Phenotypic Mutation 'burrito'

• Allele: burrito
• Mutation Type: missense
• Chromosome: 18
• Coordinate: 20,584,919 bp (GRCm39)
• Base Change: T ⇒ A (forward strand)
• Gene: Dsg4
• Gene Name: desmoglein 4
• Synonym(s): CDHF13, lah
• Chromosomal Location: 20,569,232-20,604,878 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. This gene is expressed in the suprabasal epidermis and hair follicle. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the lanceolate hair phenotype in mice. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016] ; PHENOTYPE: Mice carrying mutations at this locus exhibit abnormalities in hair growth, vibrissae growth, and a thickened epidermis. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Valine changed to Glutamic Acid
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000019426]
• AlphaFold: Q7TMD7
• SMART Domains: Protein: ENSMUSP00000019426; Gene: ENSMUSG00000001804; AA Change: V211E

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
CA	70	155	1.54e-11	SMART
CA	179	267	4.27e-19	SMART
CA	290	384	5.48e-8	SMART
CA	411	495	9.4e-7	SMART
transmembrane domain	634	656	N/A	INTRINSIC
low complexity region	724	736	N/A	INTRINSIC
Pfam:Cadherin_C	749	849	3.1e-8	PFAM

• Predicted Effect: possibly damaging ; PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
  (Using ENSMUST00000019426)
• Meta Mutation Damage Score: 0.1795
• Is this an essential gene?: Possibly essential (E-score: 0.626)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice
• Last Updated: 2019-09-04 9:44 PM by Anne Murray
• Record Created: 2016-01-08 11:36 AM by Jamie Russell
• Record Posted: 2016-11-16
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine, Katherine Timer
• Authors: Lauren Prince, Jamie Russell, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_181564; MGI:2661061

Alleles Listed at MGI

All Mutations and Alleles(8) : Chemically induced (ENU)(3) Spontaneous(2) Targeted(3)

Phenotypic Description

Figure 1. The burrito mice exhibit hair loss. A wild-type littermate is shown as reference (bottom).

The burrito phenotype was identified among G3 mice of the pedigree R4012, some of which showed hair loss on their abdomens and backs near their ears (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the hair loss phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 79 mutations (X-axis) identified in the G1 male of pedigree R4012. Binary phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 79 mutations. The hair loss phenotype was linked to a mutation in Dsg4: a T to A transversion at base pair 20,451,862 (v38) on chromosome 18, or base pair 15,688 in the GenBank genomic region NC_000084 for the Dsg4 gene. Linkage was found with a recessive model of inheritance (P = 1.257 x 10^-5), wherein four affected mice were homozygous for the variant allele, and 32 unaffected mice were either heterozygous (N = 19) or homozygous (N = 13) for the reference allele (Figure 2).

The mutation corresponds to residue 766 in the NM_181564 mRNA sequence in exon 6 of 16 total exons. 

750 GCACCCATGTTCATGGTGAACAGGTACACTGGA 206 -A--P--M--F--M--V--N--R--Y--T--G-

The mutated nucleotide is indicated in red.  The mutation results in a valine (V) to glutamic acid (E) substitution at position 211 (V211E) in the DSG4 protein, and is predicted by PolyPhen-2 to be damaging (score = 0.814).

Protein Prediction

Figure 3. Domain organization of DSG4. The burrito mutation results in a valine (V) to glutamic acid (E) substitution at position 211 (V211E). DSG4 has several domains including four cadherin repeats and two DSG repeats. Abbreviations: SP, signal peptide; PP, propeptide; EA, extracellular anchor; TM, transmembrane domain; IA, intracellular anchor; ICS, intracellular cadherin-specific sequence; LD, linker domain; TD, terminal domain.

DSG4 is a member of the desmoglein family of cadherins. Dsg4 is part of the desmosomal cadherin gene cluster on chromosome 18. The mouse genome gene cluster includes: Dsc3—Dsc2—Dsc1—Dsg1β (Dsg5)—Dsg1α—Dsg1γ (Dsg6)—Dsg4—Dsg3—Dsg2 (see the record for weg) (1). Mouse and human DSG4 share 79% amino acid identity and 86% homology.

DSG4 has four N-terminal extracellular cadherin repeats, an extracellular anchoring domain (EA), a transmembrane domain, an intracellular anchoring domain (IA), an intracellular cadherin-specific sequence (ICS), a linker domain, three intracellular repeated unit domains, and a C-terminal domain (2;3).

