Phenotypic Mutation 'Penny'

• Allele: Penny
• Mutation Type: missense
• Chromosome: 11
• Coordinate: 101,077,590 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Cntnap1
• Gene Name: contactin associated protein-like 1
• Synonym(s): Nrxn4, NCP1, Caspr, paranodin, p190, shm
• Chromosomal Location: 101,065,429-101,081,550 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene product was initially identified as a 190-kD protein associated with the contactin-PTPRZ1 complex. The 1,384-amino acid protein, also designated p190 or CASPR for 'contactin-associated protein,' includes an extracellular domain with several putative protein-protein interaction domains, a putative transmembrane domain, and a 74-amino acid cytoplasmic domain. Northern blot analysis showed that the gene is transcribed predominantly in brain as a transcript of 6.2 kb, with weak expression in several other tissues tested. The architecture of its extracellular domain is similar to that of neurexins, and this protein may be the signaling subunit of contactin, enabling recruitment and activation of intracellular signaling pathways in neurons. [provided by RefSeq, Jan 2009] ; PHENOTYPE: Homozygous mutant mice exhibit reduced body size and nervous system defects, including impaired balance, hypoactivity, and ataxia. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Glutamic Acid changed to Glycine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000099398]
• AlphaFold: O54991
• SMART Domains: Protein: ENSMUSP00000099398; Gene: ENSMUSG00000017167; AA Change: E1084G

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
FA58C	25	169	7.49e-36	SMART
LamG	196	333	2.86e-32	SMART
LamG	382	516	3.49e-27	SMART
EGF	544	578	2.28e0	SMART
Blast:FBG	580	777	1e-133	BLAST
LamG	806	940	1.95e-25	SMART
EGF_like	961	997	6.03e1	SMART
low complexity region	1032	1044	N/A	INTRINSIC
low complexity region	1047	1058	N/A	INTRINSIC
low complexity region	1063	1078	N/A	INTRINSIC
LamG	1081	1219	2.59e-30	SMART
4.1m	1305	1323	7.85e-7	SMART
low complexity region	1333	1370	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
  (Using ENSMUST00000103109)
• Meta Mutation Damage Score: 0.1514
• Is this an essential gene?: Possibly essential (E-score: 0.581)
• Phenotypic Category: Autosomal Semidominant
• Mode of Inheritance: Autosomal Semidominant
• Last Updated: 2019-09-04 9:44 PM by Anne Murray
• Record Created: 2015-11-14 7:02 PM by Emre Turer
• Record Posted: 2016-12-01
• Science Writers: Anne Murray
• Illustrators: Katherine Timer
• Authors: Emre Turer and Bruce Beutler

Accession Number

NCBI RefSeq: NM_016782; MGI:1848201

Alleles Listed at MGI

All Mutations and Alleles(14) : Gene trapped(1) Radiation induced(1) Spontaneous(4) Targeted(8)

Phenotypic Description

Figure 1. Penny mice exhibit reduced body weights. Scaled weight data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Penny phenotype was identified among N-nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R3795, some of which showed reduced body weights compared to wild-type littermates (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced body weight using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 37 mutations (X-axis) identified in the G1 male of pedigree R3795. Weight phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 37 mutations. The body weight phenotype was linked to a mutation in Cntnap1: an A to G transition at base pair 101,186,764 (v38) on chromosome 11, or base pair 12,116 in the GenBank genomic region NC_000077 encoding Cntnap1. Linkage was found with an additive model of inheritance, wherein four variant homozygotes and 10 heterozygous mice departed phenotypically from 10 homozygous reference mice with a P value of 3.249 x 10^-5 (Figure 4).  

The mutation corresponds to residue 3,392 in the mRNA sequence NM_016782 within exon 19 of 24 total exons.

3379 GTTACTGGAGAGGAGGTCTCCTTCAGCTTC 1080 -V--T--G--E--E--V--S--F--S--F-

The mutated nucleotide is indicated in red.  The mutation results in a glutamic acid (E) to glycine (G) substitution at position 1,084 (E1084G) in the Caspr protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.994).

Protein Prediction

Figure 3. Domain organization of Caspr. The extracellular region of Caspr has a signal peptide (SP), a discoidin domain, four laminin G (LamG) domains, two epidermal growth factor (EGF)-like domains, a fibrinogen-like domain, and a PGY (Pro-Gly-Tyr)-enriched segment. The cytoplasmic domain of Caspr has a band 4.1 binding motif (i.e., FERM domain [four point one, ezrin, radixin, moesin]), a proline-rich sequence, and a consensus SH3 binding site. The Penny mutation results in a glutamic acid (E) to glycine (G) substitution at position 1,084 (E1084G).

