the structure. UCSF Chimera structure is based on PDB: 2SRC, Xu et al, Mol. Cell 3, 629-638 (1999). Click on the 3D structure to view it rotate.

Blk is a member of the Src family of tyrosine kinases (SFKs), which also includes Src, Yes, Fgr, Fyn, Lck (see the record for iconoclast), Hck, Lyn (see the record for Lemon), and Yrk (1). The members of the SFKs share highly conserved domains including a Src-homology 3 (SH3) domain (amino acids 52-112 in Blk), an SH2 domain (amino acids 118-214), a tyrosine kinase domain (amino acids 235-488), and a C-terminal regulatory region [Figure 3; reviewed in (2-4)]. A ‘unique’ domain of 50-70 amino acids between the N-terminus and the SH3 domain varies among the members of the SFKs (4).

 

The kinase domain has N- and C-terminal lobes that flank an ATP- and substrate- binding cleft [Figure 4; PDB:2SRC; (5;6)]. The N-terminal lobe is involved in anchoring and orienting ATP, while the C-terminal lobe is primarily responsible for substrate binding and initiating phosphotransfer (7). Src family kinases are held in a closed, inactive conformation by intramolecular interactions between a phosphorylated tyrosine in the C-terminal tail and the SH2 domain [Figure 4; (5;6;8)]. This interaction couples the SH2 domain to the C-terminal tail, and also holds the SH2 and SH3 domains in a rigid conformation that disfavors kinase activation (9). In addition to the SH2-C-terminal tail interaction, the closed conformation of Src family kinases is also maintained by the docking of the SH3 domain onto an internal polyproline type II helical sequence formed by the linker between the SH2 and kinase domains (5;6;8). This polyproline helix is sandwiched between the SH3 domain and the back surface of the N-terminal lobe of the catalytic domain. Binding of the SH2 domain to the phosphorylated tail segment has been proposed to be important for correctly positioning the SH2-kinase domain linker for interaction with the SH3 domain. When the activation loop tyrosine (Tyr383 in Blk) is dephosphorylated, the αC helix rotates outward, assuming a conformation unable to coordinate the α- and β-phosphates of ATP within the catalytic cleft. In Lyn, dephosphorylation of the tyrosine by the tyrosine phosphatase CD45 results in a conformation change in Lyn, subsequently promoting Lyn autophosphorylation of Tyr397 and an increase in kinase activity (10). Phosphorylation of the activation loop also increases the accessibility of the SH3 domain for ligands, and it has been proposed that Src activity may generally control the availability of its regulatory domains (11). Together, phosphorylation of the tyrosine in the C-terminal tail and dephosphorylation of the activation loop tyrosine promote a closed, inactive conformation in which the lobes of the kinase domain are closely apposed and the αC helix is shifted outwards.

 

Activated Blk can be ubiquitinated by the E3 ligase E6AP and preferentially degraded by the ubiquitin-proteasome pathway (12).

 

The blaenka mutation results in a serine (S) to proline (P) substitution at position 93 (S93P). Residue 93 is within the SH3 domain.

Expression/Localization

Blk is expressed in B cells, plasmacytoid dendritic cells, double-negative αβ T cells, IL-17-producing γδ T cells, and pancreatic β-cells (1;13-16).

Background
Figure 5. Pre-BCR and BCR signaling. Following BCR ligation, Lyn or BLK phosphorylates the ITAMs of the Igα/Igβ BCR subunits. These phosphotyrosines then act as docking sites for the SH2 domains of Syk. In pre-BCR signaling, Syk phosphorylates many substrates and triggers signaling pathways that are involved in both proliferation and differentiation of pre-B cells. Syk-mediated signaling downstream from the BCR regulates cell proliferation, differentiation, and apoptosis as well as the secretion of antigen-specific antibodies. Image is interactive; click to view mutations associated with the BCR signaling pathway.