Cadherin repeats are defined by the DRE, DXD and DXNDNXPXF motifs, and classical cadherins typically have five of these repeats in their extracellular domain, as well as a single transmembrane domain and a conserved cytoplasmic (CP) domain that interacts with α- and β-catenin and connects a cadherin molecule to the actin cytoskeleton (4).  EC repeats mediate the Ca²⁺-dependent dimerization of cadherin molecules and the trans-extracellular linkages between cadherin dimers of two neighboring cells. Each cadherin repeat has four calcium binding motifs that together bind three calcium ions. Calcium binding facilitates linearization and rigidification of the cadherin ectodomain, prevents ectodomain unfolding, and promotes cadherin dimerization and consequent cell-cell adhesion (5-7). The overall 3D structure of the cadherin repeat motif is quite similar to the Greek-key topology of immunoglobulin domains with seven β-strands arranged as two opposing β-sheets with N- and C-termini at the opposite ends (4;6). The overall topology of the extracellular region is that of an elongated, curved structure of tandem EC domains connected by calcium-binding linker regions (8).

The intracellular domain of the DSG proteins binds to intermediate filaments via adaptor proteins desmoplakin and plakoglobin (9). The specific functions of the IPL, DSG repeat domains, and DTD are unknown. Although the DSG repeat domain putatively regulates homodimerization (10). The function of the intracellular anchor sequence in DSG4 is unclear, but that sequence in Dsc recruits plakoglobin and desmoplakin to the membrane as well as anchors intermediate filaments (11). The ICS domain mediates interacts between the desmosomal cadherins and catenin family members (e.g., plakoglobin). The DTD putatively mediates interactions with plakophilins (9).

DSG4 has five putative calcium-binding sites (DXNDN or A/VXDXD) and five N-linked glycosylation consensus motifs (NXS/T). There are three conserved repeats: DIIVTE, NVVVTE, and NVYYAE; the function of the repeats is unknown.

The burrito mutation results in a valine (V) to glutamic acid (E) substitution at position 211 (V211E); residue 211 is within the second cadherin repeat.

Expression/Localization

DSG4 is expressed in the suprabasal epidermis as well as throughout the matrix, precortex, and inner root sheath of the hair follicle (12). Dsg4 is expressed in the anagen stage hair follicles in mouse skin (12). In vibrissae follicles, DSG4 is expressed in the cells of the matrix, precortex, and inner root sheath (12).

HOXC13, LEF1, and FOXN1 transcription factors repress Dsg4 transcription. HOXC13, LEF1, and FOXN1 are members of the Notch pathway, indicating that the Notch pathway is involved in the activation and/or maintenance of Dsg4 expression in the hair follicle (13).

Background

Figure 4. Deficiency of DSG4 leads to impaired anchoring of the hair shaft to the hair follicle. Desmosomal cadherins, comprising multiple subtypes of desmocolins (Dsc1-3) and desmogleins (Dsg1-4), are the adhesion molecules of desmosomes, intercellular junctions that anchor the hair shaft to the hair follicle. Within desmosomes, the extracellular domains of desmocolins and desmogleins from neighboring cells form heterophilic interactions in the extracellular space, while intracellularly they are linked to plakoglobin, plakophilins, and desmoplakin. Desmoplakin binds to keratin intermediate filaments, thereby tethering the intermediate filaments to the plasma membrane to physically strengthen the junction. Grhl1 controls the expression of Dsg1 through direct binding to the Dsg1 promoter, but not to the promoters of Dsg2, Dsg3, or Dsg4. Both Dsg1 and Grhl1 are expressed in the inner root sheath, but not in the dermal papilla cells of the hair follicle. Thus, mice deficient in Grhl1 easily lose hairs in tape-stripping tests, and these hairs are bared of the inner root sheath, companion layer, and outer root sheath tissues that remain adherent to wild type hairs removed in the same way.

