Phenotypic Mutation 'burrito' (pdf version)
List |< first << previous [record 47 of 511] next >> last >|
Alleleburrito
Mutation Type missense
Chromosome18
Coordinate20,451,862 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Dsg4
Gene Name desmoglein 4
Synonym(s) lah, CDHF13
Chromosomal Location 20,436,175-20,471,821 bp (+)
MGI Phenotype Mice carrying mutations at this locus exhibit abnormalities in hair growth, vibrissae growth, and a thickened epidermis.
Accession Number

NCBI RefSeq: NM_181564; MGI:2661061

Mapped Yes 
Amino Acid Change Valine changed to Glutamic Acid
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000019426]
SMART Domains Protein: ENSMUSP00000019426
Gene: ENSMUSG00000001804
AA Change: V211E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 70 155 1.54e-11 SMART
CA 179 267 4.27e-19 SMART
CA 290 384 5.48e-8 SMART
CA 411 495 9.4e-7 SMART
transmembrane domain 634 656 N/A INTRINSIC
low complexity region 724 736 N/A INTRINSIC
Pfam:Cadherin_C 749 849 3.1e-8 PFAM
Predicted Effect possibly damaging

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
(Using ENSMUST00000019426)
Phenotypic Category skin/coat/nails
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(8) : Chemically induced (ENU)(3) Spontaneous(2) Targeted(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Dsg4 APN 18 20461326 missense possibly damaging 0.87
IGL01723:Dsg4 APN 18 20466510 missense probably damaging 0.98
IGL02249:Dsg4 APN 18 20461304 missense possibly damaging 0.56
IGL02445:Dsg4 APN 18 20446250 splice site 0.00
IGL02553:Dsg4 APN 18 20462520 missense probably benign 0.00
IGL02578:Dsg4 APN 18 20471193 missense probably benign 0.00
IGL02634:Dsg4 APN 18 20458580 missense probably damaging 0.99
IGL02677:Dsg4 APN 18 20464876 missense probably benign 0.12
IGL02741:Dsg4 APN 18 20471496 missense probably benign 0.00
IGL02747:Dsg4 APN 18 20446938 missense probably damaging 1.00
IGL03342:Dsg4 APN 18 20451823 missense probably damaging 1.00
R0043:Dsg4 UTSW 18 20452972 missense probably damaging 0.99
R0375:Dsg4 UTSW 18 20470879 missense probably damaging 1.00
R0537:Dsg4 UTSW 18 20458571 missense probably damaging 1.00
R0619:Dsg4 UTSW 18 20461359 missense probably benign 0.00
R0622:Dsg4 UTSW 18 20449788 missense possibly damaging 0.51
R0765:Dsg4 UTSW 18 20454646 splice site probably benign
R0786:Dsg4 UTSW 18 20449372 critical splice donor site probably null
R1114:Dsg4 UTSW 18 20466483 missense possibly damaging 0.62
R1249:Dsg4 UTSW 18 20446872 nonsense probably null
R1372:Dsg4 UTSW 18 20449676 splice acceptor site probably null
R1382:Dsg4 UTSW 18 20465124 missense probably benign 0.00
R1392:Dsg4 UTSW 18 20446247 splice acceptor site probably benign
R1392:Dsg4 UTSW 18 20446247 splice acceptor site probably benign
R1442:Dsg4 UTSW 18 20462660 missense possibly damaging 0.76
R1503:Dsg4 UTSW 18 20449679 missense probably damaging 1.00
R1704:Dsg4 UTSW 18 20471589 missense probably damaging 1.00
R1716:Dsg4 UTSW 18 20462461 nonsense probably null
R1765:Dsg4 UTSW 18 20456831 missense probably benign 0.01
R1817:Dsg4 UTSW 18 20471245 missense probably damaging 1.00
R1982:Dsg4 UTSW 18 20471212 missense probably damaging 1.00
R2025:Dsg4 UTSW 18 20466636 nonsense probably null
R2097:Dsg4 UTSW 18 20471044 missense probably damaging 1.00
R2198:Dsg4 UTSW 18 20461442 missense probably benign 0.00
R3551:Dsg4 UTSW 18 20451756 missense probably damaging 1.00
R3742:Dsg4 UTSW 18 20471001 missense probably damaging 1.00
R3853:Dsg4 UTSW 18 20449234 missense probably benign
R3955:Dsg4 UTSW 18 20449375 splice site probably null
R4006:Dsg4 UTSW 18 20470965 missense probably damaging 0.97
R4012:Dsg4 UTSW 18 20451862 missense possibly damaging 0.81
R4171:Dsg4 UTSW 18 20458579 nonsense probably null
R4254:Dsg4 UTSW 18 20471538 missense probably benign 0.07
R4504:Dsg4 UTSW 18 20461436 missense probably benign 0.00
R4559:Dsg4 UTSW 18 20470921 missense probably damaging 1.00
R4607:Dsg4 UTSW 18 20471245 missense probably damaging 1.00
R4612:Dsg4 UTSW 18 20462413 missense probably benign 0.10
R4683:Dsg4 UTSW 18 20461409 missense probably benign
R4700:Dsg4 UTSW 18 20456908 missense possibly damaging 0.91
R4749:Dsg4 UTSW 18 20446831 missense possibly damaging 0.88
R4775:Dsg4 UTSW 18 20471127 missense possibly damaging 0.48
R4809:Dsg4 UTSW 18 20466621 missense possibly damaging 0.82
R5276:Dsg4 UTSW 18 20446839 missense probably benign 0.21
R5767:Dsg4 UTSW 18 20462492 nonsense probably null
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice
Repository
Last Updated 11/16/2016 1:15 PM by Anne Murray
Record Created 01/08/2016 11:36 AM by Jamie Russell
Record Posted 11/16/2016
Phenotypic Description
Figure 1. The burrito mice exhibit hair loss. A wild-type littermate is shown as reference (bottom).

