Phenotypic Mutation 'nidoking' (pdf version)
Allelenidoking
Mutation Type missense
Chromosome15
Coordinate94,403,445 bp (GRCm38)
Base Change C ⇒ T (forward strand)
Gene Adamts20
Gene Name a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 20
Synonym(s) ADAMTS-20, bt
Chromosomal Location 94,270,163-94,465,418 bp (-)
MGI Phenotype Homozygous mutants have a white belt across the back in the midtrunk region and a white belly patch that coalesces to form a white belt.
Accession Number

NCBI RefSeq: NM_177431 (variant 1), NM_001164785 (variant 2), NM_001164786 (variant 3); MGI: 2260628

Mapped Yes 
Amino Acid Change Arginine changed to Histidine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000036330] [ENSMUSP00000121696]
SMART Domains Protein: ENSMUSP00000036330
Gene: ENSMUSG00000022449
AA Change: R66H

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Pep_M12B_propep 41 186 1.4e-30 PFAM
Pfam:Reprolysin_5 253 445 3.6e-13 PFAM
Pfam:Reprolysin_4 253 460 1.1e-7 PFAM
Pfam:Reprolysin 255 464 1.5e-26 PFAM
Pfam:Reprolysin_2 272 454 1.8e-10 PFAM
Pfam:Reprolysin_3 276 410 5.8e-10 PFAM
TSP1 556 608 7.73e-11 SMART
Pfam:ADAM_spacer1 718 836 2.6e-34 PFAM
TSP1 846 901 1.47e-1 SMART
TSP1 904 958 2.83e0 SMART
TSP1 965 1019 4.28e-4 SMART
TSP1 1020 1074 1.89e-5 SMART
TSP1 1075 1131 4.87e-8 SMART
TSP1 1152 1201 6.05e-4 SMART
TSP1 1204 1260 1.22e-8 SMART
TSP1 1304 1356 1.37e-2 SMART
TSP1 1357 1411 6e-8 SMART
TSP1 1416 1470 1.69e-2 SMART
TSP1 1471 1526 2.3e0 SMART
TSP1 1530 1579 1.23e0 SMART
TSP1 1653 1706 5.27e-4 SMART
Pfam:GON 1708 1905 5.8e-80 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
(Using ENSMUST00000035342)
SMART Domains Protein: ENSMUSP00000121696
Gene: ENSMUSG00000022449
AA Change: R66H