The skin serves an important function as a barrier to the environment, and maintains its integrity by continuously renewing the epidermis, while also maintaining associated structures such as hair.  The surface epithelium of the skin is composed primarily of keratinocytes and is constantly regenerated as cells in the outer cornified layer are sloughed off and replaced by newly differentiated cells.  Hair is produced and maintained by the pilosebaceous unit consisting of a hair-producing follicle and a sebaceous gland composed of many different cell types. The hair follicle can be divided into 3 regions: the lower segment (bulb and suprabulb), the middle segment (isthmus), and the upper segment (infundibulum).  Eight epithelial layers are present in the hair follicle including the outer root sheath (ORS) that is continuous with the epidermis, the companion layer (CL), the inner root sheath (IRS) consisting of three layers (Henle’s, Huxley’s and cuticle) and the hair shaft, which also consists of three layers (cuticle, cortex and medulla). After hair follicles are established, hair is periodically shed and then replaced, involving periodic destruction and regeneration of hair follicles.  The hair cycle is divided into periods of follicle growth (anagen), followed by regression (catagen) and rest (telogen). During the regression phase, the lower half of the follicle undergoes apoptosis.  During the anagen phase, hair follicle growth is reinitiated as follicle stem cells are induced to proliferate.  A number of signaling pathways are implicated in skin and hair follicle morphogenesis and regeneration including Sonic hedgehog (Shh), Wnts, and TGF-β family members.

Desmosomes are multiprotein complexes that link cadherin to the intermediate filament, providing structural support for tissues that undergo mechanical stress. The desmocolins (Dsc1-3) and DSGs are the adhesion molecules of desmosomes, intercellular junctions that anchor the hair shaft to the hair follicle, and are collectively known as desmosomal cadherins. Within desmosomes, the extracellular domains of desmocolins and desmogleins from neighboring cells form heterophilic interactions in the extracellular space, while intracellularly they are linked to plakoglobin, plakophilins, and desmoplakin.  Desmoplakin binds to keratin intermediate filaments, thereby tethering the intermediate filaments to the plasma membrane to physically strengthen the junction. Dsg4 functions in an adhesive role mainly in hair follicles, while the other members of the Dsg family show variable tissue expression (e.g., Dsg2 is expressed in all tissues that have desmosomes, and Dsg1 and Dsg3 are expressed in the stratified squamous epithelia) (12).

A spontaneous mutation in Dsg4 occurs in the lanceolate hair (lah) (12;14) and lanceolate hair-J (lah^J) mouse models (15). The mutation in the lah^J mice is a single base pair insertion after nucleotide 746 within exon 7, resulting in a frameshift and insertion of three aberrant amino acids followed by a premature stop codon. The mutation in the lah mice is an A to C transversion at base pair 587. The mutation results in conversion of tyrosine 196 to a serine. The lah and lah^J mice exhibited variable hair loss, including vibrissae, but hair remained on the head and shoulders (12;15). The lah^J mice were runted, while the lah mice were not (12;14;15). With age, the skin of the mice wrinkled, and the mice developed a noninflammatory, proliferative skin disease with follicular dystrophy.  The hair fibers exhibited periodic nodules along the shaft, compaction, spiral fractures, broken tips, and lance-shaped tips. In addition to the visible phenotypes, the lah and lah^J mice also exhibit elevated levels of IgE in the serum. Mutations in rat Dsg4 lead to a similar phenotype as that observed in the mouse (16-18). Hair loss in the lah rat begins at approximately 2 weeks of age, until at 4 weeks the rats are completely bald. Hair regrowth begins after an approximate 29-day cycle of growth and loss. The epiderms of the lah rat exhibits increased proliferation (16). The skin of the Dsg4 mutant rats is thickened with a concomitant increase in basal cell proliferation; the dermis is highly collagenous (17). The hair shaft and inner root sheath exhibit irregularities, and the outer root sheath is wider than normal in some hair follicles.

Humans with mutations in DSG4 exhibit autosomal recessive hypotrichosis 6 [LAH; OMIM: #607903; (19-23)], which is characterized by hypotrichosis of the scalp, chest, arms, and legs. Hair follicles and shafts in patients with LAH are aberrant. Typical hairs in the patients with LAH are fragile and break away easily, leaving short sparse scalp hairs. LAH affects the trunk and extremities as well as the scalp, eyebrows, and eyelashes.

Putative Mechanism

The burrito mice exhibit hair loss similar to the lah mouse models, indicating loss of DSG4^burrito function.

