Phenotypic Mutation 'new_gray'

• Allele: new_gray
• Mutation Type: missense
• Chromosome: 9
• Gene: Myo5a
• Gene Name: myosin VA
• Synonym(s): flail, Myo5, MVa, Dbv, 9630007J19Rik, MyoVA
• Chromosomal Location: 74,978,297-75,130,970 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three myosin V heavy-chain genes, belonging to the myosin gene superfamily. Myosin V is a class of actin-based motor proteins involved in cytoplasmic vesicle transport and anchorage, spindle-pole alignment and mRNA translocation. The protein encoded by this gene is abundant in melanocytes and nerve cells. Mutations in this gene cause Griscelli syndrome type-1 (GS1), Griscelli syndrome type-3 (GS3) and neuroectodermal melanolysosomal disease, or Elejalde disease. Multiple alternatively spliced transcript variants encoding different isoforms have been reported, but the full-length nature of some variants has not been determined. [provided by RefSeq, Dec 2008] ; PHENOTYPE: Mutations in this gene result in diluted coat color, behavioral deficits including opisthotonus, and postnatal or premature death. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Ref Sequences:
  Ensembl: ENSMUSP00000116028
• Gene Model: not available
• AlphaFold: Q99104
• PDB Structure: Structure of apo-calmodulin bound to unconventional myosin V [X-RAY DIFFRACTION] ; Crystal Structure of MyoVa-GTD [X-RAY DIFFRACTION] ; Crystal Structure of MyoVa-GTD in Complex with Two Cargos [X-RAY DIFFRACTION]
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Probably essential (E-score: 0.958)
• Phenotypic Category: Autosomal Recessive
• Penetrance: 100%
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Embryos, Sperm, gDNA
• Last Updated: 2019-04-18 12:01 PM by Stephen Lyon
• Record Created: unknown
• Record Posted: 2007-12-26
• Science Writers: Eva Marie Y. Moresco
• Illustrators: Diantha La Vine
• Authors: Celine Eidenschenk, Bruce Beutler

Accession Number

NCBI RefSeq: NM_010864; MGI: 105976

Alleles Listed at MGI

All alleles(71) : Gene trapped(2) Spontaneous(52) Chemically induced(17) 

Repository

none

Phenotypic Description

New gray was identified as a visible phenotype among ENU-induced G3 mutant mice. Homozygous new gray mice display a gray coat color and black eyes, as observed in concrete mutants. New gray mice exhibit normal resistance to mouse cytomegalovirus (MCMV) (MCMV Susceptibility and Resistance Screen) and to Listeria monocytogenes. Normal degranulation by natural killer (NK) cells from new gray mice is observed after antibody stimulation of NKp46 or Ly49H receptors, after exposure to YAC-1 cells, or after PMA/ionomycin stimulation.

Nature of Mutation

The new gray mutation mapped to Chromosome 9, and corresponds to a dinucleotide transition in adjacent nucleotides (GC to AT) at positions 1972 and 1973 of the Myo5a gene. The mutation occurs in exon 13 of 41 exons, and changes two codons such that two amino acids of the protein sequence are altered (M515, P516 to I515, S516).

 

1528 GATGAGGAATGTAAGATGCCTAAAGGCACAGATGAC

510  -D--E--E--C--K--M--P--K--G--T--D--D-

 

The mutated nucleotides are indicated in red lettering.

Protein Prediction

Figure 1. Domain structure of myosin Va.  The head domain contains the actin-binding and ATP-binding sites and generates force.  A central neck domain or light-chain binding domain contains six calmodulin binding IQ motifs.  The C-terminal half of myosin Va consists of the coiled coil (CC) segments responsible for myosin heavy chain dimerization and a globular tail domain (GTD) that mediates cargo binding.  The new gray mutation is a dinucleotide transition resulting in the substitution at positions 515 and 516 of methionine and proline to isoleucine and serine, respectively (red asterisk). This image is interactive. Click on the image to view other mutations found in Myo5a (red). Click on the mutations for more specific information.

