Phenotypic Mutation 'concrete' (pdf version)
Alleleconcrete
Mutation Type nonsense
Chromosome9
Coordinate73,082,409 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Rab27a
Gene Name RAB27A, member RAS oncogene family
Synonym(s) 4933437C11Rik, 2210402C08Rik, 2410003M20Rik
Chromosomal Location 73,044,854-73,098,501 bp (+)
MGI Phenotype Homozygotes have abnormal melanocyte development producing abnormal pigmentation and a gray coat color.
Accession Number

NCBI RefSeq: NM_023635; MGI: 1861441

Mapped Yes 
Amino Acid Change Arginine changed to Stop codon
Institutional SourceBeutler Lab
Ref Sequences
R54* in Ensembl: ENSMUSP00000034722 (fasta)
Gene Model not available
PDB Structure
Crystal Structure of the complex Rab27a-Slp2a [X-RAY DIFFRACTION]
SMART Domains

DomainStartEndE-ValueType
RAB 10 184 9.9e-92 SMART
Phenotypic Category immune system, MCMV susceptibility, pigmentation, skin/coat/nails
Penetrance 100% 
Alleles Listed at MGI

All alleles(108) : Targeted, other(2) Gene trapped(103) Spontaneous(2) Chemically induced(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01144:Rab27a APN 9 73075568 critical splice donor site probably null 0.00
IGL02000:Rab27a APN 9 73084972 missense probably damaging 1.00
geodude UTSW 9 73084981 missense probably damaging 1.00
ivan UTSW 9 73075544 missense probably damaging 0.99
R0644:Rab27a UTSW 9 73095423 missense probably benign 0.01
R0671:Rab27a UTSW 9 73075433 missense probably damaging 1.00
R1481:Rab27a UTSW 9 73082402 missense probably benign 0.13
R1522:Rab27a UTSW 9 73075482 missense probably damaging 1.00
R1531:Rab27a UTSW 9 73095403 missense probably benign 0.00
R1634:Rab27a UTSW 9 73075569 critical splice donor site probably null
R1950:Rab27a UTSW 9 73075469 missense probably damaging 1.00
R2497:Rab27a UTSW 9 73084981 missense probably damaging 1.00
R4083:Rab27a UTSW 9 73082439 nonsense probably null
R4094:Rab27a UTSW 9 73075544 missense probably damaging 0.99
R5027:Rab27a UTSW 9 73095413 missense probably benign 0.01
R5881:Rab27a UTSW 9 73085039 missense probably null
Mode of Inheritance Autosomal Recessive
Local Stock Embryos, Sperm, gDNA
MMRRC Submission 016836-UCD
Last Updated 05/13/2016 3:09 PM by Peter Jurek
Record Created unknown
Record Posted 05/10/2010
Phenotypic Description
Concrete was identified as a visible phenotype among ENU-induced G3 mutant mice. Homozygous concrete mice display a gray coat color and black eyes (Figure 1). Concrete mice are highly susceptible to mouse cytomegalovirus (MCMV) (MCMV Susceptibility and Resistance Screen), but resistant to Listeria monocytogenes. The mice also show a moderate bleeding diathesis, presumably due to platelet dysfunction. Natural killer (NK) cells from concrete mice fail to degranulate after antibody stimulation of NKp46 or Ly49H receptors, or after exposure to YAC-1 cells. Only 15-20% of concrete NK cells degranulate after PMA/ionomycin stimulation, compared with 80-90% of wild type cells. However, intracellular production of interferon (IFN)-γ is normal after PMA/ionomycin stimulation.
 
Figure 2. The secretion of MPO is markedly impaired in homozygous concrete mice. Rab27aconcrete/concrete mice (open circles) and wild-type mice (closed circles) were challenged with a single intraperitoneal injection of LPS (+) or vehicle (-). Blood sample were collected before (0 h) and 4 and 8 h after injection. The samples were spun down and plasma was collected and analysed for the presence of MPO using mouse-specific ELISA. The statistical significance of the difference of the means was analysed by ANOVA. *P<0.01; **P<0.001. Figure reproduced with permission from Munafo et al. (2007) Rab27a is a key component of the secretory machinery of azurophilic granules in granulocytes. Biochem J. 402, 229-239 © the Biochemical Society.
Further phenotypic analysis of concrete mice was performed after identification of the concrete mutation as a lesion in the Rab27a locus (1). The mutation results in a complete absence of Rab27a protein expression in leukocytes, whereas the Rab27a effector, JFC1/Slp1, is detected at levels similar to wild type. Previous studies suggested that neutrophil function may be impaired in humans with RAB27A deficiency (2;3). Therefore, neutrophil function was examined in concrete mice. Concrete mice showed impaired secretion of myeloperoxidase (MPO), an enzyme expressed predominantly in neutrophils, into the plasma in response to intraperitoneal injection of lipopolysaccharide (LPS) (Figure 2). Total neutrophil numbers and baseline plasma MPO concentrations were comparable in concrete and wild type mice.
 