Primers

PCR Primer
burrito_pcr_F: CTCAAGGAAGTCGGGAAAATTC
burrito_pcr_R: GGTGCATAAAACGAAATCTGTATCAC

Sequencing Primer
burrito_seq_F: CTTTTTATACCTAATGCCTGGAGG
burrito_seq_R: TAAAACGAAATCTGTATCACTGACC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 453 nucleotides is amplified (chromosome 18, + strand):

1   ctcaaggaag tcgggaaaat tcaaggaaag accagccact ctctttttat acctaatgcc
61  tggagggatt gaatctagta gaatttcaac cattctctac ctccatcctt acttatagat
121 gcactggtgg taaagttaag tgccacagat gcagatgaag acaatcactt gaattctaaa
181 attgcataca agatcatctc ccaggagcct gctggtgcac ccatgttcat ggtgaacagg
241 tacactggag aagtccgcac gatgtccaat ttccttgaca gagaggtaaa gccttctatg
301 aatgaatggt aacaatgaat ttggttttgt aaagacaaag atgagataaa ttgtgtgtga
361 ccttagtcca gtgctcagga ggaaaggaaa aatactctag tcatttttaa tgaaaattaa
421 atggtcagtg atacagattt cgttttatgc acc

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Whittock, N. V. (2003) Genomic Sequence Analysis of the Mouse Desmoglein Cluster Reveals Evidence for Six Distinct Genes: Characterization of Mouse DSG4, DSG5, and DSG6. J Invest Dermatol. 120, 970-980.

  2. Wheeler, G. N., Parker, A. E., Thomas, C. L., Ataliotis, P., Poynter, D., Arnemann, J., Rutman, A. J., Pidsley, S. C., Watt, F. M., and Rees, D. A. (1991) Desmosomal Glycoprotein DGI, a Component of Intercellular Desmosome Junctions, is Related to the Cadherin Family of Cell Adhesion Molecules. Proc Natl Acad Sci U S A. 88, 4796-4800.

  3. Koch, P. J., Walsh, M. J., Schmelz, M., Goldschmidt, M. D., Zimbelmann, R., and Franke, W. W. (1990) Identification of Desmoglein, a Constitutive Desmosomal Glycoprotein, as a Member of the Cadherin Family of Cell Adhesion Molecules. Eur J Cell Biol. 53, 1-12.

  4. Pokutta, S., and Weis, W. I. (2007) Structure and Mechanism of Cadherins and Catenins in Cell-Cell Contacts. Annu Rev Cell Dev Biol. 23, 237-261.

  5. Di Palma, F., Pellegrino, R., and Noben-Trauth, K. (2001) Genomic Structure, Alternative Splice Forms and Normal and Mutant Alleles of Cadherin 23 (Cdh23). Gene. 281, 31-41.

  6. Elledge, H. M., Kazmierczak, P., Clark, P., Joseph, J. S., Kolatkar, A., Kuhn, P., and Muller, U. (2010) Structure of the N Terminus of Cadherin 23 Reveals a New Adhesion Mechanism for a Subset of Cadherin Superfamily Members. Proc Natl Acad Sci U S A. 107, 10708-10712.

  7. Sotomayor, M., Weihofen, W. A., Gaudet, R., and Corey, D. P. (2010) Structural Determinants of Cadherin-23 Function in Hearing and Deafness. Neuron. 66, 85-100.

  8. Harrison, O. J., Brasch, J., Lasso, G., Katsamba, P. S., Ahlsen, G., Honig, B., and Shapiro, L. (2016) Structural Basis of Adhesive Binding by Desmocollins and Desmogleins. Proc Natl Acad Sci U S A. 113, 7160-7165.

  9. Dusek, R. L., Godsel, L. M., and Green, K. J. (2007) Discriminating Roles of Desmosomal Cadherins: Beyond Desmosomal Adhesion. J Dermatol Sci. 45, 7-21.

  10. Rutman, A. J., Buxton, R. S., and Burdett, I. D. (1994) Visualisation by Electron Microscopy of the Unique Part of the Cytoplasmic Domain of a Desmoglein, a Cadherin-Like Protein of the Desmosome Type of Cell Junction. FEBS Lett. 353, 194-196.

  11. Troyanovsky, S. M., Troyanovsky, R. B., Eshkind, L. G., Leube, R. E., and Franke, W. W. (1994) Identification of Amino Acid Sequence Motifs in Desmocollin, a Desmosomal Glycoprotein, that are Required for Plakoglobin Binding and Plaque Formation. Proc Natl Acad Sci U S A. 91, 10790-10794.

