Phenotypic Mutation 'Ernie2'

• Allele: Ernie2
• Mutation Type: splice site
• Chromosome: 7
• Coordinate: 121,780,085 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Ern2
• Gene Name: endoplasmic reticulum to nucleus signalling 2
• Synonym(s): Ire1b
• Chromosomal Location: 121,769,116-121,785,430 bp (-) (GRCm39)
• MGI Phenotype: PHENOTYPE: Mice homozygous for disruption of this gene are generally normal but display an increased susceptibility to intestinal inflammation. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000033153] [ENSMUSP00000145716]
• AlphaFold: Q9Z2E3
• SMART Domains: Protein: ENSMUSP00000033153; Gene: ENSMUSG00000030866

Domain	Start	End	E-Value	Type
low complexity region	14	28	N/A	INTRINSIC
PQQ	33	64	5.5e-8	SMART
PQQ	115	147	4.7e-4	SMART
PQQ	148	180	6.1e-2	SMART
PQQ	192	223	6.2e-3	SMART
low complexity region	449	461	N/A	INTRINSIC
S_TKc	508	768	2.5e-11	SMART
PUG	831	888	9e-24	SMART

• Predicted Effect: probably benign
• Predicted Effect: probably benign
• Meta Mutation Damage Score: 0.0898
• Is this an essential gene?: Probably nonessential (E-score: 0.125)
• Phenotypic Category: Autosomal Semidominant
• Mode of Inheritance: Autosomal Semidominant
• Last Updated: 2019-09-04 9:44 PM by Anne Murray
• Record Created: 2015-12-07 3:26 PM by Emre Turer
• Record Posted: 2016-05-02
• Science Writers: Anne Murray
• Illustrators: Peter Jurek
• Authors: Emre Turer and Bruce Beutler

Accession Number

NCBI RefSeq: NM_012016, NM_001316689; MGI:1349436

Alleles Listed at MGI

All Mutations and Alleles(2) : Chemically induced (ENU)(1) Targeted(1)

Phenotypic Description

Figure 1. Ernie2 mice exhibited weight loss on day 10 after DSS treatment. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Ernie2 phenotype was identified among G3 mice of the pedigree R0801, some of which showed weight loss at day 10 after treatment with dextran sulfate sodium (DSS)-containing water, indicating susceptibility to DSS-induced colitis (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the DSS-induced weight loss at day 10 after DSS treatment using a semidominant model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 44 mutations (X-axis) identified in the G1 male of pedigree R0801. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 44 mutations. The increased susceptibility to DSS-induced colitis was linked by continuous variable mapping to a mutation in Ern2: a T to C transition at base pair 122,180,862 (v38) on chromosome 7, or base pair 5,365 in the GenBank genomic region NC_000073 within the donor splice site of intron 7. Linkage was found with an additive model of inheritance (P = 1.30 x 10^-4) wherein two variant homozygotes departed phenotypically from seven homozygous reference mice and 11 heterozygous mice (Figure 2).  The effect of the mutation at the cDNA and protein level have not examined, but the mutation is predicted to not result in disruption of the splice donor site; native splicing sites might be used. In the event that the mutation affects splicing, the most likely aberrant splicing result will be skipping of the 102-base pair exon 7 (out of 22 total exons (shown below), resulting in an in-frame deletion of 34 amino acids beginning after amino acid 161 of the protein.

<--exon 6          <--exon 7 intron 7-->              exon 8-->         <--exon 22 4921 ……TTCATTGGCCGAACAC ……GGCTCACCCGGGAAAT gtgagtcctccccttttgcagc…… ACATGAGCCAC…… ……ACAAAGAGCTGA…… 157  ……-F--I--G--R--T-- ……-G--S--P--G--K--                          Y--M--S--H-…… ……-T--K--S--*-            correct            deleted                                         correct

Genomic numbering corresponds to NC_000073. The donor splice site of intron 7, which is affected by the Ernie2 mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. 

Protein Prediction

Figure 3. Domains of IRE1β. IRE1β is a type I transmembrane receptor in the endoplasmic reticulum. See the text for more details. Abbreviations: SP, signal peptide; PQQ, pyrrolo-quinoline quinone beta-propeller repeat; TM, transmembrane domain; KEN, kinase-extension-nuclease domain. The Ernie2 mutation within intron 7 is indicated in red.

