Phenotypic Mutation 'cubone' (pdf version)
List |< first << previous [record 96 of 511] next >> last >|
Allelecubone
Mutation Type critical splice donor site
Chromosome15
Coordinate78,446,657 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Tmprss6
Gene Name transmembrane serine protease 6
Synonym(s) matriptase-2, 1300008A22Rik
Chromosomal Location 78,439,668-78,468,634 bp (-)
MGI Phenotype Homozygosity for an inactivating mutation of this gene results in hair loss over the entire body except the face, microcytic anemia and female infertility, all reversible by dietary iron supplementation.
Accession Number

NCBI RefSeq: NM_027902; MGI:1919003

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000017086]
SMART Domains Protein: ENSMUSP00000017086
Gene: ENSMUSG00000016942

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
Pfam:SEA 88 191 3.2e-13 PFAM
CUB 341 452 3.82e-2 SMART
LDLa 457 489 1.33e-2 SMART
LDLa 490 527 2.31e-9 SMART
LDLa 530 568 1.07e-4 SMART
Tryp_SPc 576 806 3.75e-97 SMART
Predicted Effect probably null
Phenotypic Category growth/size, skin/coat/nails
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(12) : Chemically induced (ENU)(3) Gene trapped(2) Radiation induced(1) Targeted(6)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Tmprss6 APN 15 78442434 missense probably damaging 1.00
IGL02474:Tmprss6 APN 15 78442336 missense probably damaging 0.98
ekans UTSW 15 78459427 critical splice donor site probably null
mask UTSW 15 78464455 critical splice acceptor site
masquerade UTSW 15 78468000 nonsense
zorro UTSW 15 78464552 nonsense
R0285:Tmprss6 UTSW 15 78452868 missense possibly damaging 0.81
R1857:Tmprss6 UTSW 15 78452552 missense probably damaging 1.00
R2432:Tmprss6 UTSW 15 78465104 splice site probably benign
R4192:Tmprss6 UTSW 15 78446657 unclassified probably null
R4226:Tmprss6 UTSW 15 78446699 missense probably damaging 0.97
R4227:Tmprss6 UTSW 15 78446699 missense probably damaging 0.97
R4334:Tmprss6 UTSW 15 78459427 unclassified probably null
R4344:Tmprss6 UTSW 15 78459427 unclassified probably null
R4446:Tmprss6 UTSW 15 78452839 missense probably damaging 0.99
R4508:Tmprss6 UTSW 15 78459778 missense probably damaging 1.00
R4643:Tmprss6 UTSW 15 78445356 missense probably damaging 0.97
R4743:Tmprss6 UTSW 15 78443710 missense probably damaging 0.99
R4836:Tmprss6 UTSW 15 78445388 missense probably benign 0.22
R4859:Tmprss6 UTSW 15 78446677 missense probably benign 0.08
R4869:Tmprss6 UTSW 15 78443680 missense probably damaging 1.00
R5197:Tmprss6 UTSW 15 78454189 missense probably damaging 1.00
R5212:Tmprss6 UTSW 15 78446260 missense possibly damaging 0.95
R5225:Tmprss6 UTSW 15 78452507 missense probably benign 0.44
R5569:Tmprss6 UTSW 15 78440303 missense probably damaging 1.00
R5572:Tmprss6 UTSW 15 78442422 missense probably damaging 1.00
R5669:Tmprss6 UTSW 15 78454956 missense possibly damaging 0.78
R5947:Tmprss6 UTSW 15 78452522 missense probably benign 0.01
X0025:Tmprss6 UTSW 15 78455095 missense probably benign 0.17
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 08/17/2016 11:26 AM by Anne Murray
Record Created 12/03/2015 6:55 AM by Carlos Reyna
Record Posted 12/23/2015
Phenotypic Description
Figure 1. The cubone mice (top) exhibit hair loss and is smaller than their wild-type littermates (bottom).
Figure 2. The cubone mouse exhibits hair loss on the body, but retains hair on the head.