Concrete mice display normal type I interferon (IFN) responses to CpG DNA challenge in vivo.
Nature of Mutation
The concrete mutation was mapped to Chromosome 9, and corresponds to an A to T transversion at position 329 of the Rab27a transcript, in exon 3 of 6 total exons.
 
314 AAGAGAGTGGTGTACAGAGCCAATGGGCCAGAT
49  -K--R--V--V--Y--R--A--N--G--P--D-
 
The mutated nucleotide is indicated in red lettering, and creates a premature stop codon at codon 54 (normally an arginine) deleting 167 amino acids from the C-terminus of the protein.
Protein Prediction
Rab proteins are low molecular weight GTPases that function in membrane trafficking and vesicular fusion and targeting.  The presence of five sequence motifs designated Rab family motif (RabF) 1-5 distinguishes Rabs from other small GTPases (4). In addition, four regions designated Rab subfamily motif (RabSF) 1-4 share high amino acid sequence identity among Rabs of the same subfamily. Rab27a is a 221 amino acid protein that together with Rab27b forms the Rab27 subfamily.  Rab27a and Rab27b are 70% identical overall, and 100%, 72%, 84%, and 76% identical, respectively, in their RabSF1, RabSF2, RabSF3, and RabSF4 motifs (4). Transgenic expression of Rab27b can compensate for the lack of Rab27a to restore normal coat color in Rab27aash mice (5) (See Background).
 
Figure 3. Domain structures of Rab27a and Rab27b.  The four consensus GTP-binding sequences (I-IV) and the dicysteine isoprenylation motif are shown at the top.  I and II bind phosphate, while III and IV bind guanine. The positions of the RabF motifs and RabSF motifs for the Rab27 family are indicated.  The concrete mutation is an arginine to premature stop at amino acid 54.  Secondary structural elements are indicated with lines below each protein. The image is interactive; click to view other Rab27a mutations.
Like all the Rab proteins, Rab27a contains four consensus sequences that mediate GTP-binding of Rabs (Figure 3) (6;7). Among them, the phosphate-interacting domain, consists of six residues (DTAGQE) that are strictly conserved in all small GTPases. The C terminus of Rab27a contains a dicysteine motif (CXC), one of four consensus isoprenylation motifs present in Rabs (6;7), to which Rab geranylgeranyl transferase (GGTase) attaches two geranylgeranyl groups that serve to target Rab27a to target membranes (8). This di-geranylgeranylation event is essential for Rab27a activation and for proper subcellular localization (9). Mutations in a subunit of Rab GGTase cause the gunmetal phenotype in mice, characterized by coat color dilution, platelet defects, and loss of CTL killing ability, and Hermansky-Pudlak syndrome in humans (10;11).
 
Figure 4. Crystal structure of Rab27a in complex with GppNHp and R27BD of Slp2. β-strands are represented with flat arrows and α-helices are shown as coils. The location of the concrete mutation is indicated in red. The SHD2 sequence SGQWFY thought to provide effectors with specificity for Rab27a is colored purple. GppNHp and Mg2+ are represented as ball and stick and space-filling models, respectively. UCSF Chimera structure is based on PDB 3BC1, Chavas et al, Structure 16, 1468-77 (2008). Click on the 3D structure to view it rotate.
Rab27a uses a variety of organelle-specific effectors to carry out its functions (Table 1). With the exception of Unc13d, these effectors interact with Rab27 proteins using a common N-terminal Rab27-binding domain (R27BD, also known as the Slp homology domain, SHD) consisting of two helical subdomains (SHD1 and SHD2) either joined directly or separated by two zinc finger motifs (12;13).
 