The burrito phenotype was identified among G3 mice of the pedigree R4012, some of which showed hair loss on their abdomens and backs near their ears (Figure 1).

Nature of Mutation
Figure 2. Linkage mapping of the hair loss phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 79 mutations (X-axis) identified in the G1 male of pedigree R4012. Binary phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 79 mutations. The hair loss phenotype was linked to a mutation in Dsg4: a T to A transversion at base pair 20,451,862 (v38) on chromosome 18, or base pair 15,688 in the GenBank genomic region NC_000084 for the Dsg4 gene. Linkage was found with a recessive model of inheritance (P = 1.257 x 10-5), wherein four affected mice were homozygous for the variant allele, and 32 unaffected mice were either heterozygous (N = 19) or homozygous (N = 13) for the reference allele (Figure 2).

 

The mutation corresponds to residue 766 in the NM_181564 mRNA sequence in exon 6 of 16 total exons. 


 

750 GCACCCATGTTCATGGTGAACAGGTACACTGGA

206 -A--P--M--F--M--V--N--R--Y--T--G-

 

The mutated nucleotide is indicated in red.  The mutation results in a valine (V) to glutamic acid (E) substitution at position 211 (V211E) in the DSG4 protein, and is predicted by PolyPhen-2 to be damaging (score = 0.814).

Protein Prediction
Figure 3. Domain organization of DSG4. The burrito mutation results in a valine (V) to glutamic acid (E) substitution at position 211 (V211E). DSG4 has several domains including four cadherin repeats and two DSG repeats. Abbreviations: SP, signal peptide; PP, propeptide; EA, extracellular anchor; TM, transmembrane domain; IA, intracellular anchor; ICS, intracellular cadherin-specific sequence; LD, linker domain; TD, terminal domain.

