Phenotypic Mutation 'uhr' (pdf version)
Allele | uhr |
Mutation Type |
nonsense
|
Chromosome | 5 |
Coordinate | 76,377,401 bp (GRCm39) |
Base Change | G ⇒ A (forward strand) |
Gene |
Clock
|
Gene Name | clock circadian regulator |
Synonym(s) | bHLHe8, KAT13D, 5330400M04Rik |
Chromosomal Location |
76,357,715-76,452,639 bp (-) (GRCm39)
|
MGI Phenotype |
FUNCTION: The protein encoded by this gene plays a central role in the regulation of circadian rhythms. The protein encodes a transcription factor of the basic helix-loop-helix (bHLH) family and contains DNA binding histone acetyltransferase activity. The encoded protein forms a heterodimer with Arntl (Bmal1) that binds E-box enhancer elements upstream of Period (Per1, Per2, Per3) and Cryptochrome (Cry1, Cry2) genes and activates transcription of these genes. Per and Cry proteins heterodimerize and repress their own transcription by interacting in a feedback loop with Clock/Arntl complexes. Polymorphisms in this gene may be associated with behavioral changes, obesity, and metabolic syndrome. Two transcripts encoding the same protein have been found for this gene. [provided by RefSeq, Jan 2014] PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal circadian phase. Mice homozygous for a spontaneous mutation exhibit abnormal circadian rhythm, reproduction, behavior, hair cycle, macronutrient absorption, and metabolism. [provided by MGI curators]
|
Accession Number | NM_007715 (variant 1), NM_001289826 (variant 2), NM_001305222 (variant 3); MGI:99698
|
Mapped | Yes |
Amino Acid Change |
Glutamine changed to Stop codon
|
Institutional Source | Beutler Lab |
Gene Model |
predicted gene model for protein(s):
[ENSMUSP00000074656]
[ENSMUSP00000144022]
[ENSMUSP00000143939]
|
AlphaFold |
O08785 |
PDB Structure |
Crystal Structure of the Heterodimeric CLOCK:BMAL1 Transcriptional Activator Complex [X-RAY DIFFRACTION]
|
SMART Domains |
Protein: ENSMUSP00000074656 Gene: ENSMUSG00000029238 AA Change: Q633*
Domain | Start | End | E-Value | Type |
HLH
|
40 |
90 |
7.77e-12 |
SMART |
PAS
|
109 |
175 |
1.88e-6 |
SMART |
PAS
|
264 |
330 |
3.65e-4 |
SMART |
PAC
|
336 |
379 |
7.63e-7 |
SMART |
low complexity region
|
426 |
446 |
N/A |
INTRINSIC |
low complexity region
|
478 |
493 |
N/A |
INTRINSIC |
coiled coil region
|
523 |
559 |
N/A |
INTRINSIC |
low complexity region
|
619 |
634 |
N/A |
INTRINSIC |
low complexity region
|
640 |
657 |
N/A |
INTRINSIC |
low complexity region
|
738 |
796 |
N/A |
INTRINSIC |
low complexity region
|
818 |
837 |
N/A |
INTRINSIC |
|
Predicted Effect |
probably null
|
SMART Domains |
Protein: ENSMUSP00000144022 Gene: ENSMUSG00000029238 AA Change: Q632*
Domain | Start | End | E-Value | Type |
TFS2N
|
34 |
106 |
4.1e-3 |
SMART |
HLH
|
40 |
90 |
3.4e-14 |
SMART |
PAS
|
109 |
175 |
9.6e-9 |
SMART |
PAS
|
264 |
330 |
1.8e-6 |
SMART |
PAC
|
336 |
379 |
3.9e-9 |
SMART |
low complexity region
|
426 |
446 |
N/A |
INTRINSIC |
low complexity region
|
478 |
493 |
N/A |
INTRINSIC |