The crystal structures of Rab27a or Rab27b bound to a GTP analogue and either the R27BD of Slp2 or melanophilin, respectively, reveal that Rab27a exhibits a typical monomeric small GTPase globular fold consisting of five α helices surrounding six β strands (Figure 4) (14;15). Small GTPases contain a so-called “switch region” composed of switch I, interswitch, and switch II regions that changes conformation as a GTPase switches between the GTP- and GDP-bound states. RabF motifs are found clustered in the switch region of Rabs, with RabF1 in switch I and RabF2-5 in switch II (4). The SHD1 of the R27BDs of Slp2 and melanophilin form similar α helical structures that bind to residues in the interswitch and switch II regions of Rab27a. These residues belong to RabF1-4, RabSF1, RabSF3, and RabSF4 on the surface of Rab27a. In addition, three invariant hydrophobic aromatic amino acids from the switch region of Rab27a are essential for effector recognition (F46, W73, and F88). Residues outside of the Rab27a switch and interswitch regions make further contacts with the SHD2 located at the C-terminus of the R27BD. A sequence in SHD2 ([S/T][G/L]XW[F/Y][F/Y]) is thought to provide effectors with specificity for Rab27a/b.
 
The concrete mutation results in the conversion of the codon for arginine 54 to a stop codon. It likely results in a protein-null animal, or if any protein is expressed, a non-functional product, as the premature stop codon occurs early in the coding sequence (amino acid 54 of 221).
Expression/Localization
Northern blot analysis detects three Rab27a transcripts of distinct size, most likely due to differing lengths of 3’ untranslated region (7;16). In humans, RAB27A transcripts are found in most tissues, including spleen, thymus, prostate, testis, ovary, small intestine, colon, heart, placenta, lung, liver, muscle, kidney and pancreas, as well as in several tumor cell lines (leukemia, melanoma and HeLa cells) (7). Brain tissue is devoid of RAB27A expression. Leukocytes, platelets and melanocytes all express RAB27A (7). In mice, Rab27a expression has been analyzed by immunoblotting and found in eye, heart, intestine, lung, pancreas and spleen (17). Subcellularly, Rab27a is present on endosomes and lysosomes, and on a variety of lysosome-related and secretory organelles, including melanocytes in melanosomes (18) and lytic granules in cytotoxic T lymphocytes (CTLs) and NK cells (10).
Background
More than 60 Rab GTPase proteins are expressed in mammalian cells, where they control distinct steps in intracellular transport. Four essential steps are recognized in the mechanism underlying membrane traffic [reviewed in (19;20)]. First, cargo is selected and a vesicular or tubular transport intermediate is formed. These intermediates are then delivered to their target membrane, often using molecular motors to move them along microtubules or actin filaments. Tethering/docking brings the intermediate and target membranes close together, and finally fusion of the two membranes mediated by soluble NSF attachment protein receptor (SNARE) proteins releases the cargo. Specificity at each step is necessary to maintain appropriate compartmentalization and cargo movement through the cell, and Rabs, ubiquitously expressed and associated with distinct intracellular compartments, are critical regulators of such specificity at each step of the trafficking process.
 
Figure 5. Rab GTPase activation cycle. Please see text for details.
Rabs are molecular switches, cycling between an inactive GDP-bound and an active GTP-bound state (Figure 5). This cycle is tightly controlled by the action of Rab GGTases (geranylgeranyl transferases), GDIs (GDP dissociation inhibitors), GDFs (GDI displacement factors), GEFs (guanine nucleotide exchange factors), and GAPs (GTPase activating proteins). The function of Rabs depends on membrane association mediated by the action of a Rab GGTase and a Rab escort protein (REP). Rab GGTases bind to a 1:1 complex of Rab·GDP and REP (21;22), and covalently attach geranylgeranyl groups to one or both cysteines in the C-terminal dicysteine motif of the Rab protein (8). Prenylated Rabs are then carried to their target membrane by REP (23), which also appears to be critical in the prenylation step (24). The isoprenyl group attached to Rab may be masked by the binding of a GDI, which maintains the Rab in the cytosol until a GDF releases it. Once recruited to the target membrane, a GEF catalyzes the exchange of GDP for GTP, and the activated Rab can then interact with specific effectors to convey vesicles to their target membranes, mediate docking and membrane fusion. Inactivation of Rabs is achieved by the acceleration of the intrinsic GTP hydrolysis rate by GAPs, followed by GDI-mediated extraction from the membrane.
 
Eleven organelle-specific Rab27 effector proteins have so far been identified (Table 1).
 
