Phenotypic Mutation 'Crabby2' (pdf version)
List |< first << previous [record 86 of 511] next >> last >|
AlleleCrabby2
Mutation Type missense
Chromosome12
Coordinate98,234,266 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Galc
Gene Name galactosylceramidase
Synonym(s) Gacy, A930008M05Rik, 2310068B06Rik, galactocerebrosidase
Chromosomal Location 98,202,304-98,259,459 bp (-)
MGI Phenotype Homozygotes for spontaneous and targeted mutations exhibit tremors, progressive weakness, wasting, both central and peripheral demyelination, massive accumulation of galactosylceramide, abnormal macrophages, and death by 4 months of age.
Accession Number

NCBI RefSeq: NM_008079; MGI:95636

Mapped Yes 
Amino Acid Change Asparagine changed to Serine
Institutional SourceBeutler Lab
Gene Model predicted sequence gene model
PDB Structure
STRUCTURE OF GALACTOCEREBROSIDASE FROM MOUSE [X-RAY DIFFRACTION]
STRUCTURE OF GALACTOCEREBROSIDASE FROM MOUSE IN COMPLEX WITH GALACTOSE [X-RAY DIFFRACTION]
STRUCTURE OF MOUSE GALACTOCEREBROSIDASE WITH 4NBDG: ENZYME-SUBSTRATE COMPLEX [X-RAY DIFFRACTION]
STRUCTURE OF MOUSE GALACTOCEREBROSIDASE WITH D-GALACTAL: ENZYME- INTERMEDIATE COMPLEX [X-RAY DIFFRACTION]
STRUCTURE OF MOUSE GALACTOCEREBROSIDASE WITH GALACTOSE: ENZYME- PRODUCT COMPLEX [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000021390
Gene: ENSMUSG00000021003
AA Change: N295S

DomainStartEndE-ValueType
Pfam:Glyco_hydro_59 17 684 N/A PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000021390)
Phenotypic Category decrease in body weight
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(11) : Chemically induced (ENU)(1) Chemically induced (other)(1) Spontaneous(4) Targeted(5)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Galc APN 12 98231422 missense probably benign 0.01
IGL01287:Galc APN 12 98246244 splice donor site probably benign 0.00
IGL01618:Galc APN 12 98252081 missense probably damaging 1.00
IGL02125:Galc APN 12 98231509 missense probably damaging 1.00
IGL02274:Galc APN 12 98254214 nonsense probably null 0.00
IGL02392:Galc APN 12 98207413 missense probably damaging 1.00
IGL02478:Galc APN 12 98213132 missense probably benign 0.35
IGL02544:Galc APN 12 98231442 missense probably benign 0.40
IGL03268:Galc APN 12 98222593 splice site 0.00
IGL03327:Galc APN 12 98207476 splice site 0.00
R0218:Galc UTSW 12 98222647 missense probably damaging 1.00
R0240:Galc UTSW 12 98252034 missense probably damaging 1.00
R0240:Galc UTSW 12 98252034 missense probably damaging 1.00
R0467:Galc UTSW 12 98242645 missense probably damaging 1.00
R1619:Galc UTSW 12 98234304 missense probably benign 0.00
R1763:Galc UTSW 12 98234266 missense probably damaging 1.00
R1832:Galc UTSW 12 98234240 critical splice donor site probably null
R1844:Galc UTSW 12 98246297 splice acceptor site probably null
R1996:Galc UTSW 12 98252026 missense probably damaging 1.00
R2010:Galc UTSW 12 98254230 missense possibly damaging 0.51
R2097:Galc UTSW 12 98252032 missense probably benign 0.00
R2496:Galc UTSW 12 98227281 missense probably damaging 1.00
R2881:Galc UTSW 12 98213096 missense probably benign 0.00
R3009:Galc UTSW 12 98203969 missense probably damaging 1.00
R4571:Galc UTSW 12 98222617 missense probably benign 0.00
R4764:Galc UTSW 12 98242744 missense possibly damaging 0.78
R4851:Galc UTSW 12 98227274 missense probably benign 0.00
R4854:Galc UTSW 12 98256877 missense probably damaging 1.00
R4900:Galc UTSW 12 98231472 missense probably damaging 1.00
R4983:Galc UTSW 12 98242768 nonsense probably null
R5220:Galc UTSW 12 98231413 unclassified probably null
R5273:Galc UTSW 12 98252071 missense probably damaging 1.00
R5495:Galc UTSW 12 98231414 unclassified probably null
R5689:Galc UTSW 12 98212986 missense probably benign
R5819:Galc UTSW 12 98216261 missense probably benign 0.06
Mode of Inheritance Autosomal Semidominant
Local Stock
Repository
Last Updated 01/11/2017 8:33 AM by Anne Murray
Record Created 12/01/2015 10:28 AM by Emre Turer
Record Posted 01/11/2017
Phenotypic Description

Figure 1. Crabby2 mice exhibited reduced body weight compared to wild-type littermates. Scaled body weight data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Crabby2 phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R1763, some of which showed weight loss compared to wild-type littermates (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced body weights using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 91 mutations (X-axis) identified in the G1 male of pedigree R1763. Scaled body weight data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 91 mutations. The body weight phenotype was linked to a mutation in Galc: an A to G transition at base pair 98,234,266 (v38) on chromosome 12, or base pair 25,198 in the GenBank genomic region NC_000078 encoding Galc. Linkage was found with an additive model of inheritance, wherein one variant homozygote and five heterozygotes departed phenotypically from seven homozygous reference mice with a P value of 3.313 x 10-7 (Figure 2).