coiled coil region
|
523 |
559 |
N/A |
INTRINSIC |
low complexity region
|
619 |
633 |
N/A |
INTRINSIC |
low complexity region
|
639 |
656 |
N/A |
INTRINSIC |
low complexity region
|
737 |
795 |
N/A |
INTRINSIC |
low complexity region
|
817 |
836 |
N/A |
INTRINSIC |
|
Predicted Effect |
probably null
|
SMART Domains |
Protein: ENSMUSP00000143939 Gene: ENSMUSG00000029238 AA Change: Q633*
Domain | Start | End | E-Value | Type |
HLH
|
40 |
90 |
7.77e-12 |
SMART |
PAS
|
109 |
175 |
1.88e-6 |
SMART |
PAS
|
264 |
330 |
3.65e-4 |
SMART |
PAC
|
336 |
379 |
7.63e-7 |
SMART |
low complexity region
|
426 |
446 |
N/A |
INTRINSIC |
low complexity region
|
478 |
493 |
N/A |
INTRINSIC |
coiled coil region
|
523 |
559 |
N/A |
INTRINSIC |
low complexity region
|
619 |
634 |
N/A |
INTRINSIC |
low complexity region
|
640 |
657 |
N/A |
INTRINSIC |
low complexity region
|
738 |
796 |
N/A |
INTRINSIC |
low complexity region
|
818 |
837 |
N/A |
INTRINSIC |
|
Predicted Effect |
probably null
|
Meta Mutation Damage Score |
0.9755 |
Is this an essential gene? |
Possibly essential (E-score: 0.728) |
Phenotypic Category |
Autosomal Recessive |
Candidate Explorer Status |
loading ... |
Single pedigree Linkage Analysis Data
|
|
Penetrance | |
Alleles Listed at MGI | All Mutations and Alleles(62) : Chemically induced (ENU)(1) Chemically induced (other)(2) Gene trapped(51) Spontaneous(1) Targeted(4) Transgenic(3)
|
Lab Alleles |
Allele | Source | Chr | Coord | Type | Predicted Effect | PPH Score |
IGL00598:Clock
|
APN |
5 |
76377311 |
missense |
probably benign |
0.17 |
IGL00725:Clock
|
APN |
5 |
76402260 |
nonsense |
probably null |
|
IGL01304:Clock
|
APN |
5 |
76414202 |
critical splice donor site |
probably null |
|
IGL01369:Clock
|
APN |
5 |
76384933 |
missense |
probably benign |
0.30 |
IGL01542:Clock
|
APN |
5 |
76379322 |
missense |
possibly damaging |
0.82 |
IGL02541:Clock
|
APN |
5 |
76410519 |
splice site |
probably null |
|
IGL02602:Clock
|
APN |
5 |
76402274 |
missense |
probably damaging |
1.00 |
IGL02602:Clock
|
APN |
5 |
76402273 |
missense |
probably null |
1.00 |
IGL03186:Clock
|
APN |
5 |
76390929 |
missense |
probably damaging |
0.98 |
IGL03309:Clock
|
APN |
5 |
76379241 |
critical splice donor site |
probably null |
|
R6760_Clock_188
|
UTSW |
5 |
76374823 |
missense |
unknown |
|
R0304:Clock
|
UTSW |
5 |
76374832 |
missense |
unknown |
|
R0593:Clock
|
UTSW |
5 |
76413683 |
missense |
probably benign |
0.25 |
R0654:Clock
|
UTSW |
5 |
76374976 |
missense |
possibly damaging |
0.95 |
R0684:Clock
|
UTSW |
5 |
76393365 |
missense |
probably damaging |
0.96 |
R0707:Clock
|
UTSW |
5 |
76374976 |
missense |
possibly damaging |
0.95 |
R0751:Clock
|
UTSW |
5 |
76377208 |
missense |
possibly damaging |
0.75 |
R0865:Clock
|
UTSW |
5 |
76414271 |
splice site |
probably benign |
|
R0920:Clock
|
UTSW |
5 |
76378167 |
missense |
possibly damaging |
0.80 |
R1396:Clock
|
UTSW |
5 |
76414649 |
missense |
probably benign |
0.00 |
R1450:Clock
|
UTSW |
