Phenotypic Mutation 'Pillar' (pdf version)
AllelePillar
Mutation Type nonsense
Chromosome1
Coordinate195,155,888 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Cr2
Gene Name complement receptor 2
Synonym(s) C3DR, CD21, Cr-1, Cr1, CD35, Cr-2
Chromosomal Location 195,136,811-195,176,716 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_007758; MGI:88489

Mapped Yes 
Limits of the Critical Region 195136811 - 195176715 bp
Amino Acid Change Cysteine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000080938] [ENSMUSP00000141706] [ENSMUSP00000141276] [ENSMUSP00000141538] [ENSMUSP00000147804]
SMART Domains Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616
AA Change: C713*

DomainStartEndE-ValueType
CCP 23 82 1.01e-11 SMART
CCP 91 147 9.1e-14 SMART
CCP 155 211 1.9e-16 SMART
CCP 216 272 1.6e-9 SMART
CCP 277 343 1.01e-11 SMART
CCP 352 407 1.2e-13 SMART
CCP 411 467 2.34e-16 SMART
CCP 472 523 1.24e0 SMART
CCP 528 594 4.48e-13 SMART
CCP 603 658 1.95e-13 SMART
CCP 718 778 1.75e-15 SMART
CCP 787 842 2.06e-12 SMART
CCP 850 906 7.92e-14 SMART
CCP 911 967 1.29e-13 SMART
transmembrane domain 975 997 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000141706
Gene: ENSMUSG00000026616
AA Change: C416*

DomainStartEndE-ValueType
CCP 1 46 1.2e-1 SMART
CCP 55 110 5.9e-16 SMART
CCP 114 170 1.1e-18 SMART
CCP 175 226 6.1e-3 SMART
CCP 231 297 2.2e-15 SMART
CCP 306 361 9.4e-16 SMART
CCP 421 481 8.3e-18 SMART
CCP 490 545 1e-14 SMART
CCP 553 609 4e-16 SMART
CCP 614 670 6.2e-16 SMART
transmembrane domain 678 700 N/A INTRINSIC
Predicted Effect probably null
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616
AA Change: C713*