Cntnap1 encodes contactin-associated protein (Caspr; alternatively: paranodin or NCP1 [Neurexin IV/Caspr1/Paranodin]), a component of the paranode (1-3). Caspr is a single-pass transmembrane protein with a large extracellular domain and a short intracellular domain (Figure 3) (4). Caspr shares a high degree of homology in its extracellular domain to neurexins I, II, and III (5). The extracellular region of Caspr has a discoidin domain, four laminin G domains, two epidermal growth factor (EGF; see the record for Velvet for information about Egfr)-like domains, a fibrinogen-like domain, and a PGY (Pro-Gly-Tyr)-enriched segment (3;5). The discoidin domain typically contains two conserved cysteines that link the extremities of the domain by a disulfide bond. The laminin G domains are approximately 180-amino acids in length and are often found in extracellular proteins. Laminin G-containing proteins have a wide variety of roles in cell adhesion, signaling, migration, assembly and differentiation. The EGF-like domain is a 30- to 40-amino acid domain that typically contains six cysteine residues that, in EGF, are involved in disulfide bond formation. The structure of the EGF domain is a two-stranded beta-sheet followed by a loop to a C-terminal short two-stranded sheet. The PGY motif mediates Caspr endoplasmic reticulum retention (6). Deletion of the PGY motif promotes cell surface delivery of Caspr by bypassing the calnexin-calreticulin-associated quality control (6).

The cytoplasmic domain of Caspr has a band 4.1 binding motif (i.e., FERM domain [four point one, ezrin, radixin, moesin]), a proline-rich sequence, and a consensus SH3 binding site (4;5). Protein 4.1-like domains often mediate the linkage between cell membrane proteins and the cytoskeleton. The protein 4.1-like domain of Caspr is required for the retention of the cell adhesion complex at the paranodal junction (7). The proline-rich sequence mediates interactions between Caspr and SH3-containing proteins (8).

Caspr is proteolytically processed at the cell surface in developing and mature brains by Reelin, an extracellular matrix glycoprotein and serine protease (9). Prion protein inhibits Reelin-associated cleavage of Caspr.

The Penny mutation results in a glutamic acid (E) to glycine (G) substitution at position 1,084 (E1084G); residue 1,084 is within the fourth laminin G domain.

Expression/Localization

Caspr is expressed only in neurons. Caspr localizes to the paranodes in cerebellar white matter and in hippocampal myelinated axons; Caspr is largely absent from the synaptic regions (2;10;11). Caspr is expressed at high levels on the surface of unensheathed neurites and downregulated during myelination (2).

Background

Figure 4. Caspr localizes to the paranodal junctions. The Caspr/contactin complex in the axolemma faces neurofascin 155 (Nf155) at the glial membrane. The cytoplasmic tail of Caspr interacts with protein 4.1B, which stabilizes the Caspr/contactin complex. Protein 4.1B co-localizes with ankyrin-B, αII- and βII-spectrin at both paranodes and juxtaparanodes providing a potential link with the actin cytoskeleton. MBD, membrane binding domain . See the text for more details.

During nervous system development, cell-cell interactions are necessary for axonal projections to navigate to areas in which synapses are going to form. Cell adhesion molecules (e.g., NrCAM) mediate cell-cell interactions by interacting with each other and/or the extracellular matrix during nervous system development, subsequently facilitating several functions including cell adhesion and migration, axonal growth, fasciculation (i.e., involuntary muscle contractions), guidance, target recognition, synapse formation, and plasticity.