  12. Kljuic, A., Bazzi, H., Sundberg, J. P., Martinez-Mir, A., O'Shaughnessy, R., Mahoney, M. G., Levy, M., Montagutelli, X., Ahmad, W., Aita, V. M., Gordon, D., Uitto, J., Whiting, D., Ott, J., Fischer, S., Gilliam, T. C., Jahoda, C. A., Morris, R. J., Panteleyev, A. A., Nguyen, V. T., and Christiano, A. M. (2003) Desmoglein 4 in Hair Follicle Differentiation and Epidermal Adhesion: Evidence from Inherited Hypotrichosis and Acquired Pemphigus Vulgaris. Cell. 113, 249-260.

  13. Bazzi, H., Demehri, S., Potter, C. S., Barber, A. G., Awgulewitsch, A., Kopan, R., and Christiano, A. M. (2009) Desmoglein 4 is Regulated by Transcription Factors Implicated in Hair Shaft Differentiation. Differentiation. 78, 292-300.

  14. Montagutelli, X., Hogan, M. E., Aubin, G., Lalouette, A., Guenet, J. L., King, L. E.,Jr, and Sundberg, J. P. (1996) Lanceolate Hair (Lah): A Recessive Mouse Mutation with Alopecia and Abnormal Hair. J Invest Dermatol. 107, 20-25.

  15. Sundberg, J. P., Boggess, D., Bascom, C., Limberg, B. J., Shultz, L. D., Sundberg, B. A., King, L. E.,Jr, and Montagutelli, X. (2000) Lanceolate Hair-J (lahJ): A Mouse Model for Human Hair Disorders. Exp Dermatol. 9, 206-218.

  16. Jahoda, C. A., Kljuic, A., O'Shaughnessy, R., Crossley, N., Whitehouse, C. J., Robinson, M., Reynolds, A. J., Demarchez, M., Porter, R. M., Shapiro, L., and Christiano, A. M. (2004) The Lanceolate Hair Rat Phenotype Results from a Missense Mutation in a Calcium Coordinating Site of the Desmoglein 4 Gene. Genomics. 83, 747-756.

  17. Meyer, B., Bazzi, H., Zidek, V., Musilova, A., Pravenec, M., Kurtz, T. W., Nurnberg, P., and Christiano, A. M. (2004) A Spontaneous Mutation in the Desmoglein 4 Gene Underlies Hypotrichosis in a New Lanceolate Hair Rat Model. Differentiation. 72, 541-547.

  18. Bazzi, H., Kljuic, A., Christiano, A. M., Christiano, A. M., and Panteleyev, A. A. (2004) Intragenic Deletion in the Desmoglein 4 Gene Underlies the Skin Phenotype in the Iffa Credo "Hairless" Rat. Differentiation. 72, 450-464.

  19. Schaffer, J. V., Bazzi, H., Vitebsky, A., Witkiewicz, A., Kovich, O. I., Kamino, H., Shapiro, L. S., Amin, S. P., Orlow, S. J., and Christiano, A. M. (2006) Mutations in the Desmoglein 4 Gene Underlie Localized Autosomal Recessive Hypotrichosis with Monilethrix Hairs and Congenital Scalp Erosions. J Invest Dermatol. 126, 1286-1291.

  20. Shimomura, Y., Sakamoto, F., Kariya, N., Matsunaga, K., and Ito, M. (2006) Mutations in the Desmoglein 4 Gene are Associated with Monilethrix-Like Congenital Hypotrichosis. J Invest Dermatol. 126, 1281-1285.

  21. Wajid, M., Bazzi, H., Rockey, J., Lubetkin, J., Zlotogorski, A., and Christiano, A. M. (2007) Localized Autosomal Recessive Hypotrichosis due to a Frameshift Mutation in the Desmoglein 4 Gene Exhibits Extensive Phenotypic Variability within a Pakistani Family. J Invest Dermatol. 127, 1779-1782.

  22. Ullah, A., Raza, S. I., Ali, R. H., Naveed, A. K., Jan, A., Rizvi, S. D., Satti, R., and Ahmad, W. (2015) A Novel Deletion Mutation in the DSG4 Gene Underlies Autosomal Recessive Hypotrichosis with Variable Phenotype in Two Unrelated Consanguineous Families. Clin Exp Dermatol. 40, 78-84.

  23. Messenger, A. G., Bazzi, H., Parslew, R., Shapiro, L., and Christiano, A. M. (2005) A Missense Mutation in the Cadherin Interaction Site of the Desmoglein 4 Gene Underlies Localized Autosomal Recessive Hypotrichosis. J Invest Dermatol. 125, 1077-1079.