DomainStartEndE-ValueType
CCP 23 82 4.9e-14 SMART
CCP 91 147 4.5e-16 SMART
CCP 155 211 9.1e-19 SMART
CCP 216 272 8e-12 SMART
CCP 277 343 5e-14 SMART
CCP 352 407 5.9e-16 SMART
CCP 411 467 1.1e-18 SMART
CCP 472 523 6.1e-3 SMART
CCP 528 594 2.2e-15 SMART
CCP 603 658 9.4e-16 SMART
CCP 718 778 8.3e-18 SMART
CCP 787 842 1e-14 SMART
CCP 850 906 4e-16 SMART
CCP 911 967 6.2e-16 SMART
Predicted Effect probably null
Predicted Effect probably null
Meta Mutation Damage Score 0.594 question?
Is this an essential gene? Probably nonessential (E-score: 0.146) question?
Phenotypic Category
Phenotypequestion? Literature verified References
T-dependent humoral response defect- decreased antibody response to rSFV 10779753
Candidate Explorer Status CE: not good candidate; human score: -1.5; ML prob: 0.082
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(10) : Targeted(7) Transgenic(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Cr2 APN 1 195154251 missense possibly damaging 0.76
IGL01326:Cr2 APN 1 195141221 missense probably null 1.00
IGL01358:Cr2 APN 1 195159820 missense probably damaging 1.00
IGL01410:Cr2 APN 1 195163234 missense possibly damaging 0.49
IGL01468:Cr2 APN 1 195168535 missense probably damaging 1.00
IGL01608:Cr2 APN 1 195155220 missense possibly damaging 0.50
IGL01810:Cr2 APN 1 195159595 missense possibly damaging 0.49
IGL01843:Cr2 APN 1 195150914 splice site probably benign
IGL02332:Cr2 APN 1 195160322 missense probably benign 0.19
IGL02934:Cr2 APN 1 195154325 splice site probably benign
IGL02938:Cr2 APN 1 195166388 missense probably damaging 1.00
IGL03149:Cr2 APN 1 195166366 missense probably damaging 1.00
IGL03327:Cr2 APN 1 195169759 missense probably damaging 1.00
IGL03346:Cr2 APN 1 195169759 missense probably damaging 1.00
PIT4354001:Cr2 UTSW 1 195166309 missense probably damaging 1.00
PIT4418001:Cr2 UTSW 1 195157452 missense probably benign 0.08
R0128:Cr2 UTSW 1 195166231 missense probably damaging 0.99
R0130:Cr2 UTSW 1 195166231 missense probably damaging 0.99
R0380:Cr2 UTSW 1 195157407 missense probably damaging 1.00
R0538:Cr2 UTSW 1 195160359 splice site probably benign
R0605:Cr2 UTSW 1 195163596 splice site probably benign
R0626:Cr2 UTSW 1 195171111 missense possibly damaging 0.95
R1135:Cr2 UTSW 1 195157190 missense probably damaging 1.00
R1396:Cr2 UTSW 1 195169253 splice site probably null
R1422:Cr2 UTSW 1 195171125 missense probably benign 0.01
R1467:Cr2 UTSW 1 195157509 missense probably damaging 1.00
R1467:Cr2 UTSW 1 195157509 missense probably damaging 1.00
R1511:Cr2 UTSW 1 195155272 missense possibly damaging 0.92
R1572:Cr2 UTSW 1 195163314 missense probably damaging 1.00
R1714:Cr2 UTSW 1 195151686 missense possibly damaging 0.46
R1748:Cr2 UTSW 1 195155905 nonsense probably null
R1761:Cr2 UTSW 1 195155123 critical splice donor site probably null
R1824:Cr2 UTSW 1 195157316 missense probably damaging 1.00
R1893:Cr2 UTSW 1 195155187 missense probably benign 0.03
R1990:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R1991:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R1992:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R2191:Cr2 UTSW 1 195163381 missense possibly damaging 0.94
R2276:Cr2 UTSW 1 195157368 missense possibly damaging 0.94
R2277:Cr2 UTSW 1 195157368 missense possibly damaging 0.94
R3548:Cr2 UTSW 1 195155888 nonsense probably null
R3743:Cr2 UTSW 1 195149966 splice site probably benign
R3941:Cr2 UTSW 1 195165814 missense probably damaging 0.97
R3963:Cr2 UTSW 1 195159739 missense probably damaging 1.00
R4211:Cr2 UTSW 1 195156328 missense probably damaging 0.96
R4484:Cr2 UTSW 1 195154174 missense probably damaging 1.00
R4546:Cr2 UTSW 1 195171041 missense possibly damaging 0.94
R4791:Cr2 UTSW 1 195155935 missense probably damaging 1.00
R4801:Cr2 UTSW 1 195163311 missense probably damaging 1.00
R4802:Cr2 UTSW 1 195163311 missense probably damaging 1.00
R4874:Cr2 UTSW 1 195176570 missense possibly damaging 0.82
R4885:Cr2 UTSW 1 195158731 missense possibly damaging 0.92
R4889:Cr2 UTSW 1 195176585 missense possibly damaging 0.70
R5154:Cr2 UTSW 1 195159446 missense probably damaging 1.00
R5574:Cr2 UTSW 1 195141236 missense probably damaging 1.00
R5594:Cr2 UTSW 1 195157190 missense probably damaging 1.00
R5645:Cr2 UTSW 1 195154273 missense probably damaging 1.00
R5700:Cr2 UTSW 1 195159757 missense probably damaging 0.96
R5929:Cr2 UTSW 1 195171111 missense possibly damaging 0.91
R6237:Cr2 UTSW 1 195157502 missense probably damaging 1.00
R6299:Cr2 UTSW 1 195168646 missense probably damaging 1.00
R6368:Cr2 UTSW 1 195168472 missense probably damaging 1.00
R6406:Cr2 UTSW 1 195169771 missense probably damaging 1.00
R6618:Cr2 UTSW 1 195157379 missense probably damaging 0.98
R6684:Cr2 UTSW 1 195171021 nonsense probably null
R6720:Cr2 UTSW 1 195155200 missense probably damaging 0.97
R6866:Cr2 UTSW 1 195151691 missense probably damaging 1.00
R6915:Cr2 UTSW 1 195171146 missense probably benign 0.06
R7057:Cr2 UTSW 1 195151610 missense possibly damaging 0.83
R7117:Cr2 UTSW 1 195160601 missense possibly damaging 0.79
R7200:Cr2 UTSW 1 195163249 missense probably damaging 1.00
R7209:Cr2 UTSW 1 195168724 missense probably damaging 1.00
R7350:Cr2 UTSW 1 195155286 missense probably benign 0.21
R7414:Cr2 UTSW 1 195150036 missense probably benign
R7479:Cr2 UTSW 1 195158410 critical splice donor site probably null
R7480:Cr2 UTSW 1 195154176 missense probably damaging 1.00
X0028:Cr2 UTSW 1 195149982 missense probably benign 0.09
X0066:Cr2 UTSW 1 195166321 missense probably damaging 0.99
Mode of Inheritance Autosomal Semidominant
Local Stock
Repository
Last Updated 2019-09-04 9:44 PM by Anne Murray
Record Created 2015-12-04 11:00 PM by Jin Huk Choi
Record Posted 2018-10-16
Phenotypic Description

