Phenotypic Mutation 'new_gray' (pdf version)
Allelenew_gray
Mutation Type missense
Chromosome9
Coordinate
Base Change
Gene Myo5a
Gene Name myosin VA
Synonym(s) 9630007J19Rik, Dbv, flail, MVa, Myo5, MyoVA
Chromosomal Location 75,071,015-75,223,688 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three myosin V heavy-chain genes, belonging to the myosin gene superfamily. Myosin V is a class of actin-based motor proteins involved in cytoplasmic vesicle transport and anchorage, spindle-pole alignment and mRNA translocation. The protein encoded by this gene is abundant in melanocytes and nerve cells. Mutations in this gene cause Griscelli syndrome type-1 (GS1), Griscelli syndrome type-3 (GS3) and neuroectodermal melanolysosomal disease, or Elejalde disease. Multiple alternatively spliced transcript variants encoding different isoforms have been reported, but the full-length nature of some variants has not been determined. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mutations in this gene result in diluted coat color, behavioral deficits including opisthotonus, and postnatal or premature death. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_010864; MGI: 105976

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Ref Sequences
Ensembl: ENSMUSP00000116028 (fasta)
Gene Model not available
PDB Structure
Structure of apo-calmodulin bound to unconventional myosin V [X-RAY DIFFRACTION]
Crystal Structure of MyoVa-GTD [X-RAY DIFFRACTION]
Crystal Structure of MyoVa-GTD in Complex with Two Cargos [X-RAY DIFFRACTION]
SMART Domains

DomainStartEndE-ValueType
Blast:MYSc 13 45 N/A BLAST
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1314 1364 N/A INTRINSIC
coiled coil region 1406 1443 N/A INTRINSIC
Pfam:DIL 1685 1790 4.4e-39 PFAM
Meta Mutation Damage Score Not available question?
Is this an essential gene? Probably essential (E-score: 0.950) question?
Phenotypic Category
Phenotypequestion? Literature verified References
pigmentation
skin/coat/nails
Candidate Explorer Status CE: no linkage results
Single pedigree
Linkage Analysis Data
Penetrance 100% 
Alleles Listed at MGI