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Pep_M12B_propep 40 186 1e-31 PFAM
Pfam:Reprolysin_5 253 445 2.7e-13 PFAM
Pfam:Reprolysin_4 253 460 7.2e-8 PFAM
Pfam:Reprolysin 255 464 2.4e-28 PFAM
Pfam:Reprolysin_2 272 454 4e-10 PFAM
Pfam:Reprolysin_3 276 410 1.1e-10 PFAM
TSP1 556 608 7.73e-11 SMART
Pfam:ADAM_spacer1 718 836 2e-34 PFAM
TSP1 846 901 1.47e-1 SMART
TSP1 904 958 2.83e0 SMART
TSP1 965 1019 4.28e-4 SMART
TSP1 1020 1074 1.89e-5 SMART
TSP1 1075 1131 4.87e-8 SMART
TSP1 1152 1201 6.05e-4 SMART
TSP1 1204 1260 1.22e-8 SMART
TSP1 1304 1356 1.37e-2 SMART
TSP1 1357 1411 6e-8 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
(Using ENSMUST00000155907)
Phenotypic Category pigmentation, skin/coat/nails
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(23) : Chemically induced (ENU)(8) Radiation induced(2) Spontaneous(12) Targeted(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Adamts20 APN 15 94394641 missense probably benign
IGL00491:Adamts20 APN 15 94273232 missense possibly damaging 0.89
IGL00502:Adamts20 APN 15 94403397 missense probably damaging 0.99
IGL00672:Adamts20 APN 15 94341105 missense probably damaging 0.99
IGL00840:Adamts20 APN 15 94282482 missense probably damaging 1.00
IGL00909:Adamts20 APN 15 94379813 missense probably damaging 1.00
IGL01101:Adamts20 APN 15 94344042 missense probably damaging 1.00
IGL01137:Adamts20 APN 15 94394611 unclassified probably null
IGL01457:Adamts20 APN 15 94331448 missense probably damaging 0.97
IGL01685:Adamts20 APN 15 94403446 missense possibly damaging 0.81
IGL01949:Adamts20 APN 15 94326106 missense probably benign 0.08
IGL02525:Adamts20 APN 15 94283078 unclassified probably null
IGL03088:Adamts20 APN 15 94329914 unclassified probably null
IGL03175:Adamts20 APN 15 94273255 nonsense probably null
belt UTSW 15 94345990 missense probably damaging 1.00
buckeye UTSW 15 94341087 missense probably damaging 1.00
jack_white UTSW 15 unclassified
meowth UTSW 15 94331458 missense probably damaging 1.00
panda UTSW 15 94326699 nonsense
pikachu UTSW 15 94345990 missense probably damaging 1.00
poliwag UTSW 15 94394622 nonsense
splotch2 UTSW 15 94335561 splice acceptor site
Wash UTSW 15 94347670 nonsense
whitebelly UTSW 15 unclassified
R0483:Adamts20 UTSW 15 94353571 missense probably benign 0.00
R0514:Adamts20 UTSW 15 94270376 missense probably damaging 1.00
R0568:Adamts20 UTSW 15 94291713 splice acceptor site probably benign
R0730:Adamts20 UTSW 15 94347690 missense probably benign 0.00
R0973:Adamts20 UTSW 15 94286371 missense probably benign 0.00
R1339:Adamts20 UTSW 15 94322896 missense probably benign 0.19
R1691:Adamts20 UTSW 15 94403565 splice acceptor site noncoding transcript
R1721:Adamts20 UTSW 15 94338459 missense probably benign 0.44
R1832:Adamts20 UTSW 15 94286344 missense probably benign 0.00
R1846:Adamts20 UTSW 15 94345990 missense probably damaging 1.00
R1867:Adamts20 UTSW 15 94338459 missense probably benign 0.44
R1875:Adamts20 UTSW 15 94331396 missense probably benign 0.01
R1930:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R1931:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R1932:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R2001:Adamts20 UTSW 15 94347718 missense possibly damaging 0.96
R2068:Adamts20 UTSW 15 94282458 splice donor site
R2116:Adamts20 UTSW 15 94355362 missense probably damaging 1.00
R2162:Adamts20 UTSW 15 94331458 missense probably damaging 1.00
R2331:Adamts20 UTSW 15 94283087 splice acceptor site
R2350:Adamts20 UTSW 15 94283916 missense probably damaging 1.00
R2484:Adamts20 UTSW 15 94403360 missense silent
R2887:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R2889:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R2890:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R3109:Adamts20 UTSW 15 94345904 splice site unknown
R3719:Adamts20 UTSW 15 94361838 missense probably damaging 0.99
R3832:Adamts20 UTSW 15 94331458 missense probably damaging 1.00
R3901:Adamts20 UTSW 15 94328845 missense possibly damaging 0.81
R4398:Adamts20 UTSW 15 94333695 missense possibly damaging 0.93
R4402:Adamts20 UTSW 15 94379946 missense probably benign
R4431:Adamts20 UTSW 15 94344043 missense probably damaging 1.00
R4479:Adamts20 UTSW 15 94403445 missense probably damaging 1.00
R4482:Adamts20 UTSW 15 94345920 missense probably damaging 1.00
R4503:Adamts20 UTSW 15 94379750 missense probably damaging 0.99
R4671:Adamts20 UTSW 15 94403325 missense possibly damaging 0.48
R4700:Adamts20 UTSW 15 94394622 nonsense probably null
R4707:Adamts20 UTSW 15 94333647 missense possibly damaging 0.53
R4725:Adamts20 UTSW 15 94351762 missense probably damaging 0.99
R4771:Adamts20 UTSW 15 94351635 synonymous probably null
R4829:Adamts20 UTSW 15 94326396 missense probably benign 0.01
R4937:Adamts20 UTSW 15 94379775 missense probably benign
R4960:Adamts20 UTSW 15 94379774 missense probably benign
R5270:Adamts20 UTSW 15 94282519 missense probably benign 0.00
R5388:Adamts20 UTSW 15 94345778 missense possibly damaging 0.81
R5410:Adamts20 UTSW 15 94281957 missense possibly damaging 0.94
R5453:Adamts20 UTSW 15 94326088 missense possibly damaging 0.69
R5611:Adamts20 UTSW 15 94273280 missense possibly damaging 0.65
R5687:Adamts20 UTSW 15 94325971 missense probably benign 0.36
R5758:Adamts20 UTSW 15 94394650 missense probably benign 0.00
R5801:Adamts20 UTSW 15 94347670 nonsense probably null
R5834:Adamts20 UTSW 15 94353584 missense probably damaging 0.99
R5993:Adamts20 UTSW 15 94338723 missense probably damaging 0.99
R5997:Adamts20 UTSW 15 94379747 missense probably damaging 1.00
R6044:Adamts20 UTSW 15 94282483 missense probably damaging 1.00
R6058:Adamts20 UTSW 15 94330047 nonsense probably null
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 09/16/2016 12:57 PM by Katherine Timer
Record Created 12/31/2015 7:42 AM by Carlos Reyna
Record Posted 08/22/2016
Phenotypic Description
Figure 1. The nidoking mice (top) exhibit variable belting.

