Phenotypic Mutation 'Carlsbad' (pdf version)
List |< first << previous [record 56 of 511] next >> last >|
AlleleCarlsbad
Mutation Type missense
Chromosome6
Coordinate71,334,101 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Cd8b1
Gene Name CD8 antigen, beta chain 1
Synonym(s) Ly-3, Ly-C, Lyt-3
Chromosomal Location 71,322,812-71,337,451 bp (+)
MGI Phenotype Animals homozygous for a mutation in this gene lack CD8+CD4- cytotoxic T cells in the thymus and spleen and do not mount a cytotoxic response to alloantigens.
Accession Number

NCBI RefSeq: NM_009858; MGI:88347

Mapped Yes 
Amino Acid Change Arginine changed to Glycine
Institutional SourceBeutler Lab
Gene Model predicted sequence gene model
PDB Structure
Crystal structure of a CD8ab heterodimer [X-RAY DIFFRACTION]
Crystal structure of CD8alpha-beta in complex with YTS 156.7 FAB [X-RAY DIFFRACTION]
Crystal structure of the CD8 alpha beta/H-2Dd complex [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000070131
Gene: ENSMUSG00000053044
AA Change: R202G

DomainStartEndE-ValueType
IGv 36 119 2.33e-13 SMART
low complexity region 141 156 N/A INTRINSIC
transmembrane domain 177 199 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
(Using ENSMUST00000065248)
Phenotypic Category decrease in CD8+ T cells in CD3+ T cells, increase in CD4:CD8, increase in CD4+ T cells in CD3+ T cells, T-dependent humoral response defect- increased antibody response to rSFV
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(6) : Spontaneous (1) Targeted(3) Transgenic (2)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Cd8b1 APN 6 71332479 nonsense probably null 0.00
3-1:Cd8b1 UTSW 6 71326262 missense probably damaging 1.00
R1707:Cd8b1 UTSW 6 71326184 missense probably damaging 1.00
R2438:Cd8b1 UTSW 6 71329756 missense probably damaging 0.96
R2566:Cd8b1 UTSW 6 71334084 splice acceptor site probably benign
R2860:Cd8b1 UTSW 6 71334101 missense probably damaging 1.00
R4405:Cd8b1 UTSW 6 71326022 missense possibly damaging 0.90
R4583:Cd8b1 UTSW 6 71326097 missense probably damaging 1.00
R4611:Cd8b1 UTSW 6 71332475 missense probably benign 0.00
R4657:Cd8b1 UTSW 6 71329774 missense possibly damaging 0.77
R5604:Cd8b1 UTSW 6 71326175 missense probably benign 0.00
R5604_K:Cd8b1 UTSW 6 71326175 missense probably benign 0.00
R5604_Q:Cd8b1 UTSW 6 71326175 missense probably benign 0.00
Mode of Inheritance Autosomal Semidominant
Local Stock
Repository
Last Updated 12/30/2016 2:41 PM by Katherine Timer
Record Created 12/21/2015 11:51 AM
Record Posted 11/09/2016
Phenotypic Description

Figure 1. Carlsbad mice exhibit increased CD4 to CD8 T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Carlsbad mice exhibit reduced frequencies of CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Carlsbad mice exhibit increased frequencies of CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Homozygous riogrande mice exhibit increased T-dependent IgG responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Carlsbad phenotype was identified among G3 mice of the pedigree R2860, some of which showed an increase in the CD4+ to CD8+ T cell ratio (Figure 1) caused by a diminished frequency of CD8+ T cells in CD3+ T cells (Figure 2) coupled with an increase in the frequency of CD4+ T cells in CD3+ T cells (Figure 3), all in the peripheral blood. Also, the T-dependent antibody response to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal) was increased in the Carlsbad mice (Figure 4).

Nature of Mutation
Figure 5. Linkage mapping of the reduced CD4 to CD8 T cell ratio using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 45 mutations (X-axis) identified in the G1 male of pedigree R2860. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 45 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Cd8b1: an A to G transition at base pair 71,334,101 (v38) on chromosome 6, or base pair 11,290 in the GenBank genomic region NC_000072 encoding Cd8b1. The strongest association was found with an additive model of linkage to the normalized CD4:CD8 ratio, wherein four variant homozygotes and 15 heterozygotes departed phenotypically from five homozygous reference mice with a P value of 1.124 x 10-5 (Figure 5).

 

The mutation corresponds to residue 649 in the mRNA sequence NM_009858 within exon 5 of 6 total exons.

 
634 TACTGTGTGCGGAGGAGAGCCCGAATTCACTTC

197 -Y--C--V--R--R--R--A--R--I--H--F-

 

The mutated nucleotide is indicated in red. The mutation results in an arginine (R) to glycine (G) substitution at position 202 (R202G) in the CD8β protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.996) (1).