The cubone phenotype was identified among G3 mice of the pedigree R4192, some of which showed hair loss from the trunk; facial hair is preserved in the cubone mice (Figure 1 & 2). In addition, the cubone mice are slightly smaller than their littermates (Figure 1).

Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 40 mutations. Among these, only one affected a gene with known effects on hair loss, Tmprss6. The mutation in Tmprss6 was presumed to be causative because the cubone hair loss phenotype mimics other known alleles of Tmprss6 (see MGI for a list of Tmprss6 alleles as well as the mask (1), zorro, and masquerade strains from our lab). The Tmprss6 mutation is a T to A transversion at base pair 78,446,657 (v38) on chromosome 15, or base pair in the GenBank genomic region NC_000081 for the Tmprss6 gene. The mutation is within intron 11, 6-base pairs from the previous exon (exon 11 out of 18 total exons).

 
The effect of the mutation at the cDNA and protein level have not examined, but the mutation is predicted to result in the loss of the splice donor site in intron 11 with a concomitant use of a cryptic splice site in intron 11, leading to a 16-base pair insertion. The insertion would result in an in-frame protein product after amino acid 456 of the TMPRSS6 protein, followed by termination after the inclusion of 811 aberrant amino acids.
 
 
            <--exon 10         <--exon 11 intron 11-->                exon 12-->        <--exon 18
16160 ……ATCCAGAACAGGAG ……TACAACCAATCAGACC gtgagtacaatttgaggtgtgtgtg…… CCTGCCCTGGT…… ……GTGCTGACCTGA…… 28424
404   ……-I--Q--N--R--R ……-Y--N--Q--S--D--                             P--C--P--G-…… ……-V--L--T--*-     811

                    correct                                                     correct

 
 
Genomic numbering corresponds to NC_000084. The donor splice site of intron 11, which is destroyed by the cubone mutation, is indicated in blue lettering, the mutated nucleotide is indicated in red, and the putative cryptic splice site is indicated in green.
Protein Prediction

Figure 3. Domain structure of TMPRSS6. The C-terminus of the protein, including the serine protease domain, is extracellular. Predicted N-glycosylation sites are noted in violet circles. The cubone mutation is within intron 11. This image is interactive. Click on the image to view other mutations found in TMPRSS6 (red). Click on the mutations for more specific information. 

Tmprss6 encodes an 811-amino acid protein of the type II transmembrane protease family (2). TMPRSS6, also known as matriptase-2, is predicted to contain a C-terminal trypsin-like serine protease domain (shown to be extracellular), three class A LDL receptor domains, two CUB domains (similar to a domain represented in BMP1 as well as C1R and C1S proteins), and a membrane-proximal SEA domain (Figure 3) (1;3)

 

Please see the record for mask for information about Tmprss6.

Putative Mechanism

The peptide hormone hepcidin, encoded by the Hamp gene, was identified as the major systemic iron regulator (4;5). TMPRSS6 is a non-redundant component in a pathway that senses iron deficiency and negatively regulates Hamp expression to promote iron uptake (1). TMPRSS6 proteolytic activity is critical for its Hamp-suppressing activity. Further study will be required to fully understand the mechanisms by which TMPRSS6 mediates Hamp inhibition and promotes iron uptake. The mechanism of hair loss in Tmprss6-mutant mice, including cubone, remains to be established, although severe iron deficiency is associated with hair loss in humans (6) as in mice (7).

Primers PCR Primer
cubone(F):5'- GGTCCATGCAGAGCTACATC -3'
cubone(R):5'- ATGTGTCTAAGCCATCCCTGG -3'

Sequencing Primer
cubone_seq(F):5'- CAAAGGGATACATGTGACTGCCTAC -3'
cubone_seq(R):5'- CTGGTCACTCCTAGGCTGTG -3'
References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsCarlos Reyna, Jamie Russell, and Bruce Beutler
List |< first << previous [record 96 of 511] next >> last >|