Phenotypic Mutation 'Honey2' (pdf version)
List |< first << previous [record 6 of 18] next >> last >|
AlleleHoney2
Mutation Type splice donor site
Chromosome13
Coordinate30,761,490 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Irf4
Gene Name interferon regulatory factor 4
Synonym(s) IRF-4, Spip
Chromosomal Location 30,749,226-30,766,976 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the IRF (interferon regulatory factor) family of transcription factors, characterized by an unique tryptophan pentad repeat DNA-binding domain. The IRFs are important in the regulation of interferons in response to infection by virus, and in the regulation of interferon-inducible genes. This family member is lymphocyte specific and negatively regulates Toll-like-receptor (TLR) signaling that is central to the activation of innate and adaptive immune systems. A chromosomal translocation involving this gene and the IgH locus, t(6;14)(p25;q32), may be a cause of multiple myeloma. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display immune system abnormalities involving development of both T and B cells and affecting susceptibility to both bacterial and viral infections as well as impaired thermogenic gene expression and energy expenditure. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_013674; MGI:1096873

Mapped Yes 
Limits of the Critical Region 30749226 - 30766927 bp
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000021784] [ENSMUSP00000105936]
SMART Domains Protein: ENSMUSP00000021784
Gene: ENSMUSG00000021356

DomainStartEndE-ValueType
IRF 17 130 6.96e-64 SMART
IRF-3 249 418 1.17e-84 SMART
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000105936
Gene: ENSMUSG00000021356

DomainStartEndE-ValueType
IRF 17 130 6.96e-64 SMART
IRF-3 248 417 1.17e-84 SMART
Predicted Effect probably benign
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B1 cells - increased
FACS IgM MFI - increased
T-dependent humoral response defect- decreased antibody response to rSFV
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(6) : Chemically induced (ENU)(1) Radiation induced(1) Targeted(4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Irf4 APN 13 30751784 missense probably damaging 1.00
IGL01154:Irf4 APN 13 30757421 missense possibly damaging 0.46
IGL01669:Irf4 APN 13 30757471 missense probably damaging 0.99
IGL02729:Irf4 APN 13 30753591 critical splice donor site probably null
IGL03197:Irf4 APN 13 30763520 splice site probably benign
honey UTSW 13 30751751 missense probably damaging 1.00
R1300:Irf4 UTSW 13 30757585 missense probably damaging 0.98
R1656:Irf4 UTSW 13 30757502 missense probably benign
R1914:Irf4 UTSW 13 30761462 missense probably benign 0.00
R1915:Irf4 UTSW 13 30761462 missense probably benign 0.00
R3889:Irf4 UTSW 13 30761490 splice site probably benign
R4648:Irf4 UTSW 13 30763597 missense probably benign 0.00
R5553:Irf4 UTSW 13 30751828 missense probably damaging 1.00
R5913:Irf4 UTSW 13 30757758 missense probably benign
Mode of Inheritance Autosomal Semidominant
Local Stock
Repository
Last Updated 2017-05-12 11:13 AM by Anne Murray
Record Created 2016-01-07 11:06 PM by Jin Huk Choi
Record Posted 2016-01-20
Phenotypic Description

Figure 1. Honey2 mice exhibit diminished T-dependent IgG responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Honey2 mice exhibit diminished T-independent IgM responses to 4-hydroxy-3-nitrophenylacetyl-Ficoll (NP-Ficoll). IgM levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Honey2 phenotype was identified among G3 mice of the pedigree R3889, some of which showed a diminished T-dependent antibody response (IgG) to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal) (Figure 1) and a diminished T-independent antibody (IgM) response to 4-hydroxy-3-nitrophenylacetyl-Ficoll (NP-Ficoll) (Figure 2). 

Nature of Mutation
Figure 3. Linkage mapping of the reduced T-dependent antibody response (IgG) to rSFV-β-gal using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 57 mutations (X-axis) identified in the G1 male of pedigree R3889. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.
Whole exome HiSeq sequencing of the G1 grandsire identified 57 mutations. Both of the above anomalies were linked by continuous variable mapping to a mutation in Irf4. The Irf4 mutation is a T to C transition at base pair 30,761,490 (v38) on chromosome 13, or base pair 12,283 in the GenBank genomic region NC_000079 within the donor splice site of intron 8. The strongest association was found with an additive model of linkage to the normalized T-dependent antibody response to rSFV-β-gal, wherein two variant homozygotes departed phenotypically from 15 homozygous reference mice and five heterozygous mice with a P value of 5.279 x 10-9 (Figure 3).  
 
The effect of the mutation at the cDNA and protein level has not examined. The mutation is judged unlikely to disrupt the splice donor site of intron 8 by splice prediction programs. In the case that this mutation affects splicing, a cryptic splice site in exon 8 might be used, resulting in a transcript that has a 50-base pair deletion in exon 8 (out of 9 total exons). The mutation would lead to a frame-shifted protein product beginning after amino acid 388 of the protein, followed by premature termination after the inclusion of 26 aberrant amino acids.
 