Table 1. Rab27 effectors
 
Synonyms
Function
rabphilin 3a
exophilin 1
recruited to dense-core vesicles in Rab27a-dependent manner in PC12 cells (25)
synaptotagmin-like 4
granuphilin-A, exophilin 2, Slp4-a
mediates targeting of insulin granules to plasma membrane in pancreatic β cells (26-28)
melanophilin
exophilin 3, Slac-2a
tethers Rab27a to myosin Va during melanosome transport to the cell periphery in melanocytes (29-31)
synaptotagmin-like 2
exophilin 4, Slp2, Slp2-a
mediates attachment of melanosomes to plasma membrane by binding to Rab27a and plasma membrane phospholipids (32); mediates targeting of glucagon granules to the plasma membrane in pancreatic α cells (33); mediates granule secretion from CTLs (34)
exophilin 5
Slac2-b
required for exosome secretion in HeLa cells (35)
synaptotagmin-like 3
exophilin 6, Slp3
 
synaptotagmin-like 1
exophilin 7, JFC1, Slp1
mediates azurophilic granule transport to the periphery in neutrophils (1;36)
Myrip
exophilin 8, Slac2-c
tethers Rab27a to myosin VIIa during melanosome transport in retinal pigment epithelium cells (37)
synaptotagmin-like 5
exophilin 9, Slp5
 
rabphilin 3A-like
Noc2
mediates recruitment of insulin granules to the plasma membrane of pancreatic β cells (38)
Unc13d
Munc13-4
required to prime secretory granules for fusion in hematopoietic cells (36;39-42)
 
First cloned as ram p25 from a rat megakaryocyte library in 1990 (7), Rab27a regulates the exocytosis of lysosome related organelles from CTLs, melanocytes, platelets, and endothelial cells, as well as the secretion of non-lysosome organelles from several other cell types including insulin-containing secretory granules of pancreatic β cells (26-28), and secretory granules of PC12 and chromaffin cells (43). Mutation of Rab27a results in the mouse phenotype ashen (ash), in which mice have a light coat color due to defects in pigment granule transport (44). Melanins, the pigments for skin, hair and eyes, are synthesized in melanosomes, which are then transported along microtubule and actin filaments to the ends of melanocyte dendrites and exported to neighboring keratinocytes (Figure 6). In Rab27aash mice, melanosomes are synthesized normally, but cluster in the perinuclear region, resulting in uneven and impaired release of melanin (18). The dilute (d) and leaden (ln) mice, which also have a light coat color, exhibit exactly the same cellular phenotype as Rab27aash mice (45;46), and further study of these three mutants revealed that their encoded protein products form a tripartite complex with Rab27a that regulates the microtubule to actin filament transfer of melanosomes, a crucial step leading to melanosome exocytosis (29-31;47;48). Dilute encodes the actin-based motor protein myosin Va (Myo5a) (49) (mutated in new gray, nut, silver decerebrate, and silver decerebrate 2) and leaden encodes the Rab27 effector melanophilin (Mlph, also called Slac2-a; mutated in koala) (50).
 