DSG4 is a member of the desmoglein family of cadherins. Dsg4 is part of the desmosomal cadherin gene cluster on chromosome 18. The mouse genome gene cluster includes: Dsc3Dsc2—Dsc1—Dsg1β (Dsg5)—Dsg1α—Dsg1γ (Dsg6)—Dsg4—Dsg3—Dsg2 (1). Mouse and human DSG4 share 79% amino acid identity and 86% homology.

 

DSG4 has four N-terminal extracellular cadherin repeats, an extracellular anchoring domain (EA), a transmembrane domain, an intracellular anchoring domain (IA), an intracellular cadherin-specific sequence (ICS), a linker domain, three intracellular repeated unit domains, and a C-terminal domain (Figure 3) (2;3). DSG4 has five putative calcium-binding sites (DXNDN or A/VXDXD) and five N-linked glycosylation consensus motifs (NXS/T). The calcium coordinating pocket that mediates assembly of cadherin partners (4).There are three conserved repeats: DIIVTE, NVVVTE, and NVYYAE; the function of the repeats is unknown.

 

The burrito mutation results in a valine (V) to glutamic acid (E) substitution at position 211 (V211E); residue 211 is within the second cadherin repeat.

Expression/Localization

DSG4 is expressed in the suprabasal epidermis as well as throughout the matrix, precortex, and inner root sheath of the hair follicle (5). Dsg4 is expressed in the anagen stage hair follicles in mouse skin (5). In vibrissae follicles, DSG4 is expressed in the cells of the matrix, precortex, and inner root sheath (5).

 

HOXC13, LEF1, and FOXN1 transcription factors repress Dsg4 transcription. HOXC13, LEF1, and FOXN1 are members of the Notch pathway, indicating that the Notch pathway is involved in the activation and/or maintenance of Dsg4 expression in the hair follicle (6).

Background
Figure 4. Deficiency of DSG4 leads to impaired anchoring of the hair shaft to the hair follicle. Desmosomal cadherins, comprising multiple subtypes of desmocolins (Dsc1-3) and desmogleins (Dsg1-4), are the adhesion molecules of desmosomes, intercellular junctions that anchor the hair shaft to the hair follicle. Within desmosomes, the extracellular domains of desmocolins and desmogleins from neighboring cells form heterophilic interactions in the extracellular space, while intracellularly they are linked to plakoglobin, plakophilins, and desmoplakin.  Desmoplakin binds to keratin intermediate filaments, thereby tethering the intermediate filaments to the plasma membrane to physically strengthen the junction. Grhl1 controls the expression of Dsg1 through direct binding to the Dsg1 promoter, but not to the promoters of Dsg2, Dsg3, or Dsg4. Both Dsg1 and Grhl1 are expressed in the inner root sheath, but not in the dermal papilla cells of the hair follicle. Thus, mice deficient in Grhl1 easily lose hairs in tape-stripping tests, and these hairs are bared of the inner root sheath, companion layer, and outer root sheath tissues that remain adherent to wild type hairs removed in the same way.

The skin serves an important function as a barrier to the environment, and maintains its integrity by continuously renewing the epidermis, while also maintaining associated structures such as hair.  The surface epithelium of the skin is composed primarily of keratinocytes and is constantly regenerated as cells in the outer cornified layer are sloughed off and replaced by newly differentiated cells.  Hair is produced and maintained by the pilosebaceous unit consisting of a hair-producing follicle and a sebaceous gland composed of many different cell types. The hair follicle can be divided into 3 regions: the lower segment (bulb and suprabulb), the middle segment (isthmus), and the upper segment (infundibulum).  Eight epithelial layers are present in the hair follicle including the outer root sheath (ORS) that is continuous with the epidermis, the companion layer (CL), the inner root sheath (IRS) consisting of three layers (Henle’s, Huxley’s and cuticle) and the hair shaft, which also consists of three layers (cuticle, cortex and medulla). After hair follicles are established, hair is periodically shed and then replaced, involving periodic destruction and regeneration of hair follicles.  The hair cycle is divided into periods of follicle growth (anagen), followed by regression (catagen) and rest (telogen). During the regression phase, the lower half of the follicle undergoes apoptosis.  During the anagen phase, hair follicle growth is reinitiated as follicle stem cells are induced to proliferate.  A number of signaling pathways are implicated in skin and hair follicle morphogenesis and regeneration including Sonic hedgehog (Shh), Wnts, and TGF-β family members.