Most axons are insulated with myelin sheaths, which allows for the rapid propagation of nerve impulses. Myelin is a multilamellar membrane formed by oligodendrocytes in the central nervous system and by Schwann cells in the peripheral nervous system. During myelination, a glial process wraps around the axon, forming multiple layers of myelin and elongating along the axon. The myelinating glial cells organize the axons into segments: the nodes of Ranvier, paranode, and juxtaparanode (Figure 4). The paranode separates the node of Ranvier and juxtaparanodal domain, and also function as an electrical barrier to promote action potential propagation. The paranodal junctions are comprised of three highly conserved proteins: Caspr, the GPI-anchored neural cell adhesion molecule contactin, and the neurofascin 155 kDa isoform (Nf155; see the record for jiggle). Caspr and contactin form heteromers that localize to the paranodal junctions during myelination (2;7;12); contactin promotes the surface expression of Caspr (13). The Caspr and contactin heteromer interact in trans with the Nf155 expressed in the glia (14). Nf155 binds directly to contactin, and Caspr inhibits the Nf155-contactin interaction (15). The Caspr/contactin/Nf155 complex is required for the formation of the paranodal spectate-like junctions that link the glial loops to the axolemma. Ion channel clusters within the node of Ranvier, paranodal junction, and the juxtaparanodal region are required for the fast propagation of action potentials. Ion channel localization is specific domains depends on cell adhesion molecules, cytoskeletal proteins, and the integrity of neighboring domains. Loss of Caspr expression results in relocation of Kv1 channels from the juxtaparanodal region to the adjacent paranodes (5;17). Caspr is required for the clustering of voltage-gated channels at both the longitudinal aspect of the axolemma (nodal domains) and the radial (mesaxonal) domain (18). Caspr colocalizes with several proteins at the paranodes, including the scaffolding proteins ankyrin-B, αII- and β II-spectrin (16). Additional proteins that interact with Caspr are listed in Table 1.

Table 1. Caspr interacting proteins

Interacting protein	Brief description of interacting protein function	Downstream effect of interaction	References
Contactin	Cell adhesion molecule	Facilitates the surface transport of Caspr andf ormation of axoglial paranodal junctions surrounding the nodes of Ranvier	(13;19)
Nf155	Glial protein and splice variant of neurofascin (see the record for jiggle)	Formation of axoglial paranodal junctions surrounding the nodes of Ranvier	(19)
Nogo-A	Inhibitor of neurite growth from dorsal root ganglia	Paranodes in myelinated axons; regulation of K+ channel localization	(20)
Prion protein (PrP)	Adhesion protein that inhibits reelin-mediated shedding of Caspr from the cell surface	Potentiates the inhibitory effect of Caspr on neurite outgrowth	(9)
AMPA receptors	Receptors that mediate fast excitatory synaptic transmission in the central nervous system	Caspr/AMPA association regulates AMPA receptor trafficking to synapses	(21)
γ-secretase associated complex	Multi-subunit protease complex; cleaves amyloid precursor protein (APP)	Regulates APP generation during Alzheimer’s disease pathogenesis	(22)
APP	Promotes neural growth and repair; putatively binds other proteins on the cell surface to promote cell adhesion	Regulates Aβ generation during Alzheimer’s disease pathogenesis	(23)
Schwannomin/merlin and integrin β1	Tumor suppressor	Unknown	(24)
4.1-like proteins	Cytoskeletal adaptor protein	Promotes stability and plasticity to neuronal membrane	(3)
Protein 4.1B	Cytoskeletal adaptor protein	Putative link between the paranode and the axonal cytoskeleton; retention of the cell adhesion complex at the paranodal junction	(8;25)

Mutations in CNTNAP1 are linked to lethal congenital contracture syndrome 7 (LCCS7; OMIM: #616286; (26)). LCCS7 is an axoglial form of arthrogryposis multiplex congenita, and is characterized by congenital distal joint contractures, polyhydramnios, reduced fetal movements, and severe motor paralysis leading to death early in early childhood.

Putative Mechanism

The shambling (shm/shm) mutant mouse strain has a TT insertion in exon 22 of Cntnap1 that results in coding of a premature stop codon in exon 23 (17;27). The mutation results in expression of a truncated protein that lacks the transmembrane and cytoplasmic domains. The shm/shm mice are smaller in size compared to their wild-type littermates and also have a wobbly gait due to hindlimb weakness and tremors (17;27). The gait phenotype is observed as early as postnatal day 14 (P14), whereby the mice exhibit slow motor activity and diminished coordination in hindlimb movement. The motor defects were progressive and often the mice become immobile with age. The shm/shm mice often died around weaning (17). The numbers of myelinated axons, diameter of the axons, the thickness of the myelin sheath, the formation of the sciatic nerves, node, and paranodes were comparable between the shm/shm and wild-type mice. The length of the node was longer in the shm/shm mice than that in wild-type mice. Paranodal junctions were not seen in the paranodes of sciatic nerves in the shm/shm mice, and the axoglial junctions were disrupted in the paranodes of the shm/shm mice (17).