 

The mutation corresponds to residue 1,014 in the NM_008079 mRNA sequence in exon 8 of 17 total exons.


 

998 CGCATATTGAACCAGAATTACATCAATGGCAAT

290 -R--I--L--N--Q--N--Y--I--N--G--N-

 

The mutated nucleotide is indicated in red.  The mutation results in an asparagine (N) to serine (S) substitution at position 295 (N295S) in the GALC protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction
Figure 3. Domain organization of mouse GALC. GALC is a 684-amino acid peptide that has a signal peptide (amino acids 1-24) followed by a triosephosphate isomerase (TIM) barrel (amino acids 41-337), a β-sandwich domain, and a lectin domain (amino acids 572-668). The Crabby2 mutation results in an asparagine (N) to serine (S) substitution at position 295 (N295S); residue 295 is within the TIM barrel.
Figure 4. Crystal structure of mouse GALC. Residues 25 to 668 were solved. The locations of the domains shown in Figure 3 are indicated. Figure was generated by UCSF Chimera and is based on Dean et al. (2011). PDB:3ZR6.

Galc encodes GALC (galactosylceramidase; alternatively, galactocerebrosidase), a member of carbohydrate-active enzymes glycoside hydrolase family 59 (GH59) (1). GALC is a 684-amino acid peptide that has a signal peptide (amino acids 1-24) followed by a triosephosphate isomerase (TIM) barrel (amino acids 41-337), a β-sandwich domain, and a lectin domain (amino acids 572-668) (Figure 3) (1). GALC is an approximately 80 kDa precursor protein. In lysosomes, GALC is processed into two fragments: a 50 kDa N-terminal fragment and a 30 kDa C-terminal fragment (2). The processed protein fragments stabilize the 80 kDa protein, which is the enzymatically active form of the protein (2;3).

 

The structure of residues 25 to 668 of mouse GALC has been solved (Figure 4; PDB:3ZR6; (1)). Amino acids 25 to 40 comprise two β-strands of the β-sandwich domain before forming the TIM barrel; amino acids 338 to 452 are the remainder of the β-sandwich domain. The TIM barrel has eight parallel β-strands surrounded by α-helices. Similar to other glycosyl hydrolases, the GALC β-sandwich domain comprises two twisted β-sheets. Unique to GALC is the presence of a very long loop that wraps over the top of the TIM barrel. Cys378 within the loop forms a disulfide bond with Cys271 in the TIM barrel. In mouse GALC, a disulfide bond is predicted to form between Cys287 and Cys394. The lectin domain has a similar fold and calcium-binding site as to other glycosyl hydrolayses, including β-glucanase and galectin. However, the GALC lectin domain does not have the catalytic residues found in the β-glucanase family. Residues from the TIM barrel, β-sandwich domain, and lectin domain contribute to the substrate-binding pocket. Human GALC has four putative N-glycosylation sites: Asn284, Asn363, Asn387, and Asn542. In contrast, mouse GALC has six putative N-glycosylation sites: Asn300, Asn379, Asn403, Asn558, Asn601, and Asn645.

 

The Crabby2 mutation results in an asparagine (N) to serine (S) substitution at position 295 (N295S); residue 295 is within the TIM barrel.

Expression/Localization

Galc is expressed in mouse brain, liver, and kidney (4). Various isoforms of GALC are differentially expressed in the nervous system (5). An 80-kDa doublet was observed in the central and peripheral nervous systems; 50- and 30-kDa proteins were observed in the cortex and spinal cord, but not sciatic nerve. A 170-kDa protein product was found in the spinal cord, but not the cortex or sciatic nerve; the 170-kDa protein is a putative dimer or oligomer of GALC. Overall, GALC was expressed at lower levels in the sciatic nerve and at higher levels in the cortex and spinal cord. Different glycosylation or phosphorylation patterns may contribute to the GALC expression pattern (5). GALC localizes to the lysosome (2).