Protein Prediction
Figure 6. Domain structure of CD8β. The extracellular region of CD8β has an IgV domain. The Carlsbad mutation results in an arginine (R) to glycine (G) substitution at position 202 (R202G). Abbreviations: SP, signal peptide; Trans, transmembrane domain.
Figure 7. Crystal structure of the CD8αβ Ig-like domains in complex with the extracellular region of H-2Dd (yellow), β2m (gray), and a bound 10 amino acid peptide (not shown). CD8β (orange) is proximal to the T cell membrane; CD8α (green) is distal. Model is based on PDB 3DMM, Wang et al. J. Immunol. 183, 2554-2564 (2009). Click on the 3D structure to view it rotate.

CD8β (also known as Lyt-3) is a 213-amino acid single pass type I transmembrane glycoprotein of the immunoglobulin (Ig) superfamily (Figure 6) (2). CD8β heterodimerizes with CD8α (also known as Lyt-2; see the record for alfalfa) to form CD8αβ, which functions as a coreceptor for the T cell receptor (TCR) [reviewed in (3)]. CD8β requires an association with CD8α to translocate to the cell surface; unassociated CD8β is retained in the endoplasmic reticulum and degraded (4-6). Human CD8β, but not mouse CD8β, can form a CD8ββ homodimer (7). The lack of CD8ββ homodimers in the mouse is attributed to the Ig domain found in mouse, but not human, CD8β. The CD8ββ could not bind MHC class I.

 

The extracellular domain of CD8β increases the avidity of CD8 binding to MHC I (8). The intracellular domain of CD8β promotes the association with Lck and LAT, two proteins required for TCR signal transduction, as well as (9). The intracellular and extracellular domains of CD8β can both independently promote CD8+ T cell development, but both domains together is most efficient (8;9).

 

Connecting the Ig-like domain to the transmembrane domain is the stalk region of CD8β. The stalk region of CD8β is essential for selection of CD8+ class I MHC-restricted T cells as well as the response of peripheral T cells; the stalk region is not required for expression of CD8β on the cell surface (10). The stalk region enhances the coreceptor function of CD8, making the CD8αβ heterodimer a better coreceptor than CD8αα (11). The stalk region is heavily O-glycosylated. O-glycosylation of CD8β is developmentally regulated such that immature double positive thymocytes display lower levels than mature thymocytes (12-15). This relative difference influences thymocyte selection in that decreased levels of CD8β O-glycosylation in immature thymocytes correlate with increased affinity for pMHC I; the enhanced CD8-pMHCI binding promotes elimination of autoreactive T cells in the thymus (12;15). In contrast, higher levels of O-glycosylation in mature T cells reduce CD8 affinity for pMHCI, thereby requiring stronger TCR-pMHCI binding for T cell activation. The structural mechanism by which O-glycosylation alters CD8 affinity for pMHCI is unknown (16); in published 3D crystal structures the stalk region has been disordered. O-glycosylation has been reported to increase the rigidity of polypeptides, as observed in mucins, and may limit the mobility of the Ig-like domains of CD8αα and CD8αβ [reviewed in (3)]. O-glycosylation of CD8α does not appear to be developmentally regulated (14)

 

CD8α and CD8β share approximately 20% homology within the Ig domains. The crystal structure of the Ig-like domains of mouse CD8αβ [Figure 7; PDB:2ATP; (17)] resembles the variable domain fragment (Fv) of an antibody, with each chain adopting a V-set type Ig fold (17;18); this structure is similar to that of the Ig-like domains in the CD8αα dimer (19;20). The two chains of both dimers have similar conformations, including a disulfide bond between the B and F β-strands, and a tryptophan on the C strand. 

 

Palmitoylation of CD8β promotes the segregation of CD8 into lipid rafts, a critical step in facilitating the function of CD8 as a coreceptor with the TCR (21). Furthermore, CD8β directly associates with CD3δ to facilitate the trafficking of the TCR into lipid rafts (22).