5 |
76410578 |
nonsense |
probably null |
|
R1487:Clock
|
UTSW |
5 |
76414201 |
splice site |
probably null |
|
R1574:Clock
|
UTSW |
5 |
76390679 |
missense |
probably damaging |
1.00 |
R1574:Clock
|
UTSW |
5 |
76390679 |
missense |
probably damaging |
1.00 |
R1858:Clock
|
UTSW |
5 |
76388756 |
missense |
possibly damaging |
0.92 |
R1872:Clock
|
UTSW |
5 |
76396309 |
missense |
possibly damaging |
0.67 |
R1905:Clock
|
UTSW |
5 |
76414735 |
splice site |
probably benign |
|
R1937:Clock
|
UTSW |
5 |
76377340 |
missense |
probably damaging |
0.99 |
R2411:Clock
|
UTSW |
5 |
76379360 |
missense |
probably benign |
0.08 |
R2887:Clock
|
UTSW |
5 |
76393120 |
missense |
probably damaging |
0.99 |
R3410:Clock
|
UTSW |
5 |
76377401 |
nonsense |
probably null |
|
R4514:Clock
|
UTSW |
5 |
76378046 |
missense |
probably benign |
0.00 |
R4598:Clock
|
UTSW |
5 |
76383657 |
missense |
probably benign |
0.00 |
R4599:Clock
|
UTSW |
5 |
76383657 |
missense |
probably benign |
0.00 |
R4795:Clock
|
UTSW |
5 |
76413763 |
missense |
probably damaging |
1.00 |
R4796:Clock
|
UTSW |
5 |
76413763 |
missense |
probably damaging |
1.00 |
R4973:Clock
|
UTSW |
5 |
76402258 |
missense |
possibly damaging |
0.62 |
R5204:Clock
|
UTSW |
5 |
76391017 |
splice site |
probably null |
|
R5271:Clock
|
UTSW |
5 |
76389801 |
missense |
probably damaging |
1.00 |
R5547:Clock
|
UTSW |
5 |
76378185 |
missense |
probably benign |
0.02 |
R5630:Clock
|
UTSW |
5 |
76378185 |
missense |
probably benign |
0.02 |
R5631:Clock
|
UTSW |
5 |
76378185 |
missense |
probably benign |
0.02 |
R5632:Clock
|
UTSW |
5 |
76378185 |
missense |
probably benign |
0.02 |
R5787:Clock
|
UTSW |
5 |
76384898 |
missense |
probably damaging |
1.00 |
R6274:Clock
|
UTSW |
5 |
76385000 |
missense |
probably benign |
0.45 |
R6578:Clock
|
UTSW |
5 |
76364556 |
missense |
unknown |
|
R6622:Clock
|
UTSW |
5 |
76389801 |
missense |
probably damaging |
1.00 |
R6760:Clock
|
UTSW |
5 |
76374823 |
missense |
unknown |
|
R6793:Clock
|
UTSW |
5 |
76384967 |
frame shift |
probably null |
|
R7406:Clock
|
UTSW |
5 |
76414692 |
start codon destroyed |
probably null |
0.26 |
R7414:Clock
|
UTSW |
5 |
76410611 |
missense |
probably benign |
0.00 |
R7560:Clock
|
UTSW |
5 |
76390738 |
splice site |
probably null |
|
R7593:Clock
|
UTSW |
5 |
76384145 |
missense |
possibly damaging |
0.80 |
R7640:Clock
|
UTSW |
5 |
76396225 |
missense |
possibly damaging |
0.71 |
R7708:Clock
|
UTSW |
5 |
76414256 |
missense |
probably benign |
0.00 |
R7713:Clock
|
UTSW |
5 |
76393267 |
critical splice donor site |
probably null |
|
R7807:Clock
|
UTSW |
5 |
76390982 |
missense |
probably benign |
0.01 |
R8171:Clock
|
UTSW |
5 |
76414261 |
missense |
possibly damaging |
0.94 |
R8190:Clock
|
UTSW |
5 |
76375051 |
missense |
probably damaging |
0.98 |
R8225:Clock
|
UTSW |
5 |
76389759 |
missense |
probably damaging |
0.99 |
R8309:Clock
|
UTSW |
5 |
76402269 |
missense |
probably benign |
0.07 |
R8557:Clock
|
UTSW |
5 |
76377217 |
missense |