The SFKs interact with immune cell receptors, growth factor receptors, integrins, and G protein-coupled receptors to regulate cell migration, adhesion, phagocytosis, cell survival, differentiation, DNA synthesis, and proliferation through the phosphorylation of signaling intermediates (17;18). B cells express several SFKs, including Blk, Lyn, Fyn, Hck, Fgr, and Lck. Following BCR ligation, Blk and/or Lyn phosphorylates the ITAMs of the Igα (see the record for crab)/Igβ BCR subunits [Figure 5; (1;19;20)]. These phosphotyrosines then act as docking sites for the SH2 domains of Syk (see the record for poppy), resulting in Syk phosphorylation and activation. Syk phosphorylates a number of downstream targets including B cell linker (BLNK; see the record for busy), PLCγ2, and protein kinase C β (PKCβ; see the record for Untied). BCR stimulation also activates phosphatidylinositol 3 kinase (PI3K) resulting in the generation of PIP3, which binds selectively to the pleckstrin homology domain of Btk (Bruton’s tyrosine kinase), facilitating membrane recruitment of the kinase. Phosphorylated BLNK also provides docking sites for Btk, as well as PLCγ2, which results in the additional phosphorylation and activation of PLCγ2 by Btk leading to the hydrolysis of phosphatidylinositol-3,4-diphosphate (PIP2) to inositol-1,4,5-trisphosphate (IP3) and diacylglycerol (DAG) (21). The recruitment of Vav1, Nck, and Ras by BLNK to the BCR activates MAP kinase cascades such as JNK, p38 and extracellular signal regulated kinase (ERK) [reviewed in (22)]. Together, these signals allow the activation of multiple transcription factors, including nuclear factor of activated T cells (NF-AT), NF-κB (see the records for finlay, xander and panr2) and AP-1, which subsequently regulate biological responses including cell proliferation, differentiation, and apoptosis as well as the secretion of antigen-specific antibodies [reviewed in (23)]. Lyn is essential for the terminal differentiation of peripheral B cells as well as the elimination of autoreactive B cells (24); however, Lyn, Fyn, and Blk have redundant functions in pre-B cell expansion and BCR signaling initiation. Mice deficient in Blk, Fyn, and Lyn exhibit loss of pre-B cell receptor-mediated NF-κB activation as well as a reduction in the frequency of pre-B cells and a reduction in the number of peripheral B cells (25). Together, all three SFKs are required for pre-B cell development. Although functional redundancy is observed in B cell development and activation, Blk is required for the development and function of marginal zone B cells (26). In addition, Blk is required for early T cell development and in the development and function of γδ-17 cells (14). In leukemia stem cells, Blk functions as a tumor suppressor through a pathway that involves Pax5 (see the record for Apple) and p27, but does not affect normal hematopoietic stem cells (27). Other studies have shown that Blk may function as an oncogene (28). Blk promoted the proliferation of malignant T cells from cutaneous T-cell lymphoma patients (29).

 

Blk-deficient (Blk-/-) mice do not have an overt immunological phenotype (30), but the mice displayed slight changes in B cell differentiation and activation (26;31). The Blk-/- mice had an increased frequency of splenic B cells and preplasmablasts than wild-type littermates (31). Blk-/- mice exhibited higher amounts of anti-dsDNA IgG antibodies with age compared to wild-type littermates and developed immune complex-mediated glomerulonephritis (32). Blk-/- mice had increased numbers of splenic B1a cells; the B1a cells subsequently differentiated into class-switched CD138+IgG-secreting B1a cells (32). Blk-/- mice had reduced numbers of marginal zone B cells but increased responses to BCR stimulation compared to wild-type littermates (26). The B cell hyperactivity subsequently led to the development of autoimmunity by 6-months of age, including increased numbers of marginal zone and B1 B cells and increased levels of serum anti-nuclear antibodies. The Blk+/−.lpr mouse model expresses Blk at low levels. Reducing Blk expression resulted in increased secretion of proinflammatory cytokines and the development of proteinuria, and kidney disease (31).

 

Mutations in human BLK have been linked to several disorders. Mutations that lead to reduced Blk expression are linked to increased susceptibility to systemic lupus erythematosus (SLE) through the dysregulation of the expression of proinflammatory cytokines (33). In addition to SLE, mutations in BLK are linked to other autoimmune disorders including rheumatoid arthritis (34), dermatomyositis (35), systemic sclerosis (36), and Sjögren's syndrome (37). Paitents with the rheumatoid artritis-causing BLK  mutations have lower basal BCR activity, but the B cells are hyperactivatable (38). In addition, the patients exhibit upregulation of CD86 after BCR crosslinking and enhanced T cell stimulatory capacity (38). Simpfendorer and colleagues propose that the increased levels of CD86 correlates with an increased ability to induce T cell activation. The rheumatoid arthritis patients also have increased numbers of isotype-swithced memory B cells (e.g., IgD+ single-positive switched memory B cells). Mutations in BLK have also been linked to Kawasaki disease in Taiwanese, Japanese, Korean, and European populations (39-41)­. Kawasaki disease is a vasculitis that affect primarily infants and young children (42). Kawasaki patients have prolonged fevers and can exhibit variable skin rash, bilateral conjunctival injection, erythema of the oral mucosa, lips, tongue, palms of the hands, and soles of the feet, and cervical lymphadenopathy. Approximately a quarter of the Kawasaki disease patients develop coronary artery aneurysms. A mutation in BLK has been linked to common variable immunodeficiency (CVID), which is chachterized by defective generation of high-affinity antibodies (43). Patients with CVID have an increased risk of recurrent infections of the respiratory and intestinal tract. The BLK mutation linked to CVID causes diminished B cell proliferation and decreased ability of B cells to elicit antigen-specific CD4+ T-cell responses (43). Mutations in BLK are linked to type 11 maturity-onset diabetes of the young (MODY; OMIM: #613375), a subset of diabetes that has a young age of onset (usually before the age of 25) (13). BLK may regulate insulin levels in response to glucose. BLK overexpression increased insulin secretion in cases of high glucose concentraitons; loss of BLK expression resulted in reduced insulin secretion in cases of high glucose (13). In low glucose, BLK overexpression or downregulation did not significantly affect insulin secretion. BLK also enhances the expression of β-cell transcription factors Pdx-1 and Nkx6.1. Reduced BLK expression is linked to childhood acute lymphoblastic leukemia (44).

