Phenotypic Mutation 'ivan' (pdf version)
List |< first << previous [record 11 of 18] next >> last >|
Alleleivan
Mutation Type missense
Chromosome9
Coordinate73,075,544 bp (GRCm38)
Base Change A ⇒ C (forward strand)
Gene Rab27a
Gene Name RAB27A, member RAS oncogene family
Synonym(s) 4933437C11Rik, 2210402C08Rik, 2410003M20Rik
Chromosomal Location 73,044,854-73,097,629 bp (+)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the Rab family of proteins, which is the largest family within the Ras superfamily of GTPases. This gene product is thought to regulate vesicular transport, together with its specific effectors. Mutations in this gene cause several defects, including actin-based melanosome transport defects and immunodeficiency. Mutations in the human ortholog of this gene are associated with Griscelli syndrome type 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygotes have abnormal melanocyte development producing abnormal pigmentation and a gray coat color. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001301230 (variant 1), NM_023635 (variant 2), NM_001301232 (variant 3); MGI:1861441

Mapped No 
Amino Acid Change Isoleucine changed to Leucine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000034722] [ENSMUSP00000139310]
PDB Structure
Crystal Structure of the complex Rab27a-Slp2a [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000034722
Gene: ENSMUSG00000032202
AA Change: I44L

DomainStartEndE-ValueType
RAB 10 184 9.9e-92 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
(Using ENSMUST00000034722)
SMART Domains Protein: ENSMUSP00000139310
Gene: ENSMUSG00000032202
AA Change: I44L

DomainStartEndE-ValueType
RAB 10 184 9.9e-92 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
(Using ENSMUST00000184146)
Phenotypic Category
Phenotypequestion? Literature verified References
pigmentation
skin/coat/nails
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(159) : Chemically induced (ENU)(3) Gene trapped(151) Spontaneous(2) Targeted(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01144:Rab27a APN 9 73075568 critical splice donor site probably null
IGL02000:Rab27a APN 9 73084972 missense probably damaging 1.00
concrete UTSW 9 73082409 nonsense
geodude UTSW 9 73084981 missense probably damaging 1.00
R0644:Rab27a UTSW 9 73095423 missense probably benign 0.01
R0671:Rab27a UTSW 9 73075433 missense probably damaging 1.00
R1481:Rab27a UTSW 9 73082402 missense probably benign 0.13
R1522:Rab27a UTSW 9 73075482 missense probably damaging 1.00
R1531:Rab27a UTSW 9 73095403 missense probably benign
R1634:Rab27a UTSW 9 73075569 critical splice donor site probably null
R1950:Rab27a UTSW 9 73075469 missense probably damaging 1.00
R2497:Rab27a UTSW 9 73084981 missense probably damaging 1.00
R4083:Rab27a UTSW 9 73082439 missense probably damaging 0.96
R4094:Rab27a UTSW 9 73075544 missense probably damaging 0.99
R5027:Rab27a UTSW 9 73095413 missense probably benign 0.01
R5881:Rab27a UTSW 9 73085039 splice site probably null
R6750:Rab27a UTSW 9 73085008 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2017-12-19 10:28 AM by Anne Murray
Record Created 2015-11-24 7:01 AM by Carlos Reyna
Record Posted 2015-12-11
Phenotypic Description
Figure 1. The ivan mice (bottom) exhibit hypopigmentation of the fur.

The ivan phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4094, some of which exhibited a dark gray coat color (Figure 1).

Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 61 mutations. Among these, only one affected a gene with known effects on pigmentation, Rab27a. The mutation in Rab27a was presumed to be causative because the ivan hypopigmenation phenotype mimics other known alleles of Rab27a (see MGI for a list of Rab27a alleles and the records for concrete and geodude). The Rab27a mutation is an A to C transition at base pair 73,075,544 (v38) on chromosome 9, or base pair 30,735 in the GenBank genomic region NC_000075. The mutation corresponds to residue 503 in the mRNA sequence NM_001301230 (isoform 1) within exon 3 of 7 total exons, residue 354 in the mRNA sequence NM_023635 (isoform 2) within exon 2 of 6 total exons, and residue 396 in the mRNA sequence NM_001301232 (isoform 3) within exon 2 of 6 total exons.