Figure 6. Melanosome biogenesis and transport mediated by Rab27a. (A) Premelanosomes arise from the late secretory or endosomal pathway.  Stage 1 premelanosomes lacking pigment are thought to correspond to the coated endosome, an intermediate between early and late endosomes densely coated on one face with clathrin.  Some sorting of protein cargo occurs in the Stage 1 premelanosome, mediated by clathrin-associated adaptor protein complexes such as AP-3.  Melanin synthesis begins in Stage II premelanosomes that contain regular arrays of parallel fibers that give these organelles a striated appearance by electron microscopy.  During Stage III, these fibers gradually darken and thicken as eumelanin is deposited along them, such that by Stage IV no striations are visible and the melansome is filled with melanin.  (B) The transport of mature melanosomes takes place on microtubules and actin filaments via the action of kinesins and myosins, respectively.  Kinesin transports melanosomes toward the cell periphery where they are transferred to actin filaments abundant in distal dendritic processes.  Melanosomes must dock at the plasma membrane, from where they are transferred to adjacent keratinocytes. Click on the image to view animation.  (C) A complex of Rab27a, melanophilin, and myosin Va mediates the microtubule to actin filament transfer of melanosomes.  The switch II region of activated Rab27a binds to the SHD1 motif within the Rab27 binding domain (R27BD) of melanophilin.  Myosin Va is then recruited to the complex via an interaction between its globular tail domain (GTD) and exon F sequence with the globular tail domain binding domain (GTBD) and exon F binding domain (EFBD) in the central myosin Va binding domain (MBD).  The actin binding domain (ABD) of melanophilin binds directly to actin, as well as to the microtubule plus end binding protein EB1.  EB1 does not appear to be required for normal melanosome distribution {26402 Hume et al. (2007) J Cell Sci 120:3111-22}.  The tripartite complex transfers melanosomes from microtubules to actin filaments, which is required for melanosomes to become captured at the plasma membrane of dendrite tips from where they are transferred to keratinocytes. This image is interactive. Click on the mutations found within the pathway (red) for more specific information.
Rab27a is targeted to mature melansomes by geranylgeranylation of its C-terminal dicysteine motif. Once GTP-bound and activated, Rab27a recruits melanophilin.  Melanophilin subsequently recruits exon F-containing isoforms of myosin Va that bind via the globular tail domain and the sequence encoded by exon F to two distinct regions on melanophilin (51-54). The tripartite complex mediates the transfer of melanosomes from a microtubule-based kinesin motor to which the melanosome is bound, to the actin-based motor myosin Va, which transports the complex along actin filaments to the distal tips of melanocyte dendrites. An interaction between actin and the C-terminal actin-binding domain of melanophilin may be required for melanosome transfer (55;56), and is promoted by cAMP, which induces accumulation of melansomes at the dendritic tips of melanocytes (57). This actin-binding domain also enhances the binding of melanophilin to myosin Va (58). Movement along microtubules facilitates melanosome transport back and forth from the perinuclear region to the cell periphery, but myosin Va-mediated transport is required for the accumulation of melanosomes at the periphery (45). The disassembly of the tripartite complex may depend on the protease-dependent degradation of melanophilin through multiple C-terminal PEST-like motifs (59).
 
Once transported to the tips of dendrites, melanosomes must be captured there, docked, and released to adjacent keratinocytes. Rab27a and its effectors participate in the docking of melanosomes, as well as secretory vesicles in other cell types, to the plasma membrane using a general mechanism in which Rab27 effectors serve as adapter molecules that bridge the Rab27·vesicle complex and plasma membrane binding proteins or membrane components themselves [(60) and references therein]. Studies of Slp2, Slp4-a, and rabphilin suggest that they do so using their R27BDs to bind Rab27a, and another domain, a linker or tandem C2 domains with specificity for distinct plasma membrane molecules, to link to the cell membrane. In the case of melanosomes, Slp2 has been demonstrated to tether melanosomes to the plasma membrane of cultured skin melanocytes by binding to Rab27a and phosphatidylserine in the lipid bilayer (32). However, Slp2-deficient mice display no pigmentation defects, suggesting that other Rab27a effector proteins compensate for its loss (61). Instead, Slp2 is required for mucus granule docking and secretion in gastric surface mucous cells.
 
The diluted coat color phenotype of Rab27aash, Myo5ad and Mlphln mice can be rescued by the semi-dominant dilute suppressor (dsu) locus (62;63), which bears a mutation in the gene encoding melanoregulin (Mreg) (64). Mregdsu suppresses the coat color defect, but not the neurological or lethal effects of Myo5a-null alleles [i.e. dilute lethal (Myo5ad-l) and Myo5ad-l20J] (63;65), which must also affect the production of an alternatively spliced neuronal isoform of Myo5a (66). [On the other hand, Myo5ad (also called dilute viral, Myo5ad-v) contains a retroviral intronic insertion that disrupts the melanocyte-specific but not the neuronal-specific transcript (65;66).] Mregdsu does not suppress the diluted coat color of 14 other mutants which have mechanistically different causes for pigmentation defects, although it does suppress the ruby eye color of ruby-eye and ruby-eye-2 mice (67) (see records for stamper-coat, toffee, and dorian gray). The dsu locus has been demonstrated to function cell-autonomously in melanocytes; its protein product is not diffusible (68). Mregdsu modulates hair pigment through a myosin Va-independent pathway, as demonstrated by its inability to restore proper melanosome transport/localization in both Myo5ad/d and Myo5a-null melanocytes (64). Instead, Mregdsu alters the incorporation of pigment into hair, decreasing the normal spacing between bands of pigment in the hair. Mreg is a 214 amino acid vertebrate protein with no similarity to known motor proteins or transcription factors, and lacks any known functional domains. Thus, the mechanism by which it regulates pigment incorporation into hair is yet unknown. Recently, Mreg was shown to interact with peripherin-2, a tetraspanin protein regulating the formation of disk membranes, specialized organelles of photoreceptor rod cells (69).
 
