Allele | elektra2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | missense | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | 11 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coordinate | 82,960,390 bp (GRCm39) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Base Change | A ⇒ T (forward strand) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene | Slfn2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | schlafen 2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonym(s) | Shlf2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 82,955,938-82,961,504 bp (+) (GRCm39) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype | PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit increased susceptibility to bacterial and viral infections, reduced T cell numbers, decreased T cell proliferation, and increased apoptosis of activated T cells. [provided by MGI curators] | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Number | NCBI RefSeq: NM_0011408; MGI:1313258 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mapped | Yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Limits of the Critical Region | 83065112 - 83070678 bp | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | Histidine changed to Leucine | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | predicted gene model for protein(s): [ENSMUSP00000035562] | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AlphaFold | Q9Z0I6 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000035562 Gene: ENSMUSG00000072620 AA Change: H123L
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably benign
PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Meta Mutation Damage Score | 0.0898 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Is this an essential gene? | Probably nonessential (E-score: 0.049) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Category | Autosomal Recessive | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Candidate Explorer Status | loading ... | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Single pedigree Linkage Analysis Data |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Penetrance | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | All Mutations and Alleles(2) : Chemically induced (ENU)(1) Targeted(1) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mode of Inheritance | Autosomal Recessive | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Local Stock | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repository | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Last Updated | 2019-09-04 9:44 PM by Anne Murray | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Created | 2015-11-12 7:52 PM by Jin Huk Choi | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Posted | 2016-06-03 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Description |
The elektra2 phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R3437, some of which showed a diminished T-dependent antibody response to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal) (Figure 1). |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 48 mutations. The reduced T-dependent antibody response to rSFV-β-gal phenotype was linked by continuous variable mapping to a mutation in Slfn2: an A to T transversion at base pair 83,069,564 (v38) on chromosome 11, or base pair 4,453 in the GenBank genomic region NC_000077 for the Slfn2 gene. Linkage was found with a recessive model of inheritance (P = 4.673 x 10-5), wherein four variant homozygotes departed phenotypically from 11 homozygous reference mice and 10 heterozygous mice (Figure 2). The mutation corresponds to residue 550 in the mRNA sequence NM_0011408 within exon 2 of 2 total exons.
The mutated nucleotide is indicated in red. The mutation results in a histidine (H) to leucine (L) substitution at position 123 (H123L) in the Slfn2 protein, and is strongly predicted by PolyPhen-2 to be benign (score = 0.045) (1). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustration of Mutations in Gene & Protein |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Protein Prediction |
Schlafen2 is one of ten Schlafen (Slfn) protein family members that exist in mice and are thought to regulate thymocyte maturation and T cell activation. Slfns 1-4 contain a core region of 120 residues that are nearly identical, with divergent sequences at the N terminus. Slfn proteins contain several motifs identified based on sequence similarity to other proteins (Figure 3). All Slfns possess a region, designated COG2685 (NCBI Conserved Domain Database), with similarity to a domain present in several ATP-dependent DNA helicases, transcriptional regulators, as well as several hypothetical proteins from both prokaryotes and eukaryotes (2). The domain, of unknown function but predicted to contain a helix-turn-helix DNA binding motif, has been referred to as the “Slfn box” (3). In Slfn2, this domain is positioned between amino acids 258-280. Adjacent and overlapping the COG2685 domain, Slfns contain a divergent AAA domain, which is related to the AAA (ATPases associated with various cellular activities) domain present in proteins of the AAA-containing family (4). The elektra2 mutation, which converts histidine 123 to leucine, is found in a region of Slfn2 for which no functional domains have yet been identified. Please see the elektra record for more information about Slfn2. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Mechanism | The function of the SLFN protein family has been investigated in several studies, but so far relatively little is known. Initial reports suggested that Slfns 1-3 have growth inhibitory properties. Studies of elektra mice demonstrate that a Slfn2 mutation causes immunodeficiency as a consequence of T cell and monocyte apoptosis secondary to a semi-activated phenotype (5). The semi-activated state in Slfn2elektra/elektra T cells stems from a loss of cellular quiescence (5). Slfn2 is proposed to maintain the quiescent state by promoting the expression of quiescence genes and/or repression of genes required for proliferation/differentiation. The failure of mature homozygous elektra T cells to engage the anti-apoptotic machinery of the cell stems from loss of quiescence and acquisition of a semi-activated phenotype by naïve elektra T cells, and is not a consequence of impaired survival signaling or activation by a lymphopenic environment (5). The activation of several pathways, including the NF-κB, NFAT, AKT, ERK1/2, JNK, and p38-MAP kinase pathways, regulates T cell survival. In the case of homozygous elektra mutants, we presume that as a result of a loss of quiescence, the balance between these pathways is altered to favor apoptosis rather than expansion. The enhancement of p38-MAPK and JNK phosphorylation observed upon TCR stimulation of elektra T cells, and the fact that inflammatory monocytes (of the myeloid lineage) also undergo apoptosis upon activation, suggest that the proliferative signals negatively regulated by Slfn2 may be distinct from the TCR signaling pathways that lead to the development of activated T cell effector functions and full T cell activation. Slfn2 is required for normal proliferation of CD8+ T cells in response to TCR stimulation, PMA/ionomycin treatment, and LCMV infection. The elektra mice exhibited delayed production of antibodies in response to MCMV infection. The phenotype of the elektra2 mice indicates some loss-of-function of Slfn2elektra2. However, other immune cell phenotypes observed in the elektra strain were not observed or tested in elektra2, indicating that Slfn2elektra2 may retain some function. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primers |
PCR Primer elektra2_pcr_F: TTCTCACCTCAGAAAACAGGAG elektra2_pcr_R: TTCCACTTCAGGGAAGGCTATG Sequencing Primer elektra2_seq_F: GGAGAATGCAAACATCTCTCTAGCTG elektra2_seq_R: AACTCTGGTCTGACACAGGG |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genotyping | PCR program 1) 94°C 2:00 The following sequence of 418 nucleotides is amplified (chromosome 11, + strand): 1 ttctcacctc agaaaacagg agaatgcaaa catctctcta gctgtatgtg ctctcctgaa Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writers | Anne Murray | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustrators | Peter Jurek | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Jin Huk Choi, James Butler, Bruce Beutler |