Background
Figure 5. GALC converts galactosylcerebroside to ceramide, an essential component of the myelin sheath, in sphingolipid metabolism. In the above diagram, the molecules and enzymes involved in lysosomal ceramide production and sphingolipid degradation are indicated in black. GALC hydrolzyses the galactose ester bonds of galactosylceramide, psychosine, monogalactosyldiglyceride, and lactosylceramide. Ceramide synthesis occurs in the ER, while at the level of cis-Golgi apparatus GlcCer is generated that is converted in LacCer in the trans-Golgi. The reactions involving ceramide transformation into all major classes of GSL are catalyzed in the lumen of the Golgi apparatus by membrane-bound transferases. Diseases associated with the ceramide production pathway are indicated in red. Mutations in GALC are linked to Krabbe disease. 

GALC is a lysosomal enzyme that hydrolyzes galactosylceramide, psychosine, monogalactosyldiglyceride, and possibly lactosylceramide (Figure 5). Galactosylceramide, psychosine, and monogalactosyldiglyceride are essential for myelination in the nervous system; galactosylceramide is a major component of myelin. Most axons are insulated with myelin sheaths, which allows for the rapid propagation of nerve impulses. Myelin is a multilamellar membrane formed by oligodendrocytes in the central nervous system and by Schwann cells in the peripheral nervous system. During myelination, a glial process wraps around the axon, forming multiple layers of myelin and elongating along the axon. The myelinating glial cells organize the axons into segments: the nodes of Ranvier, paranode, and juxtaparanode. During myelination, oligodendrocyte precursor cells are differentiated into post-mitotic oligodendrocytes. During oligodendrocyte differentiation, the immature oligodendrocytes synthesize large amounts of myelin lipids including galactosylceramide and plasmalogens.

 

The twitcher mouse model has a spontaneous mutation in Galc that results in nonsense-mediated decay of the Galc transcript (6;7). The twitcher mice are phenotypically normal until approximately postnatal day 20 after which they exhibit progressive neurological phenothypes, including tremors, hindlimb weakness. The twitcher mice also exhibit slowed weight gain and wasting; most mice die by postnatal day 40 (8;9). The twitcher mice exhibit nervous system gliosis, myelin loss in both the peripheral and central nervous systems, and macrophage accumulation, similar to that observed in human Krabbe disease patients (see below) (8;9). The UDP-galactose:ceramide galactosyltransferase activity was normal in the spinal cord of the twitcher mice at postnatal day 15 (10). After postnatal day 15, there was a progressive loss in the galactosyltransferase activity (10). Galactosyltransferase activity remained normal in the kidney at all times examined. The twitcher mice have reduced frequencies of early hematopoietic progenitors and defects in the hematopoietic niche (11).

 

A second spontatneous Galc mutation (Galctwi-5J) resulting in a glutamic acid to lysine conversion at amino acid 130 causes weakness, stunted weight gain, and generalized tremors after two weeks of age; the Galctwi-5J mice die by approximately four weeks of age (5). The Galctwi-5J mice have gliosis, globoid cells, and psychosine accumulation in the nervous system, but the central nervous system does not exhibit significant demyelination. The peripheral nervous system is hypomyelinated and does not have large diameter axons, indicating primary dysmyelination instead of demyelination.

 

Galc-deficient (Galc-/-) mice feed normally and exhibit similar rates of growth to wild-type mice 30 days after birth (4). At approximately postnatal day 25 to 30, the Galc-/- mice exhibit tremors and hind leg weakness. The Galc-/- mice are slightly larger than the twitcher mice. The Galc-/- mice gain weight until postnatal day 35 to 40, and then they show progressive weight loss. On average, the Galc-/- mice exhibit lethality at approximately postnatal day 50 to 55. Near the time of death, the Galc-/- mice typically exhibit hind limb paralysis and severe hind limb wasting.

 

In humans, mutations in GALC lead to global-cell leukodystrophy (GLD; alternatively, Krabbe disease; OMIM: #245200) (12). In most cases, Krabbe disease manifests within the first six months of life, but other Krabbe patients present symptoms later, even into adulthood (13). Krabbe patients exhibit mental retardation and developmental delay due to widespread demyelination; infant Krebbe patients often die by two years of age (14-16). Krabbe disease is the results of low GALC enzyme activity and a reduced ability to degrade galactolipids in myelin (13). Patients with Krabbe disease have decreased myelin due to the presence of psychosine, which is cytotoxic to oligodendroyctes, and the accumulation of galactosylceramide (13).

Putative Mechanism

Similar to other Galc mouse models, the Crabby2 mice exhibit weight loss. Overt neurological phenotypes were not observed.

Primers PCR Primer
Crabby2(F):5'- TACTGCCTGAGTACACTGTACCCC -3'
Crabby2(R):5'- TTCACCAGTGACTACACATGCATCC -3'

Sequencing Primer
Crabby2_seq(F):5'- CTGAGTACACTGTACCCCAATAG -3'
Crabby2_seq(R):5'- cttcttcttcttctccttcttcttc -3'
References
Science Writers Anne Murray
Illustrators Katherine Timer
AuthorsEmre Turer and Bruce Beutler
List |< first << previous [record 86 of 511] next >> last >|