In humans, mutations in RAB27A cause Griscelli syndrome type II, which is characterized by partial albinism and hemophagocytic syndrome (70) (OMIM #607624). The underlying mechanisms resulting in pigmentary dilution in humans are the same as those in mice, discussed above. Hemophagocytic syndrome (also called hemophagocytic lymphohistiocytosis, HLH) is characterized by polyclonal CD8 T cell and macrophage activation and infiltration of multiple organs, leading to death unless treated by bone marrow transplant (71). In Rab27aash mice, lytic granules of CTLs and natural killer (NK) cells are blocked at a late secretory step, successfully polarizing towards the immunological synapse (a microtubule-dependent step) but failing to fuse and release their contents (10;42). Interestingly, the Rab27a/melanophilin/myosin Va complex-dependent mechanism underlying melanosome secretion is not utilized during lytic granule secretion, as demonstrated by the normal cytolytic activity of CTLs and NK cells in Myo5ad mice (40), and normal immune function of myosin Va- and melanophilin-deficient patients (72;73). Furthermore, the perinuclear clusters of Rab27aash melanosomes are cytologically distinct from the membrane-proximal polarized lytic granules of Rab27aash CTLs. These findings suggest that Rab27a interacts with a different set of molecular partners to transport lytic granules of CTLs close to the immunological synapse than those utilized to transport melanosomes.
 
The secretory defect observed in Rab27a-deficient human and mouse CTLs is similar to that seen in human FHL3 (familial hemophagocytic lymphohistiocytosis 3; OMIM #608898) cells and mouse jinx cells, which harbor mutations in Munc13-4 (also called Unc13d) (74;75), a putative Rab27a binding partner in CTLs and NK cells (40;41). In FHL3 CTLs, lytic granules dock at the immunological synapse, but fail to fuse with the membrane, indicating a block in priming granules to fusion competence (75). In contrast, in Rab27aash CTLs, granules polarize and cluster near the membrane, but do not actually dock. Unc13d and Rab27a can be coimmunoprecipitated from platelets, CTLs and mast cells, and overexpression of Unc13d enhances degranulation of secretory lysosomes from mast cells and can rescue the dominant negative effect of an unprenylated activated Rab27a mutant on secretion from platelets (40;41).  These data suggest that Unc13d functions as an effector of Rab27a during regulated exocytosis, although Rab27a and probably another effector are also required for the transport of granules close to the plasma membrane, an earlier step in the process of secretion. Recent data also demonstrate a Rab27a-independent function of Unc13d, in which Unc13d promotes the maturation of lytic granules by eliciting the fusion of recycling endosomes with late endosomes, and in turn, these vesicles with cytotoxic perforin/granzyme-containing vesicles (76).
Putative Mechanism
The concrete mutation appears to result in a functionally null animal, as no Rab27a protein is detected in cells from these mice (1). Study of concrete mice supports previous work suggesting that neutrophil function is impaired in Griscelli syndrome patients. Abnormal bactericidal activity or phagocytic ability was observed in the neutrophils of some patients (2;3). Concrete mice display impaired secretion of azurophilic granules, lysosome-related organelles that contain MPO, defensins and other antimicrobial peptides, which can be released into phagosomes or extracellularly in order to kill invading bacteria. Interestingly, Rab27a localizes on only a small subset of MPO-containing granules, suggesting that this population of neutrophil granules is heterogeneous in its content of exocytic machinery. The Rab27a-containing granules are postulated to be available for release, while those lacking Rab27a may be non-releasable (1). This hypothesis is consistent with the observation that only a minor subpopulation of azurophilic granules is exocytosed (77). The mechanism of Rab27a-mediated azurophilic granule release involves the effector JFC1/Slp1, which can be co-immunoprecipitated with Rab27a from granulocytes and colocalizes with Rab27a at the surface of MPO-containing granules (1;36).
 
Lysosome-phagosome fusion is considered as a type of intracellular secretion, and azurophilic granules predominantly release their contents into phagosomes during bacterial engulfment. Notably, neither Rab27a nor JFC1/Slp1 are part of azurophilic granules that fuse with phagosomes during phagocytosis of a labeled substrate, and Rab27a-deficient neutrophils both efficiently phagocytose substrate and deliver MPO to phagosomes (1). These results suggest that Rab27a mediates the fusion of azurophilic granules with the plasma membrane, and that these Rab27a-containing granules are distinct from those that fuse with phagosomes.
 