 

Either CD4 (see thoth) or CD8 and the TCR (αβ unless otherwise indicated) mediate T cell recognition of antigen-MHC complexes on the surface of antigen presenting cells. Expression of CD4 versus CD8αβ by a given T cell restricts TCR recognition of peptides to those bound to either MHCII or MHCI, respectively. CD4 and CD8αβ contact a conserved membrane-proximal region of their MHC target to enforce MHC class restriction. The molecular details of the interaction between CD8αβ with the peptide-MHCI complex (pMHCI) have been investigated by X-ray crystallography (18;20;23). The 3D structures revealed that the extracellular Ig-like domain of both the CD8αβ and the CD8αα dimers contact the α3 domain of the MHC I heavy chain, whereas CD8αα additionally contacts the α2 domain and β2-microglobulin. Three complementarity-determining regions (CDRs), consisting of the BC loop (CDR1), the C’C” loop (CDR2), and the FG loop (CDR3), are involved in binding to the α3 domain of pMHCI. Residues in the CDR1 (Lys23), CDR2 (Lys55), and CDR3 (Val99, Ser101, and Lys103) loops of CD8β decreased MHC I binding and T cell activation (24). The CD8β subunit of CD8αβ is positioned next to the T cell membrane, while the CD8α subunit is distal from the T cell and close to the C-terminus of the MHCI α3 domain. Differences exist between the CD8αα/pMHCI interface and the CD8αβ/pMHCI interface despite the fact that overall conformations are quite similar. Importantly, nearly all MHCI residues making key contacts with CD8αα and CD8αβ are non-polymorphic; thus CD8αα and CD8αβ bind to different MHCI alleles with only subtly different affinities (25;26). However, reports suggest that CD8αβ is a more effective coreceptor than CD8αα in enhancing the range and sensitivity to peptide antigens and alloantigens recognized by TCRs (27-30). The stalk or intracellular region of CD8β may facilitate a configuration that promotes this augmented function (30-33).

 

Human CD8B has several alternatively spliced variants that encode differerent cytoplasmic tails (M-1, M-2, M-3, M-4); mouse Cd8b1 does not encode multiple transcripts (34). In total CD8+ T cells, the expression level of the M-1 vairant was the highest and the M-3 variant was the lowest. The M-4 isoform was the highest expressed variant in effector memory CD8+ T cells. After CD8+ T cell stimulation, the expression level of the M-2 variant increased 10 to 20 fold relative to resting cells in contrast to the other isoforms.

 

The mutation results in an arginine (R) to glycine (G) substitution at position 202 (R202G); residue 202 is within the cytoplasmic domain.

Expression/Localization

CD8αβ is expressed primarily on TCRαβ+ thymocytes and peripheral cytotoxic T cells (35;36); the cell surface expression of CD8β requires association with CD8α (37;38).

Background
Figure 8. TCR signaling pathway. Together with CD4 or CD8 (depicted here), TCRs are responsible for the recognition of major histocompatibility complex (MHC) class II and I, respectively, as well as other antigens found on the surface of antigen presenting cells (APCs).  Binding of these ligands to the TCR, and CD4/8 engagement of MHC, initiates signaling and T cell activation. The TCR is composed of two separate peptide chains (TCRα/β), and is complexed with a CD3 heterodimer (CD3εγ or CD3εδ) and a ζ homodimer. One of the first steps in TCR signaling is the recruitment of the tyrosine kinases Lck and Fyn to the receptor complex. Lck and Fyn are regulated by the phosphorylation of two key tyrosine residues, an activating tyrosine located in the activation loop, and an inhibitory tyrosine located in the C-terminal tail.  CD45 dephosphorylates the C-terminal inhibitory tyrosine, thereby promoting the activation of Lck and Fyn. Once activated, they phosphorylate ITAMS present on the CD3 and ζ chains. Phosphorylation of the ITAM motifs results in recruitment of ZAP-70 and Syk, which trans- and auto-phosphorylate to form binding sites for SH2 domain- and protein tyrosine binding domain-containing proteins. The Syk family kinases phosphorylate LAT and SLP-76. LAT binds to the adaptor proteins growth factor receptor-bound 2(Grb2), Src homologous and collagen (Shc) and GRB2-related adaptor downstream of Shc (Gads), as well as phosphatidylinositol 3-kinase (PI3K) and PLC-γ1.  SLP-76 is then recruited to the complex via Gads and binds the guanine nucleotide exchange factor Vav1, Nck (non-catalytic region of tyrosine kinase adaptor protein), IL-2-induced tyrosine kinase (Itk), PLC-γ1, adhesion and degranulation-promoting adaptor protein (ADAP), and hematopoietic progenitor kinase 1 (HPK1).  This proximal signaling complex is required for PLC-γ1-dependent pathways including calcium (Ca2+) mobilization and diacylglycerol (DAG)-induced responses, cytoskeleton rearrangements, and integrin activation pathways.  Activated PLC-γ1 hydrolyzes the membrane lipid phosphatidylinositol-3,4-diphosphate (PIP2) to inositol-1,4,5-trisphosphate (IP3) and DAG resulting in Ca2+-dependent signal transduction including activation of nuclear factor of activated T cells (NF-AT), and activation of protein kinase Cθ and Ras, respectively.  PKCθ regulates nuclear factor-κB (NF-κB) activation via the trimolecular complex composed of Bcl10, mucosa-associated lymphoid tissue translocation gene 1 (MALT1), and caspase recruitment domain family, member 11 (CARMA1). Ras initiates a mitogen-associated protein kinase (MAPK) phosphorylation cascade culminating in the activation of various transcription factors. The image is interactive; click to view mutations associated with the TCR signaling pathway.