Myosins are actin-based molecular motors for various cellular cargoes, producing mechanical force through repeated cycles of ATP hydrolysis. They are composed of one or two heavy chains and one to six light chains. First cloned from mouse in 1991, myosin Va is an 1853 amino acid myosin heavy chain (MHC) (Figure 1) (1). It shares extensive homology with other MHCs in the head or motor region (amino acids ~1-765), which includes the ATP- and actin-binding sites. Myosin Va contains a novel C-terminal tail domain, and thus was designated the first member of a new class (V) of MHC (1). Following the head domain is the neck domain, which contains six imperfect tandem IQ repeats (amino acids ~766-912) that bind to six calmodulin light chains. Together, two myosin Va heavy chains and six calmodulin light chains are now known to form myosin V (42). The C terminal half of myosin Va contains a region forming an α-helical coiled-coil sequence that mediates the dimerization of myosin Va heavy chains (amino acids~ 913-1420). The last ~400 C-terminal amino acids form the globular tail domain (GTD). The GTD both mediates binding to specific organelles, such as melanosomes, and serves as a negative regulator of motor activity by folding back and contacting residues in the head domain (43).

 

Extensive structural studies have been performed on myosin V, and a relatively detailed understanding of both its static and dynamic structures is available (2;3). The myosin ATP hydrolysis cycle and coupled structural changes that move it along an actin filament are depicted in Figure 2.

 

The new gray mutation results in the substitution of amino acids methionine 515 and proline 516 of myosin Va with isoleucine and serine, respectively.

Expression/Localization

Northern blot analysis detects Myo5a transcripts in most adult mouse tissues, including heart, skeletal muscle, testis, thymus, spleen and kidney, with very high expression in brain and skin (1). No Myo5a is detected in liver. Myo5a is subject to tissue-specific transcriptional regulation since several transcripts of different sizes are found in different tissues (1;4). The neuronal expression of Myo5a occurs both embryonically and in the adult, and is found throughout the brain (1). Immunolocalization of myosin Va confirms these data, and detects expression in both neuronal cell bodies and processes, but not in astrocytes (5) [although a recent report ascribes a role for myosin Va in myelination (6)]. Subcellularly, myosin Va is localized on melanosomes (7;8), and in the growth cones, specifically on actin filaments and the plasma membrane, of cultured superior cervical ganglion neurons (9).

Background

Melanins, the pigments for skin, hair and eyes, are synthesized in melanosomes. Visible pigmentation in mammals requires the transfer of melanosomes, from melanocytes where they are made, to keratinocytes. For this transfer to occur, melanosomes must first be accumulated at the distal ends of melanocyte dendrites, the site of exocytosis. Extensive study of three mouse coat color mutants (dilute, ashen and leaden) has greatly advanced the understanding of melanosome movement. This work demonstrated that melanosomes are transported in a bidirectional manner along microtubules, and their accumulation in the periphery depends on their capture and transfer, at the distal ends of dendrites, to actin filaments.

 

Mutation of the Myo5a gene results in the mouse phenotype dilute (d), first studied as a coat color mutant having light gray fur (10;11). The hair shafts of Myo5a^d mice contain normal levels of melanin, but its distribution is irregular and is often found in clumps (10). In Myo5a^d mice, melanosomes are synthesized normally, but cluster in the perinuclear region, resulting in uneven and impaired release of melanin (12;13). The ashen (ash) and leaden (ln) mice also have a light coat color, and exhibit exactly the same cellular phenotype as Myo5a^d mice (7;12). The genes mutated in these three strains encode protein products that form a tripartite complex regulating the microtubule to actin filament transfer of melanosomes, a crucial step leading to melanosome exocytosis (Figure 3). Ashen encodes the small GTPase Rab27a (14) (mutated in concrete) and leaden encodes melanophilin (Mlph, also called Slac2-a; mutated in koala), which is thought to link melanosome-bound Rab27a to myosin Va (15). The tripartite complex forms on melanosomes after activation of Rab27a to its GTP-bound form, and mediates the transfer of melanosomes from a microtubule-based kinesin motor to the actin-based motor myosin Va (16-18). When this capture mechanism is lacking, as a result of mutations in any of these three proteins, melanosomes redistribute along microtubules, and appear clustered in regions with high microtubule density, which is greatest near the central cytoplasm (7;12;13). Although microtubule movement continues in mutant melanocytes, their failure to be captured prevents peripheral accumulation (7).

 

Of the hundreds of “dilute” mutations identified, many alleles confer, in addition to a coat color phenotype, a neurological phenotype as well. The dilute lethal (d^l) and dilute opisthotonic (d^op) mice exhibit opisthotonus, a convulsive arching of the head and neck (19). These convulsions become apparent at 9 days of age, and continue until death at approximately 3 weeks of age. The coat color and neurological phenotypes are genetically inseparable (20), and it is now known that they both result from mutations in Myo5a. The original Myo5a^d (also called dilute viral, Myo5a^d-v) mutation was shown to be caused by the insertion of an ecotropic murine leukemia virus (Emv-3) genome into the Myo5a gene; phenotypic revertants of Myo5a^d result from viral excision (21;22). The insertion occurs within an intron of Myo5a in a region of the C-terminal tail domain that is differentially spliced into melanocyte-specific, but not neuronal-specific transcripts (4). As a result of the insertion, almost none of the normal transcripts are detected in RNA from skin cells, while some normal transcripts are found in brain RNA (4). The apparently sufficient amount of normal myosin Va in Myo5a^d/d brains is postulated to account for the lack of neurological dysfunction in this strain. In contrast, dilute lethal alleles represent null mutations of Myo5a, which would necessarily result in the absence of neuronal Myo5a transcripts (23;24).

 

The basis for the neurological phenotype of dilute lethal mice remains incompletely understood. No gross anatomical deficiencies have been observed in dilute lethal mice or dilute opisthotonus (dop) rats (which also carry a null allele of Myo5a) (25). However, immunoelectron microscopic analysis of dendritic spines of dilute lethal Purkinje cells demonstrates that they lack smooth endoplasmic reticulum, an important intracellular Ca²⁺ store, and inositol-1,4,5-triphosphate (IP3) receptors, which trigger Ca²⁺ release from these stores (26;27). Notably, IP3 receptor mutant mice exhibit a similar neurological phenotype as dilute lethal mice, with tonic seizures and death by weaning age (28). Although basal synaptic transmission (from climbing and parallel fibers) is normal in dilute lethal mice, long-term depression (LTD) is impaired (27). LTD is thought to underlie motor learning in the cerebellum, and is reported to require IP3-mediated Ca²⁺ release. Consistent with this idea, IP3-mediated Ca²⁺ release from intracellular stores is significantly decreased in Purkinje cell dendritic spines of dilute lethal mice compared to wild type (29). Recent data also provide evidence that myelination of brain, optic nerve and spinal cord is impaired in dilute lethal mice, which may account for their neurological defects (6). These data suggest that multiple cellular mechanisms likely contribute to the severe neurological phenotype of dilute lethal mice.

 

 The diluted coat color phenotype of Rab27a^ash, Myo5a^d and Mlph^ln mice can be rescued by the semi-dominant dilute suppressor (dsu) locus (30;31), which bears a mutation in the gene encoding melanoregulin (Mreg) (32). Mreg^dsu suppresses the coat color defect, but not the neurological or lethal effects of Myo5a-null alleles (i.e. dilute lethal and Myo5a^d-l20J(23;31). Mreg^dsu does not suppress the diluted coat color of 14 other mutants which have mechanistically different causes for pigmentation defects, although it does suppress the ruby eye color of ruby-eye and ruby-eye-2 mice (33) (see records for stamper-coat, toffee, and dorian gray). The dsu locus has been demonstrated to function cell-autonomously in melanocytes; its protein product is not diffusible (34). Interestingly, Mreg^dsu modulates hair pigment through a myosin Va-independent pathway, as demonstrated by its inability to restore proper melanosome transport/localization in both Myo5a^d/d and Myo5a-null melanocytes (32). Instead, Mreg^dsu alters the incorporation of pigment into hair, decreasing the normal spacing between bands of pigment in the hair (32). Mreg is a 214 amino acid vertebrate protein with no similarity to known motor proteins or transcription factors, and lacks any known functional domains (32). Thus, the mechanism by which it regulates pigment incorporation into hair is yet unknown. Recently, Mreg was shown to interact with peripherin-2, a tetraspanin protein regulating the formation of disk membranes, specialized organelles of photoreceptor rod cells (35).

 

In humans, mutations in MYO5A result in Griscelli syndrome type I (OMIM #214450), represented by partial albinism of the skin and hair and neurologic deficit, but without immunologic impairment or hemophagocytic syndrome characteristic of Griscelli syndrome type II (36;37) (OMIM #607624). Mutations in RAB27A cause Griscelli syndrome type II (37), but the normal immune function of patients with myosin Va and melanophilin mutations strongly supports the idea that the Rab27a/melanophilin/myosin Va complex is specific for melanosome transport and does not contribute to lytic granule transport in immune cells (38;39).

Putative Mechanism

The new gray mutation changes two amino acids in the head region of myosin Va, encoded by exons that are not alternatively spliced in brain versus skin. The alternatively spliced exons of Myo5a occur in the tail domain, with tissue-specific differential splicing of exons designated B, D and F (4). Thus, it is initially surprising that new gray mice exhibit no neurological defects, since both skin and brain myosin Va should be altered by the mutation. However, some dilute mice with mutations affecting all isoforms of myosin Va display only mild neurological phenotypes or neurological phenotypes that disappear with age, always together with a coat color phenotype (i.e. a neurological phenotype never occurs without a coat color phenotype) (40;41). Some of these dilute alleles (called dilute neurological, dⁿ)) contain chemically-induced mutations in the head region (41), similar to new gray. One of these (Myo5a^1MNURe), described by Huang et al, is P516S, identical to one of the two amino acid changes in new gray (41). This dⁿ mutant has pigment dilution, but no neurological impairment. Northern and Western blot analysis determined that both RNA and protein levels are essentially unchanged from wild type levels (41). The primary structure of all myosin heads is highly conserved, and Huang et al modeled the position of P516 on the crystal structure for the chicken skeletal muscle conventional myosin II head. P516 is located in one of the regions believed to closely interact with the actin filament (41). This residue is conserved in about 85% of all known myosins. Huang et al hypothesize that the mild phenotype of Myo5a^1MNURe suggests that the mutant protein is partially active (41). The apparently identical phenotypes of Myo5a^1MNURe and Myo5a^{new gray} suggest that the two-amino acid mutation in new gray also results in a protein that retains some function.

 

The reasons that coat color can be affected by myosin Va mutations, without obvious neurological effects remains unknown. Clearly the molecular interactors of myosin Va in the melanosome are not the same as those in neurons. Other neuron-specific actin-based motors or accessory proteins may be able to compensate for the loss of myosin Va function. Interestingly, some dⁿ mutants exhibit neurological phenotypes at 1-3 weeks of age, but recover progressively and have apparently normal behavior by adulthood (41), suggesting that compensatory mechanisms exist which can overcome the developmental neurological deficits caused by certain Myo5a mutations.

Primers

Primers cannot be located by automatic search.

Genotyping

New gray genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the dinucleotide change.

 

Primers for PCR amplification

New(F): 5’-GAATGAGCCCACTCAAGTACGTGTC-3’

New(R): 5’-TCACCATGCTTGCACAGGAGAC-3’

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C               ∞

 

Primers for sequencing

New_seq(F): 5’- TAGGCAGATTGTCACTCACG-3’

New_seq(R): 5’- ATGCACTCCGAGATGTAGTATG-3’

 

The following sequence of 1111 nucleotides (from Genbank genomic region NC_000075 for linear DNA sequence of Myo5α) is amplified:

 

82117                                        gaat gagcccactc aagtacgtgt

82141 cttaaaaaca ggtaacaagt agtaaagttt ctggaaatgg caagaggaga cagactacca

82201 gttcatacct ttctgggtta tattaatatt ttactgtgta taaatgttac ttccatttag

82261 caatttaaaa aaataaagta tgcctaataa ttgtatttta tctttaactt gcaaagcctt

82321 tattgtatta aaaaattaaa tattgatgac tcctggtata ggcagattgt cactcacgtg

82381 ttgtaccggg tcaccccaag ccacaccctt ccttcattgg tggttagctt gtgtggatga

82441 gaataaagaa tgaattatta agttgaacat aggaactggt gtcttgttgc tgatgtcgca

82501 gaagaccttt agcactcagt catcacttca ctttcttttt tctccccaag atgcctaaag

82561 gcacagatga cacatgggcc caaaaactgt acaacacaca tttgaacaaa tgtgccctct

82621 ttgagaagcc ccgcatgtca aacaaagctt tcatcatcaa acattttgct gacaaagtaa

82681 ggaaactttt tgtctttttt tttccttttt ctgtaattta catcgaatta taataaaaat

82741 cagtagtcaa gtattggttg gtttgtttgt ttgtttgttt gtttgtttgt tttggcagca

82801 cttgcttcct ttaaagtcct ttcagggaaa gcagtcttca gtactgccat ctgggttttt

82861 tcccactgta acttgagttg attacatatt aagtaaatat gggtcaaaag tctttgtctg

82921 aaatgttgaa attcaagaaa ctgaaaacca aaagtgtttt cataacttgt ttagcaccca

82981 aacctaatct ctgacttgaa ctaacatgag atcgattcat aatttttagc ccaattgagg

83041 tgggtattta tgtgtttaag tatgaaaaat taatgtaatt tatggtatgc atgactttat

83101 taaacttttt ggtagtacta aaatggtgta tatacatact acatctcgga gtgcatgcat

83161 tacttctaaa ggcctcacag gtttcatacc agagactgga tttttgtctc ctgtgcaagc

83221 atggtga

 

PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated G and C are shown in red text.

References

   1.  Mercer, J. A., Seperack, P. K., Strobel, M. C., Copeland, N. G., and Jenkins, N. A. (1991) Novel myosin heavy chain encoded by murine dilute coat colour locus, Nature 349, 709-713.

   2.  Sellers, J. R. and Veigel, C. (2006) Walking with myosin V, Curr. Opin. Cell Biol. 18, 68-73.

   3.  Tyska, M. J. and Mooseker, M. S. (2003) Myosin-V motility: these levers were made for walking, Trends Cell Biol. 13, 447-451.

   4.  Seperack, P. K., Mercer, J. A., Strobel, M. C., Copeland, N. G., and Jenkins, N. A. (1995) Retroviral sequences located within an intron of the dilute gene alter dilute expression in a tissue-specific manner, EMBO J 14, 2326-2332.

   5.  Tilelli, C. Q., Martins, A. R., Larson, R. E., and Garcia-Cairasco, N. (2003) Immunohistochemical localization of myosin Va in the adult rat brain, Neuroscience 121, 573-586.

   6.  Sloane, J. A. and Vartanian, T. K. (2007) Myosin Va controls oligodendrocyte morphogenesis and myelination, J Neurosci. 27, 11366-11375.

   7.  Wu, X., Bowers, B., Rao, K., Wei, Q., and Hammer, J. A., III (1998) Visualization of melanosome dynamics within wild-type and dilute melanocytes suggests a paradigm for myosin V function In vivo, J Cell Biol. 143, 1899-1918.

   8.  Wu, X., Bowers, B., Wei, Q., Kocher, B., and Hammer, J. A., III (1997) Myosin V associates with melanosomes in mouse melanocytes: evidence that myosin V is an organelle motor, J Cell Sci. 110 ( Pt 7), 847-859.

   9.  Evans, L. L., Hammer, J., and Bridgman, P. C. (1997) Subcellular localization of myosin V in nerve growth cones and outgrowth from dilute-lethal neurons, J Cell Sci. 110 ( Pt 4), 439-449.

 10.  Russell, E. S. (1949) A quantitative histological study of the pigment found in the coat-color mutants of the house mouse. IV. The nature of the effects of genic substitution in five major allelic series, Genetics 34, 146-166.

 11.  Markert, C. L. and Silvers, W. K. (1956) The Effects of Genotype and Cell Environment on Melanoblast Differentiation in the House Mouse, Genetics 41, 429-450.

 12.  Provance, D. W., Jr., Wei, M., Ipe, V., and Mercer, J. A. (1996) Cultured melanocytes from dilute mutant mice exhibit dendritic morphology and altered melanosome distribution, Proc. Natl. Acad. Sci. U. S. A 93, 14554-14558.

 13.  Koyama, Y. I. and Takeuchi, T. (1981) Ultrastructural observations on melanosome aggregation in genetically defective melanocytes of the mouse, Anat. Rec. 201, 599-611.

 14.  Wilson, S. M., Yip, R., Swing, D. A., O'Sullivan, N., Zhang, Y., Novak, E. K., Swank, R. T., Russel, L. B., Copeland, N. G., and Jenkins, N. A. (2000) A mutation in Rab27a causes the vesicle transport defects observed in ashen mice, Proc. Natl. Acad. Sci. USA 97, 7933-7938.

 15.  Matesic, L. E., Yip, R., Reuss, A. E., Swing, D. A., O'Sullivan, T. N., Fletcher, C. F., Copeland, N. G., and Jenkins, N. A. (2001) Mutations in Mlph, encoding a member of the Rab effector family, cause the melanosome transport defects observed in leaden mice, Proc. Natl. Acad. Sci. U. S. A 98, 10238-10243.

 16.  Wu, X., Wang, F., Rao, K., Sellers, J. R., and Hammer, J. A., III (2002) Rab27a is an essential component of melanosome receptor for myosin Va, Mol. Biol. Cell 13, 1735-1749.

 17.  Fukuda, M., Kuroda, T. S., and Mikoshiba, K. (2002) Slac2-a/melanophilin, the missing link between Rab27 and myosin Va: implications of a tripartite protein complex for melanosome transport, J Biol. Chem. 277, 12432-12436.

 18.  Strom, M., Hume, A. N., Tarafder, A. K., Barkagianni, E., and Seabra, M. C. (2002) A family of Rab27-binding proteins. Melanophilin links Rab27a and myosin Va function in melanosome transport, J Biol. Chem. 277, 25423-25430.

 19.  Searle, A. G. (1952) A lethal allele of dilute in the house mouse, Heredity 6, 395-401.

 20.  Russell, L. B. (1971) Definition of functional units in a small chromosomal segment of the mouse and its use in interpreting the nature of radiation-induced mutations, Mutat. Res. 11, 107-123.

 21.  Jenkins, N. A., Copeland, N. G., Taylor, B. A., and Lee, B. K. (1981) Dilute (d) coat colour mutation of DBA/2J mice is associated with the site of integration of an ecotropic MuLV genome, Nature 293, 370-374.

 22.  Copeland, N. G., Hutchison, K. W., and Jenkins, N. A. (1983) Excision of the DBA ecotropic provirus in dilute coat-color revertants of mice occurs by homologous recombination involving the viral LTRs, Cell 33, 379-387.

 23.  Moore, K. J., Seperack, P. K., Strobel, M. C., Swing, D. A., Copeland, N. G., and Jenkins, N. A. (1988) Dilute suppressor dsu acts semidominantly to suppress the coat color phenotype of a deletion mutation, dl20J, of the murine dilute locus, Proc. Natl. Acad. Sci. U. S. A 85, 8131-8135.

 24.  Strobel, M. C., Seperack, P. K., Copeland, N. G., and Jenkins, N. A. (1990) Molecular analysis of two mouse dilute locus deletion mutations: spontaneous dilute lethal20J and radiation-induced dilute prenatal lethal Aa2 alleles, Mol. Cell Biol. 10, 501-509.

 25.  Takagishi, Y. and Murata, Y. (2006) Myosin Va mutation in rats is an animal model for the human hereditary neurological disease, Griscelli syndrome type 1, Ann. N. Y. Acad. Sci. 1086, 66-80.

 26.  Dekker-Ohno, K., Hayasaka, S., Takagishi, Y., Oda, S., Wakasugi, N., Mikoshiba, K., Inouye, M., and Yamamura, H. (1996) Endoplasmic reticulum is missing in dendritic spines of Purkinje cells of the ataxic mutant rat, Brain Res. 714, 226-230.

 27.  Miyata, M., Finch, E. A., Khiroug, L., Hashimoto, K., Hayasaka, S., Oda, S. I., Inouye, M., Takagishi, Y., Augustine, G. J., and Kano, M. (2000) Local calcium release in dendritic spines required for long-term synaptic depression, Neuron 28, 233-244.

 28.  Matsumoto, M., Nakagawa, T., Inoue, T., Nagata, E., Tanaka, K., Takano, H., Minowa, O., Kuno, J., Sakakibara, S., Yamada, M., Yoneshima, H., Miyawaki, A., Fukuuchi, Y., Furuichi, T., Okano, H., Mikoshiba, K., and Noda, T. (1996) Ataxia and epileptic seizures in mice lacking type 1 inositol 1,4,5-trisphosphate receptor, Nature 379, 168-171.

 29.  Finch, E. A. and Augustine, G. J. (1998) Local calcium signalling by inositol-1,4,5-trisphosphate in Purkinje cell dendrites, Nature 396, 753-756.

 30.  Moore, K. J., Swing, D. A., Rinchik, E. M., Mucenski, M. L., Buchberg, A. M., Copeland, N. G., and Jenkins, N. A. (1988) The murine dilute suppressor gene dsu suppresses the coat-color phenotype of three pigment mutations that alter melanocyte morphology, d, ash and ln, Genetics 119, 933-941.

 31.  Sweet, H. O. (1983) Dilute suppressor, a new suppressor gene in the house mouse, J Hered 74, 305-306.

 32.  O'Sullivan, T. N., Wu, X. S., Rachel, R. A., Huang, J. D., Swing, D. A., Matesic, L. E., Hammer, J. A., III, Copeland, N. G., and Jenkins, N. A. (2004) dsu functions in a MYO5A-independent pathway to suppress the coat color of dilute mice, Proc. Natl. Acad. Sci. U. S. A 101, 16831-16836.

 33.  Moore, K. J., Swing, D. A., Copeland, N. G., and Jenkins, N. A. (1990) Interaction of the murine dilute suppressor gene (dsu) with fourteen coat color mutations, Genetics 125, 421-430.

 34.  Moore, K. J., Swing, D. A., Copeland, N. G., and Jenkins, N. A. (1994) The murine dilute suppressor gene encodes a cell autonomous suppressor, Genetics 138, 491-497.

 35.  Boesze-Battaglia, K., Song, H., Sokolov, M., Lillo, C., Pankoski-Walker, L., Gretzula, C., Gallagher, B., Rachel, R. A., Jenkins, N. A., Copeland, N. G., Morris, F., Jacob, J., Yeagle, P., Williams, D. S., and mek-Poprawa, M. (2007) The tetraspanin protein peripherin-2 forms a complex with melanoregulin, a putative membrane fusion regulator, Biochemistry 46, 1256-1272.

 36.  Pastural, E., Barrat, F. J., Dufourcq-Lagelouse, R., Certain, S., Sanal, O., Jabado, N., Seger, R., Griscelli, C., Fischer, A., and de Saint, B. G. (1997) Griscelli disease maps to chromosome 15q21 and is associated with mutations in the myosin-Va gene, Nat. Genet. 16, 289-292.

 37.  Menasche, G., Pastural, E., Feldmann, J., Certain, S., Ersoy, F., Dupuis, S., Wulffraat, N., Bianchi, D., Fischer, A., Le, D. F., and de Saint, B. G. (2000) Mutations in RAB27A cause Griscelli syndrome associated with haemophagocytic syndrome, Nat. Genet. 25, 173-176.

 38.  Menasche, G., Ho, C. H., Sanal, O., Feldmann, J., Tezcan, I., Ersoy, F., Houdusse, A., Fischer, A., and de Saint, B. G. (2003) Griscelli syndrome restricted to hypopigmentation results from a melanophilin defect (GS3) or a MYO5A F-exon deletion (GS1), J Clin. Invest 112, 450-456.

 39.  Anikster, Y., Huizing, M., Anderson, P. D., Fitzpatrick, D. L., Klar, A., Gross-Kieselstein, E., Berkun, Y., Shazberg, G., Gahl, W. A., and Hurvitz, H. (2002) Evidence that Griscelli syndrome with neurological involvement is caused by mutations in RAB27A, not MYO5A, Am. J Hum. Genet. 71, 407-414.

 40.  Huang, J. D., Mermall, V., Strobel, M. C., Russell, L. B., Mooseker, M. S., Copeland, N. G., and Jenkins, N. A. (1998) Molecular genetic dissection of mouse unconventional myosin-VA: tail region mutations, Genetics 148, 1963-1972.

 41.  Huang, J. D., Cope, M. J., Mermall, V., Strobel, M. C., Kendrick-Jones, J., Russell, L. B., Mooseker, M. S., Copeland, N. G., and Jenkins, N. A. (1998) Molecular genetic dissection of mouse unconventional myosin-VA: head region mutations, Genetics 148, 1951-1961.

 42.  Cheney, R. E., O'Shea, M. K., Heuser, J. E., Coelho, M. V., Wolenski, J. S., Espreafico, E. M., Forscher, P., Larson, R. E., and Mooseker, M. S. (1993) Brain myosin-V is a two-headed unconventional myosin with motor activity, Cell 75, 13-23.

 43.  Li, X. D., Jung, H. S., Wang, Q., Ikebe, R., Craig, R., and Ikebe, M. (2008) The globular tail domain puts on the brake to stop the ATPase cycle of myosin Va, Proc. Natl. Acad. Sci. U. S. A 105, 1140-1145.