Phenotypic Mutation 'Big_bend' (pdf version)
List |< first << previous [record 33 of 511] next >> last >|
AlleleBig_bend
Mutation Type missense
Chromosome15
Coordinate78,565,945 bp (GRCm38)
Base Change T ⇒ G (forward strand)
Gene Rac2
Gene Name RAS-related C3 botulinum substrate 2
Chromosomal Location 78,559,169-78,572,783 bp (-)
MGI Phenotype Homozygotes for a targeted null mutation exhibit peripheral blood lymphocytosis, reductions in peritoneal B-1a lymphocytes, marginal zone lymphocytes, and IgM-secreting plasma cells, decreased levels of serum IgM and IgA, and abnormal T cell migration.
Accession Number

NCBI RefSeq: NM_009008; MGI:97846

Mapped Yes 
Amino Acid Change Aspartic acid changed to Alanine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000036384]
SMART Domains Protein: ENSMUSP00000036384
Gene: ENSMUSG00000033220
AA Change: D65A

DomainStartEndE-ValueType
RHO 6 179 3.36e-135 SMART
Predicted Effect possibly damaging

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
(Using ENSMUST00000043214)
Phenotypic Category decrease in B1 cells, decrease in B1a cells in B1 cells, increase in B1b cells
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(5) : Chemically induced (ENU)(1) Gene trapped(2) Radiation induced(1) Targeted(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02931:Rac2 APN 15 78570747 missense probably benign 0.18
bingo UTSW 15 78564968 missense probably damaging 1.00
lamb UTSW 15 78564934 missense probably benign 0.01
potter UTSW 15 78570743 nonsense probably null
potter2 UTSW 15 78565454 missense probably damaging 0.97
R0557:Rac2 UTSW 15 78564974 missense probably damaging 1.00
R0627:Rac2 UTSW 15 78564968 missense probably damaging 1.00
R0751:Rac2 UTSW 15 78565945 missense possibly damaging 0.95
R1184:Rac2 UTSW 15 78565945 missense possibly damaging 0.95
R2349:Rac2 UTSW 15 78565475 missense possibly damaging 0.51
R3816:Rac2 UTSW 15 78565999 missense possibly damaging 0.75
R4436:Rac2 UTSW 15 78570743 nonsense probably null
R5051:Rac2 UTSW 15 78564934 missense probably benign 0.01
R5207:Rac2 UTSW 15 78565454 missense probably damaging 0.97
Mode of Inheritance Autosomal Semidominant
Local Stock
Repository
Last Updated 06/01/2017 5:25 PM by Katherine Timer
Record Created 11/24/2015 3:29 PM
Record Posted 12/17/2015
Phenotypic Description

Figure 1. Big_bend mice exhibit decreased frequencies of peripheral B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Big_bend mice exhibit decreased frequencies of peripheral B1a cells in B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1a cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Big_bend mice exhibit increased frequencies of peripheral B1b cells. Flow cytometric analysis of peripheral blood was utilized to determine B1b cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Big_bend phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R0751, some of which showed a reduced frequency of B1 cells (Figure 1) and B1a cells in B1 cells (Figure 2) as well as an increased frequency of B1b cells (Figure 3), all in the peripheral blood.  

Nature of Mutation

Figure 4. Linkage mapping of the reduced frequency of peripheral blood B1 cells using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 72 mutations (X-axis) identified in the G1 male of pedigree R0751. Normalized phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 72 mutations. All of the above anomalies were linked by continuous variable mapping to mutations in Rac2, Eif3l, and Chadl on chromosome 15. The mutation in Rac2 was presumed to be causative because the Big_bend phenotypes mimic other known alleles of Rac2 (see MGI for a list of Rac2 alleles). The mutation in Rac2 is an A to C transition at base pair 78,565,945 (v38) on chromosome 15, or base pair 6,839 in the GenBank genomic region NC_000081 encoding the Rac2 gene. The strongest association was found with an additive model of linkage to the normalized frequency of B1 cells, wherein three variant homozygotes departed phenotypically from 20 homozygous reference mice and 14 heterozygous mice with a P value of 1.058 x 10-6 (Figure 4).  A substantial semidominant effect was observed in the B1 and B1b assays, but a recessive effect was observed in the B1a cells in B1 cells assay.

 

The mutation corresponds to residue 332 in the mRNA sequence NM_009008 within exon 3 of 7 total exons.

 

316 GGTCAGGAGGACTATGACCGCCTCCGGCCACTC

61  -G--Q--E--D--Y--D--R--L--R--P--L-

 

The mutated nucleotide is indicated in red.  The mutation results in an aspartic acid (D) to alanine (A) substitution at position 65 (D65A) in the Rac2 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.955) (1).