Ern2 encodes inositol-requiring enzyme 1β (IRE1β), a type I transmembrane receptor paralog of IRE1α. IRE1β and IRE1α have an N-terminal sensory domain that faces the endoplasmic reticulum (ER) lumen (amino acids 35-426), a transmembrane domain (amino acid 427-447), and a cytoplasmic effector domain at the C-terminus (amino acid 448-911) [Figure 3; (1;2)]. Amino acids 1-33 comprise a signal peptide. The luminal domain (LD) of IRE1β has four pyrrolo-quinoline quinone (PQQ) beta-propeller repeats (amino acids 33-64, 115-147, 148-180, and 192-223; SMART) (3). The cytoplasmic domain of IRE1β has both a protein kinase domain (amino acids 508-768) and a kinase-extension-nuclease domain (KEN domain; alternatively, RNAse domain; amino acids 771-899) (3).

The Ernie2 mutation may cause aberrant splicing and subsequent deletion of exon 7, which encodes amino acids 162-196 within the third PQQ beta-propeller repeat of the N-terminal sensory domain.

For more information about Ern2, please see the record for ernie.

Putative Mechanism

IRE1β is expressed in the gastrointestinal epithelial cells and mucus cells in bronchial epithelia. During the unfolded protein response (UPR), both IRE1α and IRE1β can catalyze the processing of Xbp1 (4-6), although IRE1β is less efficient than IRE1α (1). IRE1α and IRE1β both activate c-Jun NH₂-terminal kinase (JNK) in response to ER stress (7). IRE1β is unique from IRE1α in that IRE1β directly interacts with unfolded proteins rather than with GRP78 during conditions of ER stress (8).

IRE1β posttranscriptionally degrades Mtp (9), which is induced during enterocyte differentiation. Mtp encodes an ER chaperone required for lipid mobilization via apolipoprotein B (apoB) lipoproteins (9). MTP and apoB are also required for chylomicron assembly in the ER of enterocytes (10-12). Chylomicrons are vesicles synthesized by the intestine and function to transport large quantities of dietary fat and fat-soluble vitamins (12-14).

Ern2 knockout (Ern2^-/-) mice are viable and healthy. However, when challenged with DSS, the Ern2^-/- mice (in both the 129svev and C57BL/6 genetic backgrounds) developed colitis 3-5 days earlier than wild-type and heterozygous mice. In addition, the Ern2^-/- mice exhibited mortality approximately 5 days earlier than wild-type or heterozygous mice.  Further studies determined that loss of IRE1β expression promotes ER stress specifically in immature goblet cells (15). Examination of goblet cells from Ern2^-/- mice determined that the ER was distended in the cells. Within the distended ER of the immature goblet cells, aberrant mucin accumulation was observed. Tsuru et al. proposed that the susceptibility to colitis may indicate a qualitative defect in mucins secreted by the goblet cells in the Ern2^-/- mice (15). Similar to the Ern2^-/- mice, the Ernie2 mice exhibit susceptibility to DSS-induced colitis indicating loss of function in IRE1β.

Primers

PCR Primer
Ernie2_pcr_F: CTGACAGGATTGAGCAGGGCATTAG
Ernie2_pcr_R: TGGGTTTGGGAAGGACCACATGAC

Sequencing Primer
Ernie2_seq_F: TCCCTTAAGATGCAAGGGGTC
Ernie2_seq_R: CACATGACCATTCTCCTGGTAG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 453 nucleotides is amplified (chromosome 7, - strand):

1   tgggtttggg aaggaccaca tgaccattct cctggtagct ttgcttgtga cacacagagt
61  acacagtctc catgcatgac ctacggaccc cagccctgcg gtggaacaca acctatcgcc
121 gctactcagc acccctcctg aatggctcac ccgggaaatg tgagtcctcc ccttttgcag
181 cgttaccttg gaacaaagtc cccaacctgg gaagccccgg gtgacatcag gaccaaatac
241 tagcaaatac tgatccactg atccactgtc ccctcacatg atgaatgaca gcctgacaga
301 tgacctgggt tgactctgat gatcacatag cctgagcaat acatccgaac ttctccatac
361 tccaaatgac cccagccagg tagcctgagg tgaccccttg catcttaagg gacccccaag
421 caacctccct aatgccctgc tcaatcctgt cag

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Imagawa, Y., Hosoda, A., Sasaka, S., Tsuru, A., and Kohno, K. (2008) RNase Domains Determine the Functional Difference between IRE1alpha and IRE1beta. FEBS Lett. 582, 656-660.