              <--exon 7 exon 8-->                              intron 8-->                 exon 9-->
8539 ……CAGCAGTTTCTATCAG AGCTGCAAGTG……GTGAGGAGTTT……ATCACAGCTCAT gtgagtacctggttacatcacccgt…… GTGGAACCTCT……CGAGTTACCTGA…… 14402
362  ……-Q--Q--F--L--S-- E--L--Q--V-……G--E--E--F-……-I--T--A--H-                             G--G--T--S-……-R--V--S--*
                 correct                     deleted                                               aberrant

 

Genomic numbering corresponds to NC_000079. The donor splice site of intron 8, which is destroyed by the Honey2 mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. 

Protein Prediction

Figure 4. Domain structure of the IRF4 protein. DBD = DNA binding domain; PRD = Proline-rich domain; IAD1 = IRF association domain. The Honey2 mutation is indicated. This image is interactive; click to view other Irf4 mutations.

The Irf4 gene encodes one of nine members of the interferon regulatory factor (IRF) family of transcription factors, which regulate the transcription of type I interferons (IFN-α/β) and IFN-inducible genes during immune system development, homeostasis and activation by microbes [reviewed by (1;2)]. As in the other IRFs, the N-terminal half of IRF4 (residues 20-137) serves as the DNA binding region (3), and is characterized by the presence of five highly conserved tryptophans (residues 27, 42, 54, 74 and 93) each separated by 10-18 amino acids (Figure 4) (4). IRF family proteins share sequence and structural homology in their DNA binding regions, and all bind to a similar DNA motif (A/G NGAAANNGAAACT) called the IFN-stimulated response element (ISRE) (5) or IFN regulatory element (6) that is present in the regulatory regions of interferons and interferon-stimulated genes (ISGs). By itself, IRF4 only possesses weak DNA binding affinity (3), but can function as both a transcriptional activator and repressor depending upon the specific promoter and binding partner. The C-terminal halves of all IRF family members contain either an IRF association domain 1 (IAD1) or an IAD2, with which they bind to other IRFs, other transcription factors, or self-associate. These interactions allow the IRFs to modulate their activity and target a variety of genes. The IAD1 is approximately 177 amino acids in length, and is conserved in all IRFs except IRF1 and IRF2. IAD2 domains are found only in IRF1 and IRF2 (7-9). By homology, the mouse IRF4 IAD1 domain occurs at amino acids 245-412 (9), and along with the DBD is necessary for interactions with other IRFs, PU.1 and other transcription factors (10). IRF4 also contains an activation domain located within amino acids 150-450. Two regions within this sequence may serve as the potential activation domain: a proline-rich segment (amino acids 151-237) and a carboxy-terminal region (amino acids 354-419) containing 15% glutamine residues (10). A conserved bipartite nuclear retention signal is located within amino acids 50-100 of the DBD.

 

The mutation in Honey2 putatively results in the deletion of 50-base pairs from exon 8, subsequently leading to a frame-shift after amino acid 388, and premature termination after the inclusion of 26 aberrant amino acids. Amino acid 388 is within the carboxy-terminal region of the activation domain. The frame-shift and premature termination would also affect the IAD1 domain.

 

Please see the record for honey for more information about Irf4.

Putative Mechanism

Initially, IRF4-deficient animals displayed normal lymphocyte levels, but developed generalized lymphadenopathy with expansion of both T and B lymphocytes after four to five weeks. These animals also failed to develop germinal centers (GCs) in B cell follicles or plasma cells after immunization, had poor T and B cell proliferative responses after stimulation with most mitogens, and lacked production of all serum Ig subclasses after immunization with T cell-dependent or -independent antigens. Furthermore, these mice were unable to mount an effective anti-viral response to lymphocyticchoriomeningitis virus suggesting severe immunodeficiency. A block at a late stage of peripheral B cell maturation was discovered in these animals. These results suggest that IRF4 is essential for mature B and T cell function. The severe reduction in serum immunoglobulin and lack of GCs observed in IRF4-deficient mice (11) is due to the critical role IRF4 plays in isotype switching and plasma cell differentiation (12;13).

 

IRF4 appears to be expressed in several types of lymphoid malignancies including T cell leukemias and multiple myeloma (OMIM: #254500). Translocations involving the IRF4 gene occur in a subset of peripheral T cell lymphomas (14), and some cases of multiple myeloma contain a chromosomal translocation that juxtaposes the immunoglobulin heavy-chain locus to the Irf4 gene resulting in IRF overexpression (15). IRF4 mRNA expression is a prognostic marker for poor survival in these patients (16), and IRF4 is required for the survival of multiple myeloma cell lines (17).

 

The defective antibody production observed in Honey2 mice is consistent with the B cell phenotype observed in Irf4-/- animals. The Irf4-/- mice display a normal distribution of B and T lymphocyes at 4 to 5 weeks of age, but develop progressive generalized lymphadenopathy with an absence of both T-independent and T-dependent antibody responses (11). The similarity of these phenotypes to those seen in Honey2 mice suggests that the Honey2 mutation severely affects the function of IRF4.

Primers PCR Primer
Honey2(F):5'- ACCAGGTGTCTGAACAGTTTGG -3'
Honey2(R):5'- TTGGGTCCAAGTCATCTGCC -3'

Sequencing Primer
Honey2_seq(F):5'- GAGATTCCAGGTGACTCT -3'
Honey2_seq(R):5'- ATCTGCCCTGCTGATTCGGTG -3'
References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsJin Huk Choi, James Butler, and Bruce Beutler
List |< first << previous [record 6 of 18] next >> last >|