Cntnap1-deficient (Cntnap1^-/-) mice are born at the expected Mendelian frequency, but exhibit neurological defects, aberrant paranodal junction organization, and axo-glial interactions in the paranodal region (5). By P11, the Cntnap1^-/- mice were smaller in stature than wild-type mice and exhibited progressive neurological defects, including hypomotility, tremors, ataxia, inability to maintain balance on a stationary beam (5;10). The Cntnap1^-/- mice exhibited disrupted paranodal axo-glial junctions, which led to cytoskeletal disorganization and Purkinje neuron axon degeneration in the cerebellum (10). Cntnap1^-/- mice had normal synaptic transmission and plasticity in the CA1 region of the hippocampus (11). The smooth endoplasmic reticulum accumulates at the nodal/paranodal region in the Cntnap1^-/- mice, and axonal swellings result in myelin splitting at the paranodes. Similar to the shm/shm mice, most of the Cntnap1^-/- mice died at or around weaning. Heterozygous (Cntnap1^+/-) mice appear normal.

Both the Cntnap1^-/- and shm/shm mouse models were smaller than their wild-type littermates (5;10;17). The Penny mice do not exhibit overt neurological defects, but show reduced body weights compared to their wildtype littermates indicating that some Caspr^Penny function may be retained, or that another protein (e.g., Caspr2) may be compensating for the loss of Caspr function in the Penny mice.

Primers

PCR Primer
Penny_pcr_F: TGGATGCGCTATAACCTCCAG
Penny_pcr_R: CGTCTAAAGGACTGGATCTTTGC

Sequencing Primer
Penny_seq_F: GAGTTCTCACACATGCTGAGC
Penny_seq_R: CATTAGTCAATCTCTGTGGGAGCC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 407 nucleotides is amplified (chromosome 11, + strand):

1   tggatgcgct ataacctcca gtcagcactg cgctctgcag cccgggagtt ctcacacatg
61  ctgagccggc cagtgccggg ctatgagcct ggctatgttc caggctacga cactcctggt
121 tacgtgcctg gataccacgg ccctgggtac cgactgcccg agtacccgag gcccggccgg
181 ccagtgcccg ggtatagggg gcctgtctac aatgttactg gagaggaggt ctccttcagc
241 ttcagcacca actctgctcc tgccgtcctg ctctatgtca gctcctttgt acgtgactac
301 atggctgtgc tcatcaagga agacggtaag tgctcctcgg ctctctccct gcaggtgccc
361 aggctcccac agagattgac taatgcaaag atccagtcct ttagacg

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Bellen, H. J., Lu, Y., Beckstead, R., and Bhat, M. A. (1998) Neurexin IV, Caspr and Paranodin--Novel Members of the Neurexin Family: Encounters of Axons and Glia. Trends Neurosci. 21, 444-449.

  2. Einheber, S., Zanazzi, G., Ching, W., Scherer, S., Milner, T. A., Peles, E., and Salzer, J. L. (1997) The Axonal Membrane Protein Caspr, a Homologue of Neurexin IV, is a Component of the Septate-Like Paranodal Junctions that Assemble during Myelination. J Cell Biol. 139, 1495-1506.

  3. Menegoz, M., Gaspar, P., Le Bert, M., Galvez, T., Burgaya, F., Palfrey, C., Ezan, P., Arnos, F., and Girault, J. A. (1997) Paranodin, a Glycoprotein of Neuronal Paranodal Membranes. Neuron. 19, 319-331.

  4. Peles, E., Joho, K., Plowman, G. D., and Schlessinger, J. (1997) Close Similarity between Drosophila Neurexin IV and Mammalian Caspr Protein Suggests a Conserved Mechanism for Cellular Interactions. Cell. 88, 745-746.

  5. Bhat, M. A., Rios, J. C., Lu, Y., Garcia-Fresco, G. P., Ching, W., St Martin, M., Li, J., Einheber, S., Chesler, M., Rosenbluth, J., Salzer, J. L., and Bellen, H. J. (2001) Axon-Glia Interactions and the Domain Organization of Myelinated Axons Requires Neurexin IV/Caspr/Paranodin. Neuron. 30, 369-383.

  6. Bonnon, C., Bel, C., Goutebroze, L., Maigret, B., Girault, J. A., and Faivre-Sarrailh, C. (2007) PGY Repeats and N-Glycans Govern the Trafficking of Paranodin and its Selective Association with Contactin and Neurofascin-155. Mol Biol Cell. 18, 229-241.