probably damaging |
1.00 |
R8792:Clock
|
UTSW |
5 |
76410574 |
missense |
probably damaging |
1.00 |
R8869:Clock
|
UTSW |
5 |
76374889 |
small deletion |
probably benign |
|
R8870:Clock
|
UTSW |
5 |
76383632 |
missense |
probably benign |
0.17 |
R8980:Clock
|
UTSW |
5 |
76402286 |
missense |
probably benign |
0.01 |
R8982:Clock
|
UTSW |
5 |
76364559 |
missense |
unknown |
|
R9177:Clock
|
UTSW |
5 |
76377256 |
missense |
probably benign |
0.00 |
R9208:Clock
|
UTSW |
5 |
76384871 |
missense |
probably benign |
0.00 |
R9213:Clock
|
UTSW |
5 |
76393376 |
missense |
possibly damaging |
0.94 |
R9307:Clock
|
UTSW |
5 |
76364671 |
missense |
unknown |
|
R9446:Clock
|
UTSW |
5 |
76396288 |
missense |
probably benign |
0.00 |
R9516:Clock
|
UTSW |
5 |
76377227 |
missense |
possibly damaging |
0.85 |
R9572:Clock
|
UTSW |
5 |
76377338 |
missense |
probably benign |
0.00 |
R9630:Clock
|
UTSW |
5 |
76393281 |
missense |
probably benign |
0.03 |
|
Mode of Inheritance |
Autosomal Recessive |
Local Stock | |
Repository | |
Last Updated |
2019-09-04 9:44 PM
by Katherine Timer
|
Record Created |
2016-01-13 11:36 AM
|
Record Posted |
2017-02-14 |
Phenotypic Description |
The uhr phenotype was identified among G3 mice of the pedigree R3410, some of which showed increased body weights compared to wild-type controls (Figure 1).
|
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 61 mutations. The body weight phenotype was linked to a mutation in Clock: a C to T transition at base pair 76,229,554 (v38) on chromosome 5, or base pair 75,447 in the GenBank genomic region NC_000071 encoding Clock. Linkage was found with a recessive model of inheritance, wherein five variant homozygotes differed phenotypically from 19 heterozygous and 13 homozygous reference mice (P = 6.964 x 10-5; Figure 2). The mutation corresponds to residue 2,285 in the NM_007715 mRNA sequence in exon 21 of 23 total exons, residue 2,242 in the NM_001289826 mRNA sequence in exon 21 of 23 total exons, and residue 2,101 in the NM_001305222 mRNA sequence in exon 21 of 23 total exons.
75436 ACTCAGCAGAGTCAACAGAGTGTAATGAGTGGA
628 -T--Q--Q--S--Q--Q--S--V--M--S--G-
|
Genomic numbering corresponds to NC_000071. The mutated nucleotide is indicated in red. The mutation results in substitution of glutamine 633 to a premature stop codon (Q633*) in the CLOCK protein.
|
Illustration of Mutations in
Gene & Protein |
|
---|
Protein Prediction |
The CLOCK transcription factor is one of 19 proteins of the bHLH-PAS family, which contain a DNA-binding basic helix-loop-helix domain (bHLH) and two Per-Arnt-Sim (PAS) domain repeats (PAS-A and PAS-B) (Figure 3). These proteins form dimers that bind to E-box sequences in target genes to regulate transcription. The CLOCK protein dimerizes with the bHLH-PAS protein BMAL1 (also called Arntl, aryl hydrocarbon receptor nuclear translocator-like) to regulate transcription of the Per and Cry genes, as well as other genes that control circadian rhythm in mammals.