The nidoking phenotype was identified among N-ethyl-N-nitrosourea (ENU)-induced G3 mice of the pedigree R4479, some of which exhibited a variable belted phenotype (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the pigmentation phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 34 mutations (X-axis) identified in the G1 male of pedigree R4479. Binary phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 34 mutations.The pigmentation phenotype was linked to a mutation in Adamts20: a G to A transition at base pair 94,403,445 (v38) on chromosome 15, or base pair 61,983 in the GenBank genomic region NC_000081. Linkage was found with a recessive model of inheritance (P = 4.413 x 10-12), wherein 10 affected mice were homozygous for the variant allele, and 55 unaffected mice were either heterozygous (N = 38) or homozygous for the reference allele (N = 17) (Figure 2).
 
The mutation corresponds to residue 458 in the mRNA sequence NM_177431 (isoform 1) within exon 2 of 39 total exons and residue 458 in the mRNA sequence NM_00164785 (isoform 2) within exon 2 of 28 total exons. 
 

61967 TTCAGCCGGAAGAAACGTAGCTCCGGGGTGCCG

61    -F--S--R--K--K--R--S--S--G--V--P-

 

Genomic numbering corresponds to NC_000081. The mutated nucleotide is indicated in red. The mutation results in an arginine (R) to histidine (H) substitution at position 66 (R66H) in both ADAMTS-20 protein variants.

Protein Prediction

Figure 3. Domain structure of ADAMTS-20. The nidoking mutation is an arginine to histidine substitution at position 66 (R66H). Abbreviations: SP, Signal peptide; MP, Metalloprotease; DL, Disintegrin-like; CRR, Cystein-rich region. TSP-type domains are yellow and numbered. Click on the image to view other mutations found in ADAMTS-20. Click on each mutation for more specific information.