Putative Mechanism

The phenotype observed in the blaenka mice indicates loss of Blkblaenka function and a possible reduction in BCR-mediated B cell activation. Changes in the frequencies of B and T cell populations in the peripheral blood was not observed in the blaenka mice, indicating that some residual Blk function (or compensation by other SFKs may occur).

Primers PCR Primer
blaenka(F):5'- TCCCTTGGCATCATTCAGAG -3'
blaenka(R):5'- ACCTCCTTATCACCAGGCTG -3'

Sequencing Primer
blaenka_seq(F):5'- GAGAGCCAGAACTTTCCATTCCTG -3'
blaenka_seq(R):5'- ACCAGGCTGTCTGTCTGTC -3'
References
  34. Okada, Y., Wu, D., Trynka, G., Raj, T., Terao, C., Ikari, K., Kochi, Y., Ohmura, K., Suzuki, A., Yoshida, S., Graham, R. R., Manoharan, A., Ortmann, W., Bhangale, T., Denny, J. C., Carroll, R. J., Eyler, A. E., Greenberg, J. D., Kremer, J. M., Pappas, D. A., Jiang, L., Yin, J., Ye, L., Su, D. F., Yang, J., Xie, G., Keystone, E., Westra, H. J., Esko, T., Metspalu, A., Zhou, X., Gupta, N., Mirel, D., Stahl, E. A., Diogo, D., Cui, J., Liao, K., Guo, M. H., Myouzen, K., Kawaguchi, T., Coenen, M. J., van Riel, P. L., van de Laar, M. A., Guchelaar, H. J., Huizinga, T. W., Dieude, P., Mariette, X., Bridges, S. L.,Jr, Zhernakova, A., Toes, R. E., Tak, P. P., Miceli-Richard, C., Bang, S. Y., Lee, H. S., Martin, J., Gonzalez-Gay, M. A., Rodriguez-Rodriguez, L., Rantapaa-Dahlqvist, S., Arlestig, L., Choi, H. K., Kamatani, Y., Galan, P., Lathrop, M., RACI consortium, GARNET consortium, Eyre, S., Bowes, J., Barton, A., de Vries, N., Moreland, L. W., Criswell, L. A., Karlson, E. W., Taniguchi, A., Yamada, R., Kubo, M., Liu, J. S., Bae, S. C., Worthington, J., Padyukov, L., Klareskog, L., Gregersen, P. K., Raychaudhuri, S., Stranger, B. E., De Jager, P. L., Franke, L., Visscher, P. M., Brown, M. A., Yamanaka, H., Mimori, T., Takahashi, A., Xu, H., Behrens, T. W., Siminovitch, K. A., Momohara, S., Matsuda, F., Yamamoto, K., and Plenge, R. M. (2014) Genetics of Rheumatoid Arthritis Contributes to Biology and Drug Discovery. Nature. 506, 376-381.
  37. Lessard, C. J., Li, H., Adrianto, I., Ice, J. A., Rasmussen, A., Grundahl, K. M., Kelly, J. A., Dozmorov, M. G., Miceli-Richard, C., Bowman, S., Lester, S., Eriksson, P., Eloranta, M. L., Brun, J. G., Goransson, L. G., Harboe, E., Guthridge, J. M., Kaufman, K. M., Kvarnstrom, M., Jazebi, H., Cunninghame Graham, D. S., Grandits, M. E., Nazmul-Hossain, A. N., Patel, K., Adler, A. J., Maier-Moore, J. S., Farris, A. D., Brennan, M. T., Lessard, J. A., Chodosh, J., Gopalakrishnan, R., Hefner, K. S., Houston, G. D., Huang, A. J., Hughes, P. J., Lewis, D. M., Radfar, L., Rohrer, M. D., Stone, D. U., Wren, J. D., Vyse, T. J., Gaffney, P. M., James, J. A., Omdal, R., Wahren-Herlenius, M., Illei, G. G., Witte, T., Jonsson, R., Rischmueller, M., Ronnblom, L., Nordmark, G., Ng, W. F., UK Primary Sjogren's Syndrome Registry, Mariette, X., Anaya, J. M., Rhodus, N. L., Segal, B. M., Scofield, R. H., Montgomery, C. G., Harley, J. B., and Sivils, K. L. (2013) Variants at Multiple Loci Implicated in both Innate and Adaptive Immune Responses are Associated with Sjogren's Syndrome. Nat Genet. 45, 1284-1292.
Science Writers Anne Murray
Illustrators Katherine Timer
AuthorsTao Yue and Bruce Beutler
List |< first << previous [record 36 of 511] next >> last >|