 

Desmosomes are multiprotein complexes that link cadherin to the intermediate filament, providing structural support for tissues that undergo mechanical stress. The desmocolins (Dsc1-3) and DSGs are the adhesion molecules of desmosomes, intercellular junctions that anchor the hair shaft to the hair follicle, and are collectively known as desmosomal cadherins (Figure 4). Within desmosomes, the extracellular domains of desmocolins and desmogleins from neighboring cells form heterophilic interactions in the extracellular space, while intracellularly they are linked to plakoglobin, plakophilins, and desmoplakin.  Desmoplakin binds to keratin intermediate filaments, thereby tethering the intermediate filaments to the plasma membrane to physically strengthen the junction. Dsg4 functions in an adhesive role mainly in hair follicles, while the other members of the Dsg family show variable tissue expression (e.g., Dsg2 is expressed in all tissues that have desmosomes, and Dsg1 and Dsg3 are expressed in the stratified squamous epithelia) (5).

 

A spontaneous mutation in Dsg4 occurs in the lanceolate hair (lah) (5;7) and lanceolate hair-J (lahJ) mouse models (8). The mutation in the lahJ mice is a single base pair insertion after nucleotide 746 within exon 7, resulting in a frameshift and insertion of three aberrant amino acids followed by a premature stop codon. The mutation in the lah mice is an A to C transversion at base pair 587. The mutation results in conversion of tyrosine 196 to a serine. The lah and lahJ mice exhibited variable hair loss, including vibrissae, but hair remained on the head and shoulders (5;8). The lahJ mice were runted, while the lah mice were not (5;7;8). With age, the skin of the mice wrinkled, and the mice developed a noninflammatory, proliferative skin disease with follicular dystrophy.  The hair fibers exhibited periodic nodules along the shaft, compaction, spiral fractures, broken tips, and lance-shaped tips. In addition to the visible phenotypes, the lah and lahJ mice also exhibit elevated levels of IgE in the serum. Mutations in rat Dsg4 lead to a similar phenotype as that observed in the mouse (9-11). Hair loss in the lah rat begins at approximately 2 weeks of age, until at 4 weeks the rats are completely bald. Hair regrowth begins after an approximate 29-day cycle of growth and loss. The epiderms of the lah rat exhibits increased proliferation (9). The skin of the Dsg4 mutant rats is thickened with a concomitant increase in basal cell proliferation; the dermis is highly collagenous (10). The hair shaft and inner root sheath exhibit irregularities, and the outer root sheath is wider than normal in some hair follicles.

 

Humans with mutations in DSG4 exhibit autosomal recessive hypotrichosis 6 [LAH; OMIM: #607903; (12-16)], which is characterized by hypotrichosis of the scalp, chest, arms, and legs. Hair follicles and shafts in patients with LAH are aberrant. Typical hairs in the patients with LAH are fragile and break away easily, leaving short sparse scalp hairs. LAH affects the trunk and extremities as well as the scalp, eyebrows, and eyelashes.

Putative Mechanism

The burrito mice exhibit hair loss similar to the lah mouse models, indicating loss of DSG4burrito function.

Primers PCR Primer
burrito(F):5'- CTCAAGGAAGTCGGGAAAATTC -3'
burrito(R):5'- GGTGCATAAAACGAAATCTGTATCAC -3'

Sequencing Primer
burrito_seq(F):5'- CTTTTTATACCTAATGCCTGGAGG -3'
burrito_seq(R):5'- TAAAACGAAATCTGTATCACTGACC -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine, Katherine Timer
AuthorsLauren Prince, Jamie Russell, and Bruce Beutler
List |< first << previous [record 47 of 511] next >> last >|