 
30720 ATCACCACAGTGGGCATTGATTTCAGGGAAAAG

39    -I--T--T--V--G--I--D--F--R--E--K-

 

Genomic numbering corresponds to NC_000075. The mutated nucleotide is indicated in red. The mutation results in an isoleucine (I) to leucine (L) substitution at position 44 (I44L) in all isoforms of the Rab27a protein, and is strongly predicted by PolyPhen-2 to cause loss of function (score = 0.988) (1).

Protein Prediction

Figure 3. Domain structures of Rab27a and Rab27b.  The four consensus GTP-binding sequences (I-IV) and the dicysteine isoprenylation motif are shown at the top. I and II bind phosphate, while III and IV bind guanine. The positions of the RabF motifs and RabSF motifs for the Rab27 family are indicated. The ivan mutation results in the conversion of isoleucine 44 to a leucine. Secondary structural elements are indicated with lines below each protein. The image is interactive; click to view other Rab27a mutations.

Rab27a and Rab27b form the Rab27 subfamily of Rab proteins, which are low molecular weight GTPases that function in membrane trafficking and vesicular fusion and targeting. The presence of five sequence motifs designated Rab family motif (RabF) 1-5 distinguishes Rabs from other small GTPases (2). In addition, four regions designated Rab subfamily motif (RabSF) 1-4 share high amino acid sequence identity among Rabs of the same subfamily. Rab27a contains four consensus sequences that mediate GTP-binding of Rabs (Figure 2) (3;4). The phosphate-interacting domain consists of six residues (DTAGQE) that are strictly conserved in all small GTPases. The C-terminus of Rab27a contains a dicysteine motif (CXC), one of four consensus isoprenylation motifs present in Rabs (3;4), to which Rab geranylgeranyl transferase (GGTase) attaches two geranylgeranyl groups that serve to target Rab27a to target membranes (5).

 

The ivan mutation results in the conversion of isoleucine 44 to a leucine within the RabF1 motif.

 

Please see the record concrete for information about Rab27a.

Putative Mechanism

Rabs are molecular switches, cycling between an inactive GDP-bound and an active GTP-bound state. Rab27a regulates the exocytosis of lysosome related organelles from cytotoxic T lymphocytes, melanocytes, platelets, and endothelial cells, as well as the secretion of non-lysosome organelles from several other cell types including insulin-containing secretory granules of pancreatic β cells (6-8), and secretory granules of PC12 and chromaffin cells (9). Mutation of Rab27a results in the mouse phenotype ashen (ash), in which mice have a light coat color due to defects in pigment granule transport (10). In Rab27aash mice, melanosomes are synthesized normally, but cluster in the perinuclear region, resulting in uneven and impaired release of melanin (11). In humans, mutations in RAB27A cause Griscelli syndrome type II, which is characterized by partial albinism and hemophagocytic syndrome [OMIM #607624; (12)]. Hemophagocytic syndrome (also called hemophagocytic lymphohistiocytosis, HLH) is characterized by polyclonal CD8 T cell and macrophage activation and infiltration of multiple organs, leading to death unless treated by bone marrow transplant (13). In Rab27aash mice, lytic granules of CTLs and natural killer (NK) cells are blocked at a late secretory step, successfully polarizing towards the immunological synapse (a microtubule-dependent step) but failing to fuse and release their contents (14;15). The hypopigmentation phenotype of the ivan mice indicates loss of function of Rab27aivan.

Primers Primers cannot be located by automatic search.
References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsCarlos Reyna, Jamie Russell, and Bruce Beutler
List |< first << previous [record 11 of 18] next >> last >|