  7. Gollan, L., Sabanay, H., Poliak, S., Berglund, E. O., Ranscht, B., and Peles, E. (2002) Retention of a Cell Adhesion Complex at the Paranodal Junction Requires the Cytoplasmic Region of Caspr. J Cell Biol. 157, 1247-1256.

  8. Peles, E., Nativ, M., Lustig, M., Grumet, M., Schilling, J., Martinez, R., Plowman, G. D., and Schlessinger, J. (1997) Identification of a Novel Contactin-Associated Transmembrane Receptor with Multiple Domains Implicated in Protein-Protein Interactions. EMBO J. 16, 978-988.

  9. Devanathan, V., Jakovcevski, I., Santuccione, A., Li, S., Lee, H. J., Peles, E., Leshchyns'ka, I., Sytnyk, V., and Schachner, M. (2010) Cellular Form of Prion Protein Inhibits Reelin-Mediated Shedding of Caspr from the Neuronal Cell Surface to Potentiate Caspr-Mediated Inhibition of Neurite Outgrowth. J Neurosci. 30, 9292-9305.

  10. Garcia-Fresco, G. P., Sousa, A. D., Pillai, A. M., Moy, S. S., Crawley, J. N., Tessarollo, L., Dupree, J. L., and Bhat, M. A. (2006) Disruption of Axo-Glial Junctions Causes Cytoskeletal Disorganization and Degeneration of Purkinje Neuron Axons. Proc Natl Acad Sci U S A. 103, 5137-5142.

  11. Pillai, A. M., Garcia-Fresco, G. P., Sousa, A. D., Dupree, J. L., Philpot, B. D., and Bhat, M. A. (2007) No Effect of Genetic Deletion of Contactin-Associated Protein (CASPR) on Axonal Orientation and Synaptic Plasticity. J Neurosci Res. 85, 2318-2331.

  12. Rios, J. C., Melendez-Vasquez, C. V., Einheber, S., Lustig, M., Grumet, M., Hemperly, J., Peles, E., and Salzer, J. L. (2000) Contactin-Associated Protein (Caspr) and Contactin Form a Complex that is Targeted to the Paranodal Junctions during Myelination. J Neurosci. 20, 8354-8364.

  13. Faivre-Sarrailh, C., Gauthier, F., Denisenko-Nehrbass, N., Le Bivic, A., Rougon, G., and Girault, J. A. (2000) The Glycosylphosphatidyl Inositol-Anchored Adhesion Molecule F3/contactin is Required for Surface Transport of paranodin/contactin-Associated Protein (Caspr). J Cell Biol. 149, 491-502.

  14. Charles, P., Tait, S., Faivre-Sarrailh, C., Barbin, G., Gunn-Moore, F., Denisenko-Nehrbass, N., Guennoc, A. M., Girault, J. A., Brophy, P. J., and Lubetzki, C. (2002) Neurofascin is a Glial Receptor for the paranodin/Caspr-Contactin Axonal Complex at the Axoglial Junction. Curr Biol. 12, 217-220.

  15. Gollan, L., Salomon, D., Salzer, J. L., and Peles, E. (2003) Caspr Regulates the Processing of Contactin and Inhibits its Binding to Neurofascin. J Cell Biol. 163, 1213-1218.

  16. Ogawa, Y., Schafer, D. P., Horresh, I., Bar, V., Hales, K., Yang, Y., Susuki, K., Peles, E., Stankewich, M. C., and Rasband, M. N. (2006) Spectrins and ankyrinB Constitute a Specialized Paranodal Cytoskeleton. J Neurosci. 26, 5230-5239.

  17. Sun, X. Y., Takagishi, Y., Okabe, E., Chishima, Y., Kanou, Y., Murase, S., Mizumura, K., Inaba, M., Komatsu, Y., Hayashi, Y., Peles, E., Oda, S., and Murata, Y. (2009) A Novel Caspr Mutation Causes the Shambling Mouse Phenotype by Disrupting Axoglial Interactions of Myelinated Nerves. J Neuropathol Exp Neurol. 68, 1207-1218.

  18. Gordon, A., Adamsky, K., Vainshtein, A., Frechter, S., Dupree, J. L., Rosenbluth, J., and Peles, E. (2014) Caspr and caspr2 are Required for both Radial and Longitudinal Organization of Myelinated Axons. J Neurosci. 34, 14820-14826.

