Phenotypic Mutation 'ekans' (pdf version)
Alleleekans
Mutation Type splice site
Chromosome15
Coordinate78,459,427 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Tmprss6
Gene Name transmembrane serine protease 6
Synonym(s) matriptase-2, 1300008A22Rik
Chromosomal Location 78,439,667-78,468,634 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II transmembrane serine proteinase that is found attached to the cell surface. The encoded protein may be involved in matrix remodeling processes in the liver. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygosity for an inactivating mutation of this gene results in hair loss over the entire body except the face, microcytic anemia and female infertility, all reversible by dietary iron supplementation. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_027902; MGI:1919003

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000017086 ] [ENSMUSP00000155414] [ENSMUSP00000155355 ] [ENSMUSP00000155549 ] [ENSMUSP00000155401 ]   † probably from a misspliced transcript
SMART Domains Protein: ENSMUSP00000017086
Gene: ENSMUSG00000016942

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
Pfam:SEA 88 191 3.2e-13 PFAM
CUB 341 452 3.82e-2 SMART
LDLa 457 489 1.33e-2 SMART
LDLa 490 527 2.31e-9 SMART
LDLa 530 568 1.07e-4 SMART
Tryp_SPc 576 806 3.75e-97 SMART
Predicted Effect probably null
Predicted Effect probably benign
Predicted Effect probably null
Predicted Effect probably null
Predicted Effect probably null
Meta Mutation Damage Score 0.606 question?
Is this an essential gene? Probably nonessential (E-score: 0.105) question?
Phenotypic Category
Phenotypequestion? Literature verified References
FACS T cells - decreased
skin/coat/nails 18523150 23300183
Candidate Explorer Status CE: excellent candidate; human score: 0; ML prob: 0.682
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(13) : Chemically induced (ENU)(3) Gene trapped(2) Radiation induced(2) Targeted(6)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Tmprss6 APN 15 78442434 missense probably null 1.00
IGL02474:Tmprss6 APN 15 78442336 missense probably damaging 0.99
cubone UTSW 15 78446657 splice site probably null
mask UTSW 15 78464455 intron probably benign
masquerade UTSW 15 78468000 intron probably benign
zorro UTSW 15 78464552 intron probably benign
PIT1430001:Tmprss6 UTSW 15 78440627 missense probably damaging 1.00
R0285:Tmprss6 UTSW 15 78452868 missense probably damaging 0.99
R1857:Tmprss6 UTSW 15 78452552 missense probably damaging 1.00
R2432:Tmprss6 UTSW 15 78465104 splice site probably benign
R4192:Tmprss6 UTSW 15 78446657 splice site probably null
R4226:Tmprss6 UTSW 15 78446699 missense probably damaging 1.00
R4227:Tmprss6 UTSW 15 78446699 missense probably damaging 1.00
R4334:Tmprss6 UTSW 15 78459427 splice site probably null
R4344:Tmprss6 UTSW 15 78459427 splice site probably null
R4446:Tmprss6 UTSW 15 78452839 missense probably damaging 1.00
R4508:Tmprss6 UTSW 15 78459778 missense probably damaging 1.00
R4643:Tmprss6 UTSW 15 78445356 missense probably damaging 0.98
R4743:Tmprss6 UTSW 15 78443710 missense probably damaging 0.99
R4836:Tmprss6 UTSW 15 78445388 missense probably damaging 1.00
R4859:Tmprss6 UTSW 15 78446677 missense probably damaging 0.99
R4869:Tmprss6 UTSW 15 78443680 unclassified probably null
R5197:Tmprss6 UTSW 15 78454189 missense probably damaging 1.00
R5212:Tmprss6 UTSW 15 78446260 missense probably damaging 0.99
R5225:Tmprss6 UTSW 15 78452507 missense probably damaging 0.97
R5569:Tmprss6 UTSW 15 78440303 missense probably damaging 1.00
R5572:Tmprss6 UTSW 15 78442422 missense probably damaging 1.00
R5669:Tmprss6 UTSW 15 78454956 missense possibly damaging 0.86
R5947:Tmprss6 UTSW 15 78452522 missense probably damaging 1.00
R6800:Tmprss6 UTSW 15 78440257 missense probably damaging 1.00
R6941:Tmprss6 UTSW 15 78446777 missense probably damaging 1.00
R6965:Tmprss6 UTSW 15 78444128 missense probably damaging 1.00
R7334:Tmprss6 UTSW 15 78443817 missense unknown
R7338:Tmprss6 UTSW 15 78459819 missense probably damaging 1.00
X0025:Tmprss6 UTSW 15 78455095 missense possibly damaging 0.55
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2019-09-04 9:44 PM by Anne Murray
Record Created 2015-12-31 7:58 AM by Carlos Reyna
Record Posted 2016-01-11
Phenotypic Description
Figure 1. Phenotype of the ekans mice.