ADAMTS-20 is a 1,906 amino acid protein of the large family of secreted zinc-dependent metalloproteases known as the ADAMTS (a disintegrin and metalloprotease domain, with thrombospondin type-1 repeats) family (Figure 3). ADAMTS-20 has an N-terminal signal peptide and a propeptide domain which contains three conserved Cys residues and ends in a basic region (aa 246-259). Following the prodomain, ADAMTS-20 contains the zinc-coordinating catalytic sequence HELGHVFNVPHD (aa 399-410) that is closely related to sequences found in metalloproteases. The catalytic domain of ADAMTS-20 is followed by a disintegrin-like domain similar in size and structure amongst all ADAMTS proteins (76 residues) and includes eight conserved Cys residues. The disintegrin domain precedes a single thrombospondin type I repeat (TSP1) which is well-conserved and similar to a domain in Thrombospondin I. The first TSP1 repeat is followed by a cysteine (Cys)-rich domain that has ten conserved Cys residues as well as a spacer characteristic of ADAMTS family members. The spacer domain contains a putative sequence for glycosaminoglycan attachment and may be important in substrate recognition and ECM association (1;2). C-terminal to the spacer region, ADAMTS proteins have a highly variable number of TSP1 repeats. The full-length ADAMTS-20 protein contains fourteen of these motifs with linker sequences between the fifth and sixth repeat and the seventh and eighth repeat. The smaller splice variant for mouse ADAMTS-20 contains nine instead of 14 TSP1 motifs at the C-terminal domain while the human splice variant contains 11 instead of 14 TSP1 domains (1;3-5). The nidoking mutation results in an arginine (R) to histidine (H) substitution at position 66 (R66H) within the propeptide domain of both splice variants. The propeptide domain is a putative protein-convertase recognition site to generate mature enzyme.

 

Please see the record for splotch2 for more information about Adamts20.

Putative Mechanism

The ADAMTS proteins are predicted to interact with the extracellular matrix (ECM) and play a wide role in normal and pathological processes (1;3). White-spotting mutants are often the result of improper melanoblast development or survival. The lack of pigment in the adult reflects the absence of mature melanocytes in that area due to defects at various stages of melanocyte development including proliferation, survival, migration, invasion of the integument, hair follicle entry, and melanocyte stem cell renewal (6;7). Adamts20 is the gene mutated in belted and splotch2 mutant mice. Belted animals exhibit a mostly pigmented coat except for a region near the hindlimbs that resembles a belt (8). At least fifteen different belted alleles are in existence and four of these, including splotch2, have been sequenced. Two of the three previously described mutations result in single amino acid changes either in the Cys-rich domain or one of the C-terminal TSP1 repeats. The third mutation generates a premature stop codon, resulting in truncation of the protein and loss of eight C-terminal TSP1 domains. Deficient ADAMTS-20 activity may cause loss of melanoblast entry into the hair follicles (3). ADAMTS-20 may degrade specific peptide substrates, either ECM components or signaling molecules, and this degradation could be necessary for melanoblast migration to the proper areas. Examination of ADAMTS-20 function during melanoblast development determined that mice with mutations in Adamts20 had a normal distribution of melanoblasts during embryogenesis suggesting that melanoblast migration is normal in these animals. The phenotype of the nidoking mice resembles those of other Adamts20 alleles indicating that the mutation results in impaired ADAMTS-20 function.

Primers PCR Primer
nidoking(F):5'- TAGAAACAGTGGCGCAGGTC -3'
nidoking(R):5'- TGAGACTGACCAAAACTGGG -3'

Sequencing Primer
nidoking_seq(F):5'- AGGTCTGGGGACTCCGTG -3'
nidoking_seq(R):5'- GGTAGGGATGCTTGGCTCAAGAG -3'
References

1. Tang, B. L. (2001) ADAMTS: A Novel Family of Extracellular Matrix Proteases. Int J Biochem Cell Biol. 33, 33-44.

  8. Murray, J. M., and Snell, G. D. (1945) Belted, A New 6Th Chromosome Mutation in the Mouse. J Hered. 36, 266-268.
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsCarlos Reyna, Jamie Russell, and Bruce Beutler