  19. Poliak, S., and Peles, E. (2003) The Local Differentiation of Myelinated Axons at Nodes of Ranvier. Nat Rev Neurosci. 4, 968-980.

  20. Nie, D. Y., Zhou, Z. H., Ang, B. T., Teng, F. Y., Xu, G., Xiang, T., Wang, C. Y., Zeng, L., Takeda, Y., Xu, T. L., Ng, Y. K., Faivre-Sarrailh, C., Popko, B., Ling, E. A., Schachner, M., Watanabe, K., Pallen, C. J., Tang, B. L., and Xiao, Z. C. (2003) Nogo-A at CNS Paranodes is a Ligand of Caspr: Possible Regulation of K(+) Channel Localization. EMBO J. 22, 5666-5678.

  21. Santos, S. D., Iuliano, O., Ribeiro, L., Veran, J., Ferreira, J. S., Rio, P., Mulle, C., Duarte, C. B., and Carvalho, A. L. (2012) Contactin-Associated Protein 1 (Caspr1) Regulates the Traffic and Synaptic Content of Alpha-Amino-3-Hydroxy-5-Methyl-4-Isoxazolepropionic Acid (AMPA)-Type Glutamate Receptors. J Biol Chem. 287, 6868-6877.

  22. Hur, J. Y., Teranishi, Y., Kihara, T., Yamamoto, N. G., Inoue, M., Hosia, W., Hashimoto, M., Winblad, B., Frykman, S., and Tjernberg, L. O. (2012) Identification of Novel Gamma-Secretase-Associated Proteins in Detergent-Resistant Membranes from Brain. J Biol Chem. 287, 11991-12005.

  23. Fan, L. F., Xu, D. E., Wang, W. H., Yan, K., Wu, H., Yao, X. Q., Xu, R. X., Liu, C. F., and Ma, Q. H. (2013) Caspr Interaction with Amyloid Precursor Protein Reduces Amyloid-Beta Generation in Vitro. Neurosci Lett. 548, 255-260.

  24. Denisenko-Nehrbass, N., Goutebroze, L., Galvez, T., Bonnon, C., Stankoff, B., Ezan, P., Giovannini, M., Faivre-Sarrailh, C., and Girault, J. A. (2003) Association of Caspr/paranodin with Tumour Suppressor schwannomin/merlin and beta1 Integrin in the Central Nervous System. J Neurochem. 84, 209-221.

  25. Denisenko-Nehrbass, N., Oguievetskaia, K., Goutebroze, L., Galvez, T., Yamakawa, H., Ohara, O., Carnaud, M., and Girault, J. A. (2003) Protein 4.1B Associates with both Caspr/paranodin and Caspr2 at Paranodes and Juxtaparanodes of Myelinated Fibres. Eur J Neurosci. 17, 411-416.

  26. Laquerriere, A., Maluenda, J., Camus, A., Fontenas, L., Dieterich, K., Nolent, F., Zhou, J., Monnier, N., Latour, P., Gentil, D., Heron, D., Desguerres, I., Landrieu, P., Beneteau, C., Delaporte, B., Bellesme, C., Baumann, C., Capri, Y., Goldenberg, A., Lyonnet, S., Bonneau, D., Estournet, B., Quijano-Roy, S., Francannet, C., Odent, S., Saint-Frison, M. H., Sigaudy, S., Figarella-Branger, D., Gelot, A., Mussini, J. M., Lacroix, C., Drouin-Garraud, V., Malinge, M. C., Attie-Bitach, T., Bessieres, B., Bonniere, M., Encha-Razavi, F., Beaufrere, A. M., Khung-Savatovsky, S., Perez, M. J., Vasiljevic, A., Mercier, S., Roume, J., Trestard, L., Saugier-Veber, P., Cordier, M. P., Layet, V., Legendre, M., Vigouroux-Castera, A., Lunardi, J., Bayes, M., Jouk, P. S., Rigonnot, L., Granier, M., Sternberg, D., Warszawski, J., Gut, I., Gonzales, M., Tawk, M., and Melki, J. (2014) Mutations in CNTNAP1 and ADCY6 are Responsible for Severe Arthrogryposis Multiplex Congenita with Axoglial Defects. Hum Mol Genet. 23, 2279-2289.

  27. Green, E. L. (1967) Shambling, a Neurological Mutant of the Mouse. J Hered. 58, 65-68.