Concrete mice are resistant to Listeria monocytogenes infections, a somewhat surprising finding since elimination of Listeria relies on neutrophil function. However, neutrophils may retain relatively normal function in concrete animals, as both phagosome loading and phagocytosis itself are normal in mutants. Concrete mice are highly susceptible to MCMV, and accordingly, NK cell degranulation is severely impaired.
Primers Primers cannot be located by automatic search.
Genotyping
Concrete genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. The same primers are used for PCR amplification and for sequencing.
 
Primers
Con(F): 5’-TTCGGGACTCAATTCTCTTGA -3’
Con(R): 5’-TCTGGCAGCTCATCTTACCA-3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:30
3) 55°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 40X
6) 72°C             10:00
7) 4°C               ∞
 
The following sequence of 336 nucleotides (from Genbank genomic region NC_000075 for linear DNA sequence of Rab27α) is amplified:
 
37418                                         ttc gggactcaat tctcttgaga
37441 agtctaaatg ctttgagatt ttgtgctgaa tcgaaagtca agaagagccc gctggtctca
37501 gaatttccct tggcttatct ttgctttgct gttttaggtg tacagagcca atgggccaga
37561 tggagctgtg ggccgaggcc agagaatcca cctgcagtta tgggacacgg cggggcagga
37621 gaggtatgtc tccccagtct gtccacactg acctgggcag gagaggtgtg tctcccccag
37681 tctattcaca ctgacctggc caggcaaagg cagccaactg gctcatctgc acctggtaag
37741 atgagctgcc aga
 
Primer binding sites are underlined; the mutated A is shown in red text.
References
16.  Tolmachova, T., Ramalho, J. S., Anant, J. S., Schultz, R. A., Huxley, C. M., and Seabra, M. C. (1999) Cloning, mapping and characterization of the human RAB27A gene, Gene 239, 109-116.
27.  Yi, Z., Yokota, H., Torii, S., Aoki, T., Hosaka, M., Zhao, S., Takata, K., Takeuchi, T., and Izumi, T. (2002) The Rab27a/granuphilin complex regulates the exocytosis of insulin-containing dense-core granules, Mol. Cell Biol. 22, 1858-1867.
43.  Desnos, C., Schonn, J. S., Huet, S., Tran, V. S., El-Amraoui, A., Raposo, G., Fanget, I., Chapuis, C., Menasche, G., de Saint, B. G., Petit, C., Cribier, S., Henry, J. P., and Darchen, F. (2003) Rab27A and its effector MyRIP link secretory granules to F-actin and control their motion towards release sites, J Cell Biol. 163, 559-570.
54.  Wu, X., Wang, F., Rao, K., Sellers, J. R., and Hammer, J. A., III (2002) Rab27a is an essential component of melanosome receptor for myosin Va, Mol. Biol. Cell 13, 1735-1749.
62.  Moore, K. J., Swing, D. A., Rinchik, E. M., Mucenski, M. L., Buchberg, A. M., Copeland, N. G., and Jenkins, N. A. (1988) The murine dilute suppressor gene dsu suppresses the coat-color phenotype of three pigment mutations that alter melanocyte morphology, d, ash and ln, Genetics 119, 933-941.
Science Writers Eva Marie Y. Moresco
Illustrators Diantha La Vine
AuthorsSophie Rutschmann, Celine Eidenschenk, Bruce Beutler
Edit History
11/12/2010 12:25 PM (current)
09/10/2010 2:39 PM
07/30/2010 1:28 PM
07/29/2010 9:35 AM
07/21/2010 2:34 PM
05/11/2010 1:18 PM
05/11/2010 1:10 PM
05/11/2010 1:10 PM
05/11/2010 10:27 AM
05/11/2010 10:25 AM
05/11/2010 10:25 AM
05/11/2010 10:24 AM
05/11/2010 10:22 AM
05/11/2010 10:20 AM
05/11/2010 10:20 AM
05/11/2010 10:18 AM
05/11/2010 10:15 AM
05/11/2010 10:13 AM
05/11/2010 10:11 AM
05/11/2010 10:05 AM
05/10/2010 1:47 PM
04/30/2010 2:17 PM
02/03/2010 9:13 AM