Figure 1. Pillar mice exhibit diminished T-dependent IgG responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Pillar phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4427, some of which showed a diminished T-dependent antibody response to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal) (Figure 1).

Nature of Mutation
Figure 2. Linkage mapping of the reduced T-dependent IgG responses to rSFV-β-gal phenotype using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 36 mutations (X-axis) identified in the G1 male of pedigree R4427. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 36 mutations. The diminished T-dependent antibody response to rrSFV-β-gal phenotype was linked by continuous variable mapping to a mutation in Cr2: a T to A transversion at base pair 195,155,888 (v38) on chromosome 1, or base pair 21,303 in the GenBank genomic region NC_000067 encoding Cr2. Linkage was found with an additive model of inheritance, wherein five variant homozygotes and 25 heterozygous mice departed phenotypically from 15 homozygous reference mice with a P value of 0.000167 (Figure 2).  

 

The mutation corresponds to residue 2,244 in the mRNA sequence NM_007758 within exon 12 of 19 total exons.

 

2227 AAAAAGATTGAAGTTTGTACAGTTATTCTCTGT

708  -K--K--I--E--V--C--T--V--I--L--C-

 

The mutated nucleotide is indicated in red. The mutation results in substitution of cysteine 713 to a premature stop codon (C713*) in the CR2 protein.

Protein Prediction
Figure 3. Domain organization of CR2. The location of the pillar mutation is indicated. Domain information is from UniProt. Abbreviations: SCR, short consensus repeats; TM, transmembrane domain.
Figure 4. Crystal structure of human CR2 in complex with its C3d ligand. Residues 1-134 are shown and colored as in Figure 3. UCSF Chimera model is based on PDB 1GHQ, Szakonyi, et al. Science. 292, 1725-1728 (2001). Click on the 3D structure to view it rotate.

Cr2 encodes the type I transmembrane protein complement receptor 2 (CR2; alternatively, CD21). Alternative splicing of mouse Cr2 also produces the CR1 (alternatively, CD35) protein (1). Human CR2 only produces the CR2 protein; humans express a CR1 that is similar to Cr2-derived CR1, but it is derived from the CRRY gene (2).