Together, the bHLH and PAS domains mediate dimerization of bHLH-PAS proteins. The bHLH domain consists of an HLH dimerization domain and 4-6 basic amino acids that bind to E-box motifs in DNA. Although these motifs are defined as 6-bp DNA elements with a consensus sequence of CANNTG (typically CG or GC at degenerate positions) (1-3), the CLOCK-BMAL1 bHLH domains have been shown to bind many E-box like and non-canonical E-box elements including CACGTT, CCAATG, CATTGG, CATGTG, and AACGTG, in addition to the consensus sequence CACGTG (4-7). The crystal structure of a complex containing CLOCK-BMAL1 bHLH domains bound to canonical E-box DNA showed the basic helical regions of CLOCK and BMAL1 inserting into the major groove of the DNA, similar to other bHLH protein-DNA structures (Figure 4) (8). The CLOCK-BMAL1 heterodimer interacted with all six nucleotides of the E-box. In addition, BMAL1 formed a hydrophobic contact with a thymine nucleotide flanking the consensus E-box sequence; this interaction permitted specific binding to non-canonical E-boxes. Heterodimerization of the two bHLH domains was shown to depend on CLOCK His84 and BMAL1 Leu125, which preclude homodimer formation due to side chain clash (8). The PAS domain is approximately 100-120 amino acids in length. Sequence analysis of 34 mouse PAS domain-containing proteins suggests that PAS-A and PAS-B domains have distinct consensus sequences (PAS-A: LxALDGFxxV VxxxxGxxxY xSExVxxxLG xxQxxLxxxG xSxxxxxHPx DxxExxxxL; PAS-B: IxxxxxxFx xRHxxDxxFx xxDxRxxxxx GYxPxxLxGx xxYxxxHxxD xxxxxxxH) (9). However, they exhibit a similar three dimensional fold in a variety of proteins, with four to five α-helices surrounding a sheet of five antiparallel β-strands (10;11). The PAS-A domain is important for preventing dimerization with non-PAS containing bHLH proteins, and for mediating binding to non-canonical E-box sequences (12). It has been proposed that the PAS-B domain is important as a sensor of environmental signals through binding to proteins that transduce sensory information (9;13). The PAS domains of CLOCK have been implicated in binding to PER and CRY1, components of the negative arm of the feedback loop regulating circadian rhythm (14;15).
The crystal structure of a complex containing the bHLH-PAS domains of mouse CLOCK:BMAL1 shows a tightly intertwined heterodimer with three distinct contact interfaces mediated by homotypic domain interactions (Figure 5) (11). The overall conformation of the complex is asymmetric, as is the distribution of electrostatic potential over the two protein subunits. In particular, BMAL1 has an overall positive electrostatic potential while CLOCK has an overall negative electrostatic potential. The dimer interface between the PAS-A domains of CLOCK and BMAL1 appears similar to those of other complexes (16) and contains multiple residues that are conserved among other bHLH-PAS proteins, suggesting a common mode of dimerization via this domain. In contrast, the dimer interface between the CLOCK and BMAL1 PAS-B domains is more unusual, with the β sheet of BMAL1 PAS-B making contacts with the helical face of CLOCK PAS-B in a parallel stack of the domains. PAS domains are covalently linked to and regulate the activities of a wide range of effector domains (10). The C-terminal half of CLOCK is rich in glutamine residues, a characteristic of transactivation domains of transcription factors (17). However, experiments measuring reporter activation in vitro by heterodimers of truncated CLOCK and wild type BMAL1, or by CLOCK fused to a GAL4 DNA-binding domain, suggest that no transactivation domain is present in the CLOCK C-terminus (18). Rather, CLOCK may play a regulatory or structural role to promote the transactivation activity of BMAL1 in the CLOCK-BMAL1 heterodimer (18;19). The uhr mutation occurs within the glutamine-rich region of CLOCK.
|
Expression/Localization | Gene and protein expression of CLOCK is ubiquitous (20;21). CLOCK localization cycles between the nucleus and cytoplasm (68).