T cells become activated when the TCR engages a peptide antigen in complex with an MHC molecule on the surface of a target or antigen-presenting cell. However, TCR-pMHC interaction is not by itself sufficient to induce an effective T cell response. Rather, engagement of pMHC by the TCR and either the CD4 or CD8 coreceptor is necessary for optimal T cell stimulation (39;40). For cytotoxic T cells, the interaction of CD8 with MCHI enhances the antigen sensitivity and response of the T cells to pMHC ligands (41). CD8 contacts invariant sites on the membrane-proximal region of the MHCI molecule in the context of the composite pMHCI complex. These sites are distinct and physically distant from the sites bound by the TCR, permitting both coreceptor and TCR to bind the same pMHCI complex (20). Absent CD8-pMHCI interaction, MHC class I-restricted immune responses including cytokine production and cytotoxic effector function are impaired (39;40). However, high-affinity pMHC/TCR interactions can in some cases compensate for a lack of CD8 engagement in terms of Lck activation, T cell proliferation, and cytotoxic T lymphocyte (CTL) activity (42). Discussed here is the TCR coreceptor function of the CD8αβ heterodimer.

 

For an in-depth discussion on the function of the CD8αβ heterodimer, please see the record for alfalfa.

 

Rather than physically promoting initial TCR-pMHCI binding, the major function of CD8αβ is to recruit the kinase Lck to the TCR-MHC interaction site where it can phosphorylate immunoreceptor tyrosine-based activation motifs (ITAMs) on the cytoplasmic tails of associated CD3 proteins (see tumormouse, a mutation of Cd3e, and allia, a mutation of Cd247) (43;44). Their phosphorylation recruits and activates other proteins including ZAP-70 (ζ-chain-associated protein of 70 kDa; see murdock), SLP-76 (SH2 domain-containing leukocyte protein of 76 kDa), and LAT (linker for activation of T cells) necessary for signaling leading to T cell activation, proliferation, and differentiation (Figure 8; also see iconoclast for a description of TCR signaling). The CD8-pMHCI interaction synergistically stabilizes TCR-pMHCI interactions (45). However, it has also been reported that CD8αβ can play a critical role in promoting TCR-pMHCI binding, particularly for multimeric low-affinity pMHCI ligands (46;47).

Putative Mechanism
Figure 9. Thymocyte differentiation. CD4+ and CD8+ T cells expressing αβ TCRs begin their development as double negative CD4-CD8- precursor thymocytes in the capsule of the thymus.  After TCRβ rearrangement, progression to the double positive CD4+CD8+ stage, and TCRα rearrangement (in the cortex of the thymus), the yet immature TCRαβ+CD4+CD8+ thymocytes are then subject to positive or negative selection to generate mature CD4+ helper T cells and CD8+ cytotoxic T cells in the medulla of the thymus.

TCR signaling is necessary for both adaptive immune responses and for thymocyte differentiation (Figure 9). CD8αβ is required for both positive and negative selection of double positive cells in the thymus (48-50). Cd8b1-deficient mice exhibited a five-fold reduction in the numbers of CD8+ T cells in the thymus and the periphery; the CD8+ T cells that remained had normal cytotoxic T lymphocyte activity (48-51). CD8α expression on thymocytes and peripheral T cells was reduced compared to that in wild-type mice (51). The population size and CD8α expression was normal in intraepithelial lymphocytes from the Cd8b1-deficient mice due to the predominant expression of CD8αα homodimers on these cells (51). Peripheral T cells from the Cd8b1-deficient mice did not exhibit defective cytotoxic activity against lymphocytic choriomeningitis virus or vesicular stomatitis virus (51-53). The phenotype of the Carlsbad mice indicates loss of CD8β function.

Primers PCR Primer
Carlsbad(F):5'- AGTTTCCACCCACGTGAGATG -3'
Carlsbad(R):5'- TGAGGATGACTGGGAACTTCC -3'

Sequencing Primer
Carlsbad_seq(F):5'- GCTATTAGAATCATGGAATGGATGAC -3'
Carlsbad_seq(R):5'- GTCCTGGAACTCACTATGTAGAC -3'
References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsMing Zeng, Xue Zhong, and Bruce Beutler
List |< first << previous [record 56 of 511] next >> last >|