Protein Prediction

Figure 5. Protein domains of Rac2. Rac proteins have 5 GTP binding and hydrolysis domains (G-boxes; G1-G5), 2 switch regions, and a C-terminal polybasic region. The amino acid altered in Big_bend is indicated. The image is interactive; click to view additional mutations in Rac2.

Rac2 is a member of the Rac subfamily of Rho guanosine triphosphatases (Rho GTPases). Rho GTPases have several conserved domains including five GTP binding and hydrolysis domains (G-boxes; G1-G5), two switch regions (switch I and II), a polybasic domain, and a prenylation site [Figure 5; (2)]. G-boxes function in GDP binding and exhibit GTPase activity (3). In Rac2, these regions correspond to amino acids 10-17 (G1), Thr35 (G2), 57-61 (G3), and 115-118 (G4), and 157-160 (G5). The Rac proteins each have two highly conserved switch regions, switch I (amino acids 27-40) and switch II (amino acids 56-71), situated on either side of the bound nucleotide. Both switch regions are sites of interactions between the Rac proteins and guanine nucleotide exchange factors (GEFs) and guanine nucleotide-dissociation inhibitors (GDIs) as well as with downstream protein targets (4). The polybasic region of Rac2 (RQQKRP; amino acids 183-188) is required for its function as a regulator of NAPDH oxidase.

 

The mutation in Big_bend results in an aspartic acid (D) to alanine (A) substitution at position 65. Amino acid 65 is within an undefined region between the G3 and G4 regions.

 

For more information about Rac2, please see the record for bingo.

Putative Mechanism

Rho GTPases integrate receptor-mediated signals through binding to effectors and regulators of the actin cytoskeleton and affect multiple cellular activities including cell morphology, polarity, migration, proliferation, apoptosis, phagocytosis, cytokinesis, adhesion, vesicular transport, and transcription. Rac2 functions in actin polymerization resulting in lamellopodial extension and membrane ruffling, directed migration, chemotaxis, and superoxide (O2) production in phagocytic cells as well as cytoskeleton organization in red blood cells and osteoclasts (5-10). The Rac proteins regulate leukocyte migration by transducing signals from cell surface receptors (e.g., the Fcγ receptor, formylmethionyl-leucyl-phenylalanine (fMLP) receptor, and β2 integrins) to the actin and microtubule cytoskeletons through cytoplasmic effectors (e.g., tyrosine kinases, scaffolding/adapter proteins, nucleotide exchange proteins, and phosphatases) upon binding of GTP (11).

 

The Big_bend mice exhibited increased frequency of B1 cells and B1b cells as well as a reduced frequency of B1a cells in B1 cells in the peripheral blood. Rac2 is required for B cell development as well as for either B cell receptor (BCR) signal transduction and subsequent calcium mobilization or in determining the efficiency of BCR ligation (12;13). Rac2-deficient (Rac2-/-) mice exhibit a 30% reduction in B cell numbers due mainly be a reduced number of recirculating B lymphocytes in the bone marrow (12). Rac2-/- mice also display a lack of peritoneal B1 and marginal zone B cells (12). In the peripheral blood, Rac2-/- mice had an increase in total leukocyte number including both B and T cells (12). B cell numbers were reduced in the spleen due to a loss of mature and/or marginal zone B cells (12). In humans, mutations in RAC2 are linked to neutrophil (alternatively, phagocytic) immunodeficiency syndrome [NIS; OMIM: #608203; (14-16)] and decreased numbers of peripheral T and B cells. Patients with NIS have severe, recurrent infections, poor wound healing, and exhibit reduced neutrophil migration, azurophilic granule secretion, and superoxide production (14-16).

 

The alterations in the frequencies of B1, B1b, and B1a cells in B1 cells indicate a loss of Rac2Big_bend function; however, some Rac2 function may remain or Rac1 may be compensating for the loss of Rac2 function and/or expression as other Rac2-/--associated phenotypes were not observed in the Big_bend mice.

Primers PCR Primer
Big_bend(F):5'- TGCCTGGCACACACTGAGAAAG -3'
Big_bend(R):5'- GTTGTGGAAACAGCCAGTTGCAC -3'

Sequencing Primer
Big_bend_seq(F):5'- CTCGGGGCATGGTGATACTC -3'
Big_bend_seq(R):5'- GGTCACAGTCCCTCTCTGAG -3'
References
Science Writers Anne Murray
Illustrators Katherine Timer
AuthorsMing Zeng, Xue Zhong, and Bruce Beutler
List |< first << previous [record 33 of 511] next >> last >|