All alleles(71) : Gene trapped(2) Spontaneous(52) Chemically induced(17

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Myo5a APN 9 75161497 nonsense probably null
IGL00547:Myo5a APN 9 75141453 missense probably benign 0.00
IGL00788:Myo5a APN 9 75168959 missense probably benign 0.15
IGL01327:Myo5a APN 9 75187538 splice site probably benign
IGL01687:Myo5a APN 9 75156249 missense probably benign 0.12
IGL01886:Myo5a APN 9 75169090 splice site probably benign
IGL01945:Myo5a APN 9 75140671 missense probably damaging 1.00
IGL02127:Myo5a APN 9 75212981 missense probably benign 0.12
IGL02137:Myo5a APN 9 75161535 splice site probably null
IGL02183:Myo5a APN 9 75167236 splice site probably benign
IGL02427:Myo5a APN 9 75176618 splice site probably benign
IGL02490:Myo5a APN 9 75136455 missense probably damaging 1.00
IGL02574:Myo5a APN 9 75211147 missense probably benign 0.00
IGL02886:Myo5a APN 9 75151887 splice site probably benign
IGL02961:Myo5a APN 9 75215120 missense probably benign 0.04
IGL03090:Myo5a APN 9 75120833 missense probably damaging 1.00
IGL03119:Myo5a APN 9 75174015 missense probably benign 0.01
IGL03237:Myo5a APN 9 75129994 missense probably damaging 1.00
IGL03296:Myo5a APN 9 75116202 missense probably damaging 1.00
naoki UTSW 9 75161492 missense probably damaging 1.00
nut UTSW 9 splice donor site
silver_decerebrate UTSW 9 75164195 missense probably damaging 1.00
silver_decerebrate_2 UTSW 9 75211127 missense probably damaging 1.00
IGL02988:Myo5a UTSW 9 75130141 splice site probably benign
IGL03050:Myo5a UTSW 9 75146909 unclassified probably null
PIT4403001:Myo5a UTSW 9 75217523 missense probably damaging 1.00
R0047:Myo5a UTSW 9 75156207 missense probably damaging 1.00
R0047:Myo5a UTSW 9 75156207 missense probably damaging 1.00
R0091:Myo5a UTSW 9 75161492 missense probably damaging 1.00
R0142:Myo5a UTSW 9 75160574 missense probably benign 0.01
R0243:Myo5a UTSW 9 75186123 critical splice donor site probably null
R0395:Myo5a UTSW 9 75193977 missense probably benign 0.39
R0427:Myo5a UTSW 9 75174196 missense probably benign 0.00
R0545:Myo5a UTSW 9 75167037 missense possibly damaging 0.94
R0565:Myo5a UTSW 9 75180112 missense probably benign 0.00
R0601:Myo5a UTSW 9 75174015 missense probably benign 0.01
R1457:Myo5a UTSW 9 75213065 missense probably damaging 0.99
R1510:Myo5a UTSW 9 75171551 missense probably benign
R1548:Myo5a UTSW 9 75171746 missense probably damaging 1.00
R1759:Myo5a UTSW 9 75181993 missense possibly damaging 0.72
R1924:Myo5a UTSW 9 75116207 missense probably damaging 1.00
R1960:Myo5a UTSW 9 75147857 missense probably damaging 1.00
R2050:Myo5a UTSW 9 75146874 missense probably benign 0.01
R2070:Myo5a UTSW 9 75181984 missense probably benign 0.03
R2075:Myo5a UTSW 9 75189918 missense probably benign 0.01
R2148:Myo5a UTSW 9 75180147 missense probably damaging 1.00
R2201:Myo5a UTSW 9 75217943 missense possibly damaging 0.51
R2337:Myo5a UTSW 9 75203801 missense probably damaging 1.00
R2357:Myo5a UTSW 9 75201365 missense probably damaging 0.99
R2392:Myo5a UTSW 9 75209239 missense probably benign 0.02
R2432:Myo5a UTSW 9 75212873 missense possibly damaging 0.89
R2568:Myo5a UTSW 9 75123040 missense probably damaging 1.00
R2568:Myo5a UTSW 9 75151897 missense probably damaging 1.00
R2932:Myo5a UTSW 9 75196136 missense possibly damaging 0.85
R2971:Myo5a UTSW 9 75116202 missense probably damaging 1.00
R4231:Myo5a UTSW 9 75189997 missense possibly damaging 0.67
R4293:Myo5a UTSW 9 75144171 missense probably benign
R4321:Myo5a UTSW 9 75217530 missense probably damaging 0.99
R4450:Myo5a UTSW 9 75167176 missense probably benign 0.00
R4573:Myo5a UTSW 9 75201297 synonymous probably null
R4577:Myo5a UTSW 9 75217545 missense probably damaging 1.00
R4601:Myo5a UTSW 9 75136388 missense probably damaging 1.00
R4690:Myo5a UTSW 9 75153823 missense probably damaging 0.99
R4691:Myo5a UTSW 9 75180156 missense probably damaging 0.99
R4764:Myo5a UTSW 9 75116336 intron probably benign
R4767:Myo5a UTSW 9 75144076 missense probably damaging 0.99
R4811:Myo5a UTSW 9 75141543 critical splice donor site probably null
R4829:Myo5a UTSW 9 75136407 missense probably damaging 1.00
R4863:Myo5a UTSW 9 75217507 missense probably damaging 1.00
R4902:Myo5a UTSW 9 75174078 missense probably benign
R4947:Myo5a UTSW 9 75123048 missense probably damaging 1.00
R5074:Myo5a UTSW 9 75174156 missense probably benign
R5095:Myo5a UTSW 9 75152020 missense probably damaging 1.00
R5095:Myo5a UTSW 9 75184389 nonsense probably null
R5254:Myo5a UTSW 9 75130120 missense probably damaging 1.00
R5267:Myo5a UTSW 9 75152010 missense probably damaging 1.00
R5419:Myo5a UTSW 9 75147897 missense probably damaging 1.00
R5514:Myo5a UTSW 9 75153766 missense probably damaging 1.00
R5629:Myo5a UTSW 9 75203845 missense possibly damaging 0.89
R5649:Myo5a UTSW 9 75171719 missense possibly damaging 0.92
R5661:Myo5a UTSW 9 75167206 missense probably benign 0.02
R5665:Myo5a UTSW 9 75144181 critical splice donor site probably null
R5719:Myo5a UTSW 9 75151931 missense probably damaging 1.00
R5964:Myo5a UTSW 9 75203833 missense probably benign 0.09
R6014:Myo5a UTSW 9 75167207 nonsense probably null
R6344:Myo5a UTSW 9 75160509 missense probably benign 0.09
R6345:Myo5a UTSW 9 75189913 missense possibly damaging 0.77
R6644:Myo5a UTSW 9 75146967 missense probably damaging 0.98
R6712:Myo5a UTSW 9 75212900 missense probably benign 0.12
R6838:Myo5a UTSW 9 75153883 critical splice donor site probably null
R6866:Myo5a UTSW 9 75140688 missense probably damaging 1.00
R6876:Myo5a UTSW 9 75160490 missense probably benign 0.04
R7108:Myo5a UTSW 9 75129992 missense probably damaging 1.00
R7159:Myo5a UTSW 9 75171563 missense probably benign 0.07
R7164:Myo5a UTSW 9 75180153 missense probably benign 0.00
R7219:Myo5a UTSW 9 75120770 missense probably damaging 1.00
R7497:Myo5a UTSW 9 75197701 missense
X0010:Myo5a UTSW 9 75185905 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock Embryos, Sperm, gDNA
Repository