 

CR2 has a 954-amino acid extracellular domain, a 24-amino acid transmembrane domain, and a 34-amino acid cytoplasmic domain (Figure 3) (3). CR1 and CR2 have multiple (21 in CR1 and 15 in CR2) short consensus repeats (SCRs; alternatively, Sushi or CCP domains) in the extracellular region. SCRs are 60 to 70 amino acids in length, and each SCR contains invariant residues involved in a triple-loop conformation. SCRs are typically present in complement factors and adhesion proteins whereby they facilitate ligand binding. The first two SCR domains are primarily involved in interactions with most CR2 ligands (4-6). The SCR1-SCR2 domains assume a compact V-shaped confirmation [Figure 4; PDB:1LY2; (5) and PDB:1GHQ; (6)]. The CR2 ligand CD23 interacts with CR2 at SCR1 and SCR2 as well as with SCR5 through SCR8 (7). The CR1 unique N-terminus has binding sites for C3b and C4b.

 

The extracellular domain has 11 N-glycosylation consensus sequences (Asn-X-Ser/Thr) (8). The cytoplasmic domain of CR2 has a TSQK sequence, which is a putative protein kinase C substrate target. An EAREVY sequence (i.e., a tyrosine kinase target sequence) is also within the cytoplasmic domain.

 

CR2 can be cleaved to release a soluble CR2 (sCR2) (9). sCR2 corresponds to the extracellular portion of full-length CR2. In addition to cleavage of full-length CR2, sCR2 can be produced by alternative splicing of exon 11 of CR2 (10). sCR2 is able to bind the same ligands as the membrane form (9). The function of sCR2 is unknown, but it putatively interferes with ligand-receptor interactions. In addition, increased amounts of sCR2 is found in the sera of patients with B cell chronic lymphocytic leukemia (11). A sCR2 containing 16 SCRs (designated long CR2) was detected in human blood, and is proposed to be derived from follicular dendritic cells (12;13). Another study found that the sCR2 in human plasma is predominantly the short form (14).

 

The Pillar mutation results in substitution of cysteine 713 to a premature stop codon (C713*); residue 713 is within the twelfth SCR domain.

Expression/Localization

Mouse and human CR2 are expressed on B cells and follicular dendritic cells (15). Human CR2 is also expressed on red blood cells, myeloid cells, and lymphocytes (13;16;17). Expression of CR2 on mouse B cells first appears at the T1-T2 transitional stage on B220low/IgMhigh B cells. CR2 expression is terminated when the cells differentiate into plasma cells. CR2 is constitutively expressed on memory B cells and follicular dendritic cells within germinal centers. In the spleen, CR2 is highly expressed on marginal zone B cells and follicular B cells; CR2 is expressed at low levels on B1 cells (18). CR2 is primarily expressed on IgM+/IgD cells in humans during bone marrow development (19). CR2 is expressed almost on all mature peripheral human B lymphocytes.

Background
Figure 5. CD21/CR2 role in complement activation. CR2 binds to C3d on antigens binding to IgM on B cells, leading to an enhanced response. CR2 on follicular dendritic cells can also capture C3d-opsonized antigen and present the antigen to previously primed B cells in the germinal center (not shown).
Figure 6. BCR signaling. The tails of Igα and Igβ become phosphorylated by Src family kinases (typically Lyn), causing them to take an open conformation and serve as docking sites for the adapter protein BLNK and the SH2 domains of SYK. SYK phosphorylates a number of downstream targets including BLNK, PLC-γ2 and protein kinase C β (PKCβ). BCR stimulation also activates phosphatidylinositol 3 kinase (PI3K) resulting in the generation of 3′-phosphorylated phosphoinositides. One of these lipids, phosphatidylinositol-3,4,5-triphosphate (PIP3), binds selectively to the pleckstrin homology (PH) domain of Btk, facilitating membrane recruitment of the kinase. Phosphorylated BLNK also provides docking sites for Btk, as well as PLC-γ2, which results in the additional phosphorylation and activation of PLC-γ2 by Btk leading to the hydrolysis of phosphatidylinositol-4,5-diphosphate (PIP2) to inositol-1,4,5-trisphosphate (IP3) and diacylglycerol (DAG). Soluble IP3 and membrane-bound DAG initiate downstream signal transduction pathways involving calcium (Ca2+) mobilization and PKC, respectively. The recruitment of Vav, Nck and Ras by BLNK to the BCR activates MAP kinase cascades such as JNK, p38 and extracellular signal regulated kinase (ERK). Together, these signals allow the activation of multiple transcription factors, including nuclear factor of activated T cells (NF-AT), nuclear factor (NF)-κB and AP-1, which subsequently regulate biological responses including cell proliferation, differentiation and apoptosis, as well as the secretion of antigen-specific antibodies. Other molecules that play important roles in BCR signaling include Bcl10, mucosa-associated lymphoid tissue translocation gene 1 (MALT1), and caspase recruitment domain family, member 11 (CARMA1 or CARD11), which are involved in NF-κB activation along with PKCβ. This image is interactive. Click on the image to view mutations found within the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information.