The ekans phenotype was identified among G3 mice of the pedigree R4344, some of which showed body hair loss, but intact facial hair (Figure 1).

Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 35 mutations. Among these, only one affected a gene with known effects on hair loss, Tmprss6. The mutation in Tmprss6 was presumed to be causative because the cubone hair loss phenotype mimics other known alleles of Tmprss6 (see MGI for a list of Tmprss6 alleles as well as the mask (1), zorro, and masquerade strains from our lab). The Tmprss6 mutation is an A to T transversion at base pair 78,459,427 (v38) on chromosome 15, or base pair 133,970 in the GenBank genomic region NC_000081 for the Tmprss6 gene.

 

The effect of the mutation at the cDNA and protein level have not examined, but the mutation is predicted to result in skipping of the 178-base pair exon 10 (out of 18 total exons), resulting in an in-frame deletion of the 42-base pair exon 6, which encodes amino acid 206-219.

 

         <--exon 5          <--exon 6 intron 6-->         exon 7-->            <--exon 18

……GGCCTGGTGATCCTGG ……CTGAATTCCACGCTGG gtacgctgctctgtcct…… GCTGTTATCGC…… ……CAGGTGCTGACCTGA

……-G--L--V--I--L-- ……-L--N--S--T--L--                     G--C--Y--R-…… ……-Q--V--L--T--*-
      correct            deleted                                     correct

 

Genomic numbering corresponds to NC_000081. The donor splice site of intron 6, which is destroyed by the ekans mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. 

Protein Prediction

Figure 3. Domain structure of TMPRSS6. The C-terminus of the protein, including the serine protease domain, is extracellular. Predicted N-glycosylation sites are noted in violet circles. The ekans mutation is within intron 6. This image is interactive. Click on the image to view other mutations found in TMPRSS6 (red). Click on the mutations for more specific information. 

Tmprss6 encodes an 811-amino acid protein of the type II transmembrane protease family (2). TMPRSS6, also known as matriptase-2, is predicted to contain a C-terminal trypsin-like serine protease domain (shown to be extracellular), three class A LDL receptor domains, two CUB domains (similar to a domain represented in BMP1 as well as C1R and C1S proteins), and a membrane-proximal SEA domain (Figure 3) (1;3)

 

Please see the record for mask for information about Tmprss6.

Putative Mechanism

The peptide hormone hepcidin, encoded by the Hamp gene, was identified as the major systemic iron regulator (4;5). TMPRSS6 is a non-redundant component in a pathway that senses iron deficiency and negatively regulates Hamp expression to promote iron uptake (1). TMPRSS6 proteolytic activity is critical for its Hamp-suppressing activity. Further study will be required to fully understand the mechanisms by which TMPRSS6 mediates Hamp inhibition and promotes iron uptake. The mechanism of hair loss in Tmprss6-mutant mice, including cubone, remains to be established, although severe iron deficiency is associated with hair loss in humans (6) and mice (7).

Primers PCR Primer
ekans(F):5'- AAGCACACGTCTACCTGAGC -3'
ekans(R):5'- CCTGGAGCCAAGATAGAAGTC -3'

Sequencing Primer
ekans_seq(F):5'- TACCTGAGCCCCCACCTG -3'
ekans_seq(R):5'- CCAAGATAGAAGTCGAGGGC -3'
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 425 nucleotides is amplified (chromosome 15, - strand):


1   cctggagcca agatagaagt cgagggcggg gacaggggca ggagcagggg cagggtgggt
61  gcagacagca tggagggctt acctctgctg agcctggctc ggcttctctc ccctgttttt
121 attttcgttg ttctattaat ttggctttgc ccttgtttat ttgtttgttc atttcctttt
181 gacagaagcc agtgtgaacg acatagtcgt actgaattcc acgctgggta cgctgctctg
241 tccttgtatt ggcctctttc ctttagaatc ataggtcttc ttgtctggtc cgttgtgggg
301 gtggaggtcc cgaggtgtcc actgtgggga cagggaaccc cagcttagaa acactggggg
361 gatctcagag ggtaatctgg gtgagggctc tgagcccagg tgggggctca ggtagacgtg
421 tgctt


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

1. Du, X., She, E., Gelbart, T., Truksa, J., Lee, P., Xia, Y., Khovananth, K., Mudd, S., Mann, N., Moresco, E. M., Beutler, E., and Beutler, B. (2008) The Serine Protease TMPRSS6 is Required to Sense Iron Deficiency. Science. 320, 1088-1092.

Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsCarlos Reyna, Jamie Russell, and Bruce Beutler