|
Background |
Circadian rhythms are intrinsic daily cycles of behavioral and physiological changes driven by an endogenous “clock” or “oscillator” [reviewed in (22-24)]. Changes in sleep/wakefulness, locomotion, feeding, and temperature are all overt signs of the body’s circadian rhythm. These rhythms, which follow a 24-hour cycle or period, are both self-sustained, occurring even in the absence of external inputs, and entrained (synchronized) by environmental cues such as the light-dark cycle. In mammals, the master circadian clock is located in the hypothalamic suprachiasmatic nucleus (SCN) (25), where a network of interconnected and therefore synchronized neurons receives photic input from the retina and provides circadian timing information to the rest of the body (26). This information is conveyed by direct neuronal projections to other brain and peripheral regions, as well as by diffusible factors (27;28) and systemic cues (e.g. body temperature) from the SCN (29-31). Peripheral organs can sustain circadian rhythms in the absence of SCN input, and do so with tissue-specific differences in period and phase (21). However, peripheral tissues rely on the master clock for long term synchronization to an internally coherent timing system (21;32-34). At the molecular level, the circadian clock consists of several interacting positive and negative transcriptional feedback loops that drive recurrent cycling of RNA and protein levels of clock components (Figure 6) (23;35;36). The core feedback loop consists of BMAL1 and CLOCK, components of the positive arm of the loop, and three Period (PER) and two Cryptochrome (CRY) proteins, components of the negative arm of the loop. CLOCK-BMAL1 heterodimers activate the transcription of Per (see kortiku), Cry, and Rev-Erbα genes through interaction with E-box enhancers (37;38). After heterodimerization in the cytoplasm, PER-CRY complexes translocate into the nucleus where they directly interact with CLOCK-BMAL1 and inhibit transcription (19;39-42). Ubiquitin-mediated degradation of PER and CRY proteins gradually relieves their repression of CLOCK-BMAL1, and the cycle begins again (43-47). The 24-hour period of the cycle is modulated by casein kinase 1δ (CK1δ) and CK1ε, serine kinases that phosphorylate PER proteins and thereby control their translocation into the nucleus (48;49) or their degradation (46). CK1δ/ε deficiency results in the constitutive cytoplasmic localization of PER proteins (48). The activities of CK1δ and CK1ε are regulated by phosphatases PP1 and PP5 (48;49). Rhythmic changes in Bmal1 transcription are controlled by another transcriptional feedback loop involving the retinoic acid receptor (RAR)-related orphan receptors (RORα, RORβ, RORγ; see 4-limb clasper and chestnut) and Rev-Erbα/Rev-Erbβ (Figure 6). RORα and RORβ have been shown to interact with several ROR response elements (RORE) in the promoter of Bmal1, cyclically competing with the transcriptional repressors Rev-Erbα and Rev-Erbβ for binding (38;50-52). ROREs are also found in intron 1 of Cry1; these, together with E-box elements found in the Cry1 promoter, generate an essential delay in Cry1 expression relative to genes regulated strictly by CLOCK-BMAL1 (53;54). Although rhythmicity of BMAL1 expression is not necessary for proper timing of the core feedback loop (55), the delay in feedback repression by CRY1 is required for mammalian circadian clock function (53). The role of CLOCK in regulating circadian rhythm was first discovered through study of an ENU-induced mutant mouse strain harboring a dominant mutation of Clock (17;56;57). A point mutation within intron 18 of Clock resulted in aberrant splicing that excluded exon 19 from the mRNA. ClockΔ19/+ and ClockΔ19/Δ19 mice exhibited excessively long circadian periods, exaggerated resetting responses to light, and reduced amplitude of Per gene expression (peak mRNA level) (56;58). The mutant CLOCK protein in these animals was found to compete with wild type CLOCK for binding to BMAL1 (17) and sequester BMAL1 in a complex capable of binding to E-box DNA but incompetent in transactivation activity (37). With the exception of Bmal1 deficiency (59), single gene knockout of core clock components did not abolish circadian rhythms of behavior, which are supported by the genetic redundancy of clock components (55;60) and by the intercellular coupling of SCN neurons (26). Mice with a null mutation of CLOCK displayed robust circadian rhythms in locomotor activity, although they had a slightly shortened circadian period in constant darkness and altered behavioral responses (locomotor activity) to light (61). In addition, rhythmic gene expression of Per1, Per2, Rev-erbα, and Bmal1 in the SCN of CLOCK-deficient mice was maintained, despite a reduction in the amplitude of expression. Mice lacking both CLOCK and NPAS2, a paralog of CLOCK which can be coimmunoprecipitated with BMAL1 from whole brain extracts (61-63), exhibited arrhythmic locomotor behavior immediately upon placement in constant darkness, suggesting that it functions redundantly with CLOCK in forming transcriptionally active complexes with BMAL1 (60). Although initially surprising, these findings are nevertheless consistent with the dominant negative effects of the ClockΔ19 mutation. ClockΔ19/Δ19 mice exhibited multiple physiological defects as a result of alterations in circadian timing. These include an attenuated diurnal feeding rhythm, hyperphagia, obesity, and metabolic syndrome, which were associated with altered expression of neuropeptides involved in appetite and energy regulation (64). ClockΔ19/Δ19 mice also showed abnormal circadian regulation of heart rate and systemic blood pressure (65), abnormal sleep homeostasis characterized by less time asleep and less non-REM