The complement pathway marks non-self proteins and microbes for phagocytic uptake and destruction. The pathway is comprised of several serum and membrane-bound proteins that regulate the pathway so that it recognizes foreign antigens, but recognizes normal self tissue and cells [reviewed in (20)]. The complement pathway is initiated by the activation of the C3 protein, which generates C3a and C3b. C3b putatively forms a covalent thiol-ester bond to the substrate as well as joins with the C3 convertases to function as a C5 convertase to release C5a and C5b. C3b can be degraded into small, inactive forms (i.e., iC3b and C3dg) by the serine protease factor I. The C3b cleavage products maintain their bonds to the substrate and are recognized by a series of receptors. CR2 functions as a receptor for the gp350/220 viral coat protein of the Epstein-Barr virus, C3dg, iC3b, C3d, the low-affinity IgE receptor CD23, and the type I cytokine, IFN-alpha (Figure 5) (7;21-24). CR1 binds both C4b and C3b, and functions as a cofactor to inactivate C3b and C4b to iC3b and iC4b, respectively. The CR2-associated complement pathway enhances humoral immunity to T-dependent and T-independent foreign antigens (25;26).

 

As CR2 binds the inactive forms of C3, it has minimal complement regulatory functions, but functions primarily as a member of the B cell co-receptor complex with CD19 (see the record for hive) and CD81 (Figure 6) (27). CR2 (in complex with CD19 and CD81) stabilizes the B-cell receptor (BCR) in lipid rafts (28). In BCR signaling, following the aggregation of BCR molecules, the ITAMs in the tails of Igα (see the record for crab) and Igβ (see the record for hallasan) become phosphorylated by Src family kinases (typically Lyn) (29;30). These phosphotyrosines then act as docking sites for the SH2 domains of Syk, resulting in Syk phosphorylation and activation. Syk phosphorylates a number of downstream targets including BLNK (see the record for busy), PLCγ2 (see the record for queen), and protein kinase C β (PKCβ; see the record for Untied). BCR stimulation also activates phosphatidylinositol 3 kinase (PI3K) resulting in the generation of PIP3, which binds selectively to the pleckstrin homology domain of Btk, facilitating membrane recruitment of the kinase. Lyn phosphorylates the cytoplasmic tail of CD19 upon CD19 activation. Phosphorylated CD19 recruits another Lyn molecule, leading to Lyn phosphorylation. CD19 subsequently recruits VAV, which is phosphorylated by Lyn. Phosphorylated BLNK also provides docking sites for Btk, as well as PLCγ2, which results in the additional phosphorylation and activation of PLCγ2 by Btk leading to the hydrolysis of phosphatidylinositol-3,4-diphosphate (PIP2) to inositol-1,4,5-trisphosphate (IP3) and diacylglycerol (DAG) (31). The recruitment of Vav1, Nck and Ras by BLNK to the BCR activates MAP kinase cascades such as JNK, p38 and extracellular signal regulated kinase (ERK) [reviewed in (32)]. Together, these signals allow the activation of multiple transcription factors, including nuclear factor of activated T cells (NF-AT), NF-κB (see the records for puffxander and panr2) and AP-1, which subsequently regulate biological responses including cell proliferation, differentiation, and apoptosis as well as the secretion of antigen-specific antibodies [reviewed in (33)]. Other molecules that play important roles in BCR signaling include Bcl10, mucosa-associated lymphoid tissue translocation gene 1 (Malt1), and caspase recruitment domain family, member 11 (CARMA1, alternatively Card11; see the record for king), which are involved in NF-κB activation along with PKCβ (34).

 

Mutations in human CR2 are linked to common variable immunodeficiency-7 (CVID7; OMIM: #614699; (35)) and are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9; OMIM: #610927; (36;37)). Patients with CVID7 exhibit persistent myalgias, fever, sore throat, respiratory tract infections, chronic diarrhea associated with Haemophilus influenza infection, splenomegaly, and hypogammaglobulinemia affecting mainly IgG; IgA values were slightly reduced and IgM levels were low-normal (35)

 

Cr2-deficient (Cr2tm1.1Jhws/tm1.1Jhws; MGI:5547494) mice exhibit reduced B1a cell numbers, increased susceptibility to S. pneumoniae, failure to produce activated germinal center B cells after sheep red blood cell immunization, and reduced IgG2b, IgG2c, and IgG3 levels compared to wild-type littermates (38). A second Cr2-deficeint mouse (Cr2tm1Crr/tm1Crr; MGI:2448261) exhibited reduced numbers of follicular B cells, B1a cells, and neutrophils with concomitant increased numbers of marginal zone B cells compared to wild-type littermates (25;39;40). The Cr2tm1Crr/tm1Crr mice exhibited diminished T-dependent antibody responses as well as decreased IgG and IgM levels (25;41). The amount of TNF secretion was reduced in the peritoneal lavage after cecal ligation and puncture (40). Female Cr2tm1Crr/tm1Crr mice had increased anti-dsDNA antibodies compared to controls at five to six months of age (42). A third Cr2-deficient model (Cr2tm1Hmo/tm1Hmo; MGI:1932568) exhibited increased susceptibility to pneumococcal infection than controls (43). After immunization with a T-dependent antigen, serum levels of IgG and IgM were reduced in the Cr2tm1Hmo/tm1Hmo mice compared to wild-type controls (26). Cr2tm1Hmo/tm1Hmo mice showed abnormal B cell activation, memory B cell differentiation and class switch recombination in response to low-dose antigen (44). A fourth Cr2-deficient mouse (Cr2tm1Tft/tm1Tft; MGI:3531094) exhibited reduced frequencies of spleen germinal centers, reduced T-independent and T-dependent antibody responses, increased susceptibility to S. pneumoniae, and reduced IgM and IgG levels (45).

Putative Mechanism

The Pillar mice showed a diminished T-dependent antibody responses similar to that in Cr2tm1Crr/tm1Crr  and Cr2tm1Tft/tm1Tft mice indicating loss of CR2-associated function (25;41;45).

Primers PCR Primer
Pillar_pcr_F: TGGAAACTAGAGCATGCTTTCG
Pillar_pcr_R: CCAAGGGGCTCATTTAGAAATATCTC

Sequencing Primer
Pillar_seq_F: CTAGAGCATGCTTTCGGTTAAATAAC
Pillar_seq_R: TAGGTACCAGTTGACTGG
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 446 nucleotides is amplified (chromosome 1, - strand):


1   ccaaggggct catttagaaa tatctctata aatgtacttt ttatgatgaa gaagtaaaat
61  attgagaaga aatgtaatat aacatctttt tctaggtacc agttgactgg atatacttat
121 gagaagtgtc aaaatgctga gaatgggact tggtttaaaa agattgaagt ttgtacaggt
181 aaattatgga catgggagaa gccaacccta gattagagag ttagaaaagg aaaatcaatt
241 aatggagagc aagcttacaa ctactttaat agtttatact ttttcttgct atgtataaga
301 catgttaaat cttttagttt tgatcaaaac tatttatttc tttatacttt attttatttt
361 ctgagttttt tggaatgaac atgtagtact tacataagta taacatttga taaagttatt
421 taaccgaaag catgctctag tttcca


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsJin Huk Choi, James Butler, Bruce Beutler