  2. Lee, K. P., Dey, M., Neculai, D., Cao, C., Dever, T. E., and Sicheri, F. (2008) Structure of the Dual Enzyme Ire1 Reveals the Basis for Catalysis and Regulation in Nonconventional RNA Splicing. Cell. 132, 89-100.

  3. Wang, X. Z., Harding, H. P., Zhang, Y., Jolicoeur, E. M., Kuroda, M., and Ron, D. (1998) Cloning of Mammalian Ire1 Reveals Diversity in the ER Stress Responses. EMBO J. 17, 5708-5717.

  4. Calfon, M., Zeng, H., Urano, F., Till, J. H., Hubbard, S. R., Harding, H. P., Clark, S. G., and Ron, D. (2002) IRE1 Couples Endoplasmic Reticulum Load to Secretory Capacity by Processing the XBP-1 mRNA. Nature. 415, 92-96.

  5. Lee, K., Tirasophon, W., Shen, X., Michalak, M., Prywes, R., Okada, T., Yoshida, H., Mori, K., and Kaufman, R. J. (2002) IRE1-Mediated Unconventional mRNA Splicing and S2P-Mediated ATF6 Cleavage Merge to Regulate XBP1 in Signaling the Unfolded Protein Response. Genes Dev. 16, 452-466.

  6. Yoshida, H., Matsui, T., Yamamoto, A., Okada, T., and Mori, K. (2001) XBP1 mRNA is Induced by ATF6 and Spliced by IRE1 in Response to ER Stress to Produce a Highly Active Transcription Factor. Cell. 107, 881-891.

  7. Urano, F., Wang, X., Bertolotti, A., Zhang, Y., Chung, P., Harding, H. P., and Ron, D. (2000) Coupling of Stress in the ER to Activation of JNK Protein Kinases by Transmembrane Protein Kinase IRE1. Science. 287, 664-666.

  8. Oikawa, D., Kitamura, A., Kinjo, M., and Iwawaki, T. (2012) Direct Association of Unfolded Proteins with Mammalian ER Stress Sensor, IRE1beta. PLoS One. 7, e51290.

  9. Dai, K., Khatun, I., and Hussain, M. M. (2010) NR2F1 and IRE1beta Suppress Microsomal Triglyceride Transfer Protein Expression and Lipoprotein Assembly in Undifferentiated Intestinal Epithelial Cells. Arterioscler Thromb Vasc Biol. 30, 568-574.

  10. Hussain, M. M., Shi, J., and Dreizen, P. (2003) Microsomal Triglyceride Transfer Protein and its Role in apoB-Lipoprotein Assembly. J Lipid Res. 44, 22-32.

  11. Hussain, M. M., Iqbal, J., Anwar, K., Rava, P., and Dai, K. (2003) Microsomal Triglyceride Transfer Protein: A Multifunctional Protein. Front Biosci. 8, s500-6.

  12. Iqbal, J., Dai, K., Seimon, T., Jungreis, R., Oyadomari, M., Kuriakose, G., Ron, D., Tabas, I., and Hussain, M. M. (2008) IRE1beta Inhibits Chylomicron Production by Selectively Degrading MTP mRNA. Cell Metab. 7, 445-455.

  13. Hussain, M. M., Kancha, R. K., Zhou, Z., Luchoomun, J., Zu, H., and Bakillah, A. (1996) Chylomicron Assembly and Catabolism: Role of Apolipoproteins and Receptors. Biochim Biophys Acta. 1300, 151-170.

  14. Hussain, M. M. (2000) A Proposed Model for the Assembly of Chylomicrons. Atherosclerosis. 148, 1-15.

  15. Tsuru, A., Fujimoto, N., Takahashi, S., Saito, M., Nakamura, D., Iwano, M., Iwawaki, T., Kadokura, H., Ron, D., and Kohno, K. (2013) Negative Feedback by IRE1beta Optimizes Mucin Production in Goblet Cells. Proc Natl Acad Sci U S A. 110, 2864-2869.