none

Last Updated 2019-04-18 12:01 PM by Stephen Lyon
Record Created unknown
Record Posted 2007-12-26
Phenotypic Description
New gray was identified as a visible phenotype among ENU-induced G3 mutant mice. Homozygous new gray mice display a gray coat color and black eyes, as observed in concrete mutants. New gray mice exhibit normal resistance to mouse cytomegalovirus (MCMV) (MCMV Susceptibility and Resistance Screen) and to Listeria monocytogenes. Normal degranulation by natural killer (NK) cells from new gray mice is observed after antibody stimulation of NKp46 or Ly49H receptors, after exposure to YAC-1 cells, or after PMA/ionomycin stimulation.

 

Nature of Mutation
The new gray mutation mapped to Chromosome 9, and corresponds to a dinucleotide transition in adjacent nucleotides (GC to AT) at positions 1972 and 1973 of the Myo5a gene. The mutation occurs in exon 13 of 41 exons, and changes two codons such that two amino acids of the protein sequence are altered (M515, P516 to I515, S516).
 
1528 GATGAGGAATGTAAGATGCCTAAAGGCACAGATGAC
510  -D--E--E--C--K--M--P--K--G--T--D--D-
 
The mutated nucleotides are indicated in red lettering.
Protein Prediction
Figure 1. Domain structure of myosin Va.  The head domain contains the actin-binding and ATP-binding sites and generates force.  A central neck domain or light-chain binding domain contains six calmodulin binding IQ motifs.  The C-terminal half of myosin Va consists of the coiled coil (CC) segments responsible for myosin heavy chain dimerization and a globular tail domain (GTD) that mediates cargo binding.  The new gray mutation is a dinucleotide transition resulting in the substitution at positions 515 and 516 of methionine and proline to isoleucine and serine, respectively (red asterisk). This image is interactive. Click on the image to view other mutations found in Myo5a (red). Click on the mutations for more specific information.
Myosins are actin-based molecular motors for various cellular cargoes, producing mechanical force through repeated cycles of ATP hydrolysis. They are composed of one or two heavy chains and one to six light chains. First cloned from mouse in 1991, myosin Va is an 1853 amino acid myosin heavy chain (MHC) (Figure 1) (1). It shares extensive homology with other MHCs in the head or motor region (amino acids ~1-765), which includes the ATP- and actin-binding sites. Myosin Va contains a novel C-terminal tail domain, and thus was designated the first member of a new class (V) of MHC (1). Following the head domain is the neck domain, which contains six imperfect tandem IQ repeats (amino acids ~766-912) that bind to six calmodulin light chains. Together, two myosin Va heavy chains and six calmodulin light chains are now known to form myosin V (42). The C terminal half of myosin Va contains a region forming an α-helical coiled-coil sequence that mediates the dimerization of myosin Va heavy chains (amino acids~ 913-1420). The last ~400 C-terminal amino acids form the globular tail domain (GTD). The GTD both mediates binding to specific organelles, such as melanosomes, and serves as a negative regulator of motor activity by folding back and contacting residues in the head domain (43).
 
Extensive structural studies have been performed on myosin V, and a relatively detailed understanding of both its static and dynamic structures is available (2;3). The myosin ATP hydrolysis cycle and coupled structural changes that move it along an actin filament are depicted in Figure 2.
 
The new gray mutation results in the substitution of amino acids methionine 515 and proline 516 of myosin Va with isoleucine and serine, respectively.
Expression/Localization
Northern blot analysis detects Myo5a transcripts in most adult mouse tissues, including heart, skeletal muscle, testis, thymus, spleen and kidney, with very high expression in brain and skin (1). No Myo5a is detected in liver. Myo5a is subject to tissue-specific transcriptional regulation since several transcripts of different sizes are found in different tissues (1;4). The neuronal expression of Myo5a occurs both embryonically and in the adult, and is found throughout the brain (1). Immunolocalization of myosin Va confirms these data, and detects expression in both neuronal cell bodies and processes, but not in astrocytes (5) [although a recent report ascribes a role for myosin Va in myelination (6)]. Subcellularly, myosin Va is localized on melanosomes (7;8), and in the growth cones, specifically on actin filaments and the plasma membrane, of cultured superior cervical ganglion neurons (9).
Background
Melanins, the pigments for skin, hair and eyes, are synthesized in melanosomes. Visible pigmentation in mammals requires the transfer of melanosomes, from melanocytes where they are made, to keratinocytes. For this transfer to occur, melanosomes must first be accumulated at the distal ends of melanocyte dendrites, the site of exocytosis. Extensive study of three mouse coat color mutants (dilute, ashen and leaden) has greatly advanced the understanding of melanosome movement. This work demonstrated that melanosomes are transported in a bidirectional manner along microtubules, and their accumulation in the periphery depends on their capture and transfer, at the distal ends of dendrites, to actin filaments.
 
Mutation of the Myo5a gene results in the mouse phenotype dilute (d), first studied as a coat color mutant having light gray fur (10;11). The hair shafts of Myo5ad mice contain normal levels of melanin, but its distribution is irregular and is often found in clumps (10). In Myo5ad mice, melanosomes are synthesized normally, but cluster in the perinuclear region, resulting in uneven and impaired release of melanin (12;13). The ashen (ash) and leaden (ln) mice also have a light coat color, and exhibit exactly the same cellular phenotype as Myo5ad mice (7;12). The genes mutated in these three strains encode protein products that form a tripartite complex regulating the microtubule to actin filament transfer of melanosomes, a crucial step leading to melanosome exocytosis (Figure 3). Ashen encodes the small GTPase Rab27a (14) (mutated in concrete) and leaden encodes melanophilin (Mlph, also called Slac2-a; mutated in koala), which is thought to link melanosome-bound Rab27a to myosin Va (15). The tripartite complex forms on melanosomes after activation of Rab27a to its GTP-bound form, and mediates the transfer of melanosomes from a microtubule-based kinesin motor to the actin-based motor myosin Va (16-18). When this capture mechanism is lacking, as a result of mutations in any of these three proteins, melanosomes redistribute along microtubules, and appear clustered in regions with high microtubule density, which is greatest near the central cytoplasm (7;12;13). Although microtubule movement continues in mutant melanocytes, their failure to be captured prevents peripheral accumulation (7).
 
Of the hundreds of “dilute” mutations identified, many alleles confer, in addition to a coat color phenotype, a neurological phenotype as well. The dilute lethal (dl) and dilute opisthotonic (dop) mice exhibit opisthotonus, a convulsive arching of the head and neck (19). These convulsions become apparent at 9 days of age, and continue until death at approximately 3 weeks of age. The coat color and neurological phenotypes are genetically inseparable (20), and it is now known that they both result from mutations in Myo5a. The original Myo5ad (also called dilute viral, Myo5ad-v) mutation was shown to be caused by the insertion of an ecotropic murine leukemia virus (Emv-3) genome into the Myo5a gene; phenotypic revertants of Myo5ad result from viral excision (21;22). The insertion occurs within an intron of Myo5a in a region of the C-terminal tail domain that is differentially spliced into melanocyte-specific, but not neuronal-specific transcripts (4). As a result of the insertion, almost none of the normal transcripts are detected in RNA from skin cells, while some normal transcripts are found in brain RNA (4). The apparently sufficient amount of normal myosin Va in Myo5ad/d brains is postulated to account for the lack of neurological dysfunction in this strain. In contrast, dilute lethal alleles represent null mutations of Myo5a, which would necessarily result in the absence of neuronal Myo5a transcripts (23;24).
 
The basis for the neurological phenotype of dilute lethal mice remains incompletely understood. No gross anatomical deficiencies have been observed in dilute lethal mice or dilute opisthotonus (dop) rats (which also carry a null allele of Myo5a) (25). However, immunoelectron microscopic analysis of dendritic spines of dilute lethal Purkinje cells demonstrates that they lack smooth endoplasmic reticulum, an important intracellular Ca2+ store, and inositol-1,4,5-triphosphate (IP3) receptors, which trigger Ca2+ release from these stores (26;27). Notably, IP3 receptor mutant mice exhibit a similar neurological phenotype as dilute lethal mice, with tonic seizures and death by weaning age (28). Although basal synaptic transmission (from climbing and parallel fibers) is normal in dilute lethal mice, long-term depression (LTD) is impaired (27). LTD is thought to underlie motor learning in the cerebellum, and is reported to require IP3-mediated Ca2+ release. Consistent with this idea, IP3-mediated Ca2+ release from intracellular stores is significantly decreased in Purkinje cell dendritic spines of dilute lethal mice compared to wild type (29). Recent data also provide evidence that myelination of brain, optic nerve and spinal cord is impaired in dilute lethal mice, which may account for their neurological defects (6). These data suggest that multiple cellular mechanisms likely contribute to the severe neurological phenotype of dilute lethal mice.
 
 The diluted coat color phenotype of Rab27aash, Myo5ad and Mlphln mice can be rescued by the semi-dominant dilute suppressor (dsu) locus (30;31), which bears a mutation in the gene encoding melanoregulin (Mreg) (32). Mregdsu suppresses the coat color defect, but not the neurological or lethal effects of Myo5a-null alleles (i.e. dilute lethal and Myo5ad-l20J(23;31). Mregdsu does not suppress the diluted coat color of 14 other mutants which have mechanistically different causes for pigmentation defects, although it does suppress the ruby eye color of ruby-eye and ruby-eye-2 mice (33) (see records for stamper-coat, toffee, and dorian gray). The dsu locus has been demonstrated to function cell-autonomously in melanocytes; its protein product is not diffusible (34). Interestingly, Mregdsu modulates hair pigment through a myosin Va-independent pathway, as demonstrated by its inability to restore proper melanosome transport/localization in both Myo5ad/d and Myo5a-null melanocytes (32). Instead, Mregdsu alters the incorporation of pigment into hair, decreasing the normal spacing between bands of pigment in the hair (32). Mreg is a 214 amino acid vertebrate protein with no similarity to known motor proteins or transcription factors, and lacks any known functional domains (32). Thus, the mechanism by which it regulates pigment incorporation into hair is yet unknown. Recently, Mreg was shown to interact with peripherin-2, a tetraspanin protein regulating the formation of disk membranes, specialized organelles of photoreceptor rod cells (35).
 
In humans, mutations in MYO5A result in Griscelli syndrome type I (OMIM #214450), represented by partial albinism of the skin and hair and neurologic deficit, but without immunologic impairment or hemophagocytic syndrome characteristic of Griscelli syndrome type II (36;37) (OMIM #607624). Mutations in RAB27A cause Griscelli syndrome type II (37), but the normal immune function of patients with myosin Va and melanophilin mutations strongly supports the idea that the Rab27a/melanophilin/myosin Va complex is specific for melanosome transport and does not contribute to lytic granule transport in immune cells (38;39).
Putative Mechanism
The new gray mutation changes two amino acids in the head region of myosin Va, encoded by exons that are not alternatively spliced in brain versus skin. The alternatively spliced exons of Myo5a occur in the tail domain, with tissue-specific differential splicing of exons designated B, D and F (4). Thus, it is initially surprising that new gray mice exhibit no neurological defects, since both skin and brain myosin Va should be altered by the mutation. However, some dilute mice with mutations affecting all isoforms of myosin Va display only mild neurological phenotypes or neurological phenotypes that disappear with age, always together with a coat color phenotype (i.e. a neurological phenotype never occurs without a coat color phenotype) (40;41). Some of these dilute alleles (called dilute neurological, dn)) contain chemically-induced mutations in the head region (41), similar to new gray. One of these (Myo5a1MNURe), described by Huang et al, is P516S, identical to one of the two amino acid changes in new gray (41). This dn mutant has pigment dilution, but no neurological impairment. Northern and Western blot analysis determined that both RNA and protein levels are essentially unchanged from wild type levels (41). The primary structure of all myosin heads is highly conserved, and Huang et al modeled the position of P516 on the crystal structure for the chicken skeletal muscle conventional myosin II head. P516 is located in one of the regions believed to closely interact with the actin filament (41). This residue is conserved in about 85% of all known myosins. Huang et al hypothesize that the mild phenotype of Myo5a1MNURe suggests that the mutant protein is partially active (41). The apparently identical phenotypes of Myo5a1MNURe and Myo5anew gray suggest that the two-amino acid mutation in new gray also results in a protein that retains some function.
 
The reasons that coat color can be affected by myosin Va mutations, without obvious neurological effects remains unknown. Clearly the molecular interactors of myosin Va in the melanosome are not the same as those in neurons. Other neuron-specific actin-based motors or accessory proteins may be able to compensate for the loss of myosin Va function. Interestingly, some dn mutants exhibit neurological phenotypes at 1-3 weeks of age, but recover progressively and have apparently normal behavior by adulthood (41), suggesting that compensatory mechanisms exist which can overcome the developmental neurological deficits caused by certain Myo5a mutations.
Primers Primers cannot be located by automatic search.
Genotyping
New gray genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the dinucleotide change.
 
Primers for PCR amplification
New(F): 5’-GAATGAGCCCACTCAAGTACGTGTC-3’
New(R): 5’-TCACCATGCTTGCACAGGAGAC-3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               ∞
 
Primers for sequencing
New_seq(F): 5’- TAGGCAGATTGTCACTCACG-3’
New_seq(R): 5’- ATGCACTCCGAGATGTAGTATG-3’
 
The following sequence of 1111 nucleotides (from Genbank genomic region NC_000075 for linear DNA sequence of Myo5α) is amplified:
 
82117                                        gaat gagcccactc aagtacgtgt
82141 cttaaaaaca ggtaacaagt agtaaagttt ctggaaatgg caagaggaga cagactacca
82201 gttcatacct ttctgggtta tattaatatt ttactgtgta taaatgttac ttccatttag
82261 caatttaaaa aaataaagta tgcctaataa ttgtatttta tctttaactt gcaaagcctt
82321 tattgtatta aaaaattaaa tattgatgac tcctggtata ggcagattgt cactcacgtg
82381 ttgtaccggg tcaccccaag ccacaccctt ccttcattgg tggttagctt gtgtggatga
82441 gaataaagaa tgaattatta agttgaacat aggaactggt gtcttgttgc tgatgtcgca
82501 gaagaccttt agcactcagt catcacttca ctttcttttt tctccccaag atgcctaaag
82561 gcacagatga cacatgggcc caaaaactgt acaacacaca tttgaacaaa tgtgccctct
82621 ttgagaagcc ccgcatgtca aacaaagctt tcatcatcaa acattttgct gacaaagtaa
82681 ggaaactttt tgtctttttt tttccttttt ctgtaattta catcgaatta taataaaaat
82741 cagtagtcaa gtattggttg gtttgtttgt ttgtttgttt gtttgtttgt tttggcagca
82801 cttgcttcct ttaaagtcct ttcagggaaa gcagtcttca gtactgccat ctgggttttt
82861 tcccactgta acttgagttg attacatatt aagtaaatat gggtcaaaag tctttgtctg
82921 aaatgttgaa attcaagaaa ctgaaaacca aaagtgtttt cataacttgt ttagcaccca
82981 aacctaatct ctgacttgaa ctaacatgag atcgattcat aatttttagc ccaattgagg
83041 tgggtattta tgtgtttaag tatgaaaaat taatgtaatt tatggtatgc atgactttat
83101 taaacttttt ggtagtacta aaatggtgta tatacatact acatctcgga gtgcatgcat
83161 tacttctaaa ggcctcacag gtttcatacc agagactgga tttttgtctc ctgtgcaagc
83221 atggtga
 
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated G and C are shown in red text.
References
 19.  Searle, A. G. (1952) A lethal allele of dilute in the house mouse, Heredity 6, 395-401.
Science Writers Eva Marie Y. Moresco
Illustrators Diantha La Vine
AuthorsCeline Eidenschenk, Bruce Beutler
Edit History
2011-01-07 9:24 AM (current)
2010-08-27 10:01 AM
2010-08-10 1:51 PM
2010-07-01 10:10 AM
2010-07-01 9:34 AM
2010-07-01 9:14 AM
2010-07-01 8:42 AM
2010-07-01 8:42 AM
2010-05-12 8:42 AM
2010-05-11 1:18 PM
2010-05-11 1:17 PM
2010-05-11 1:13 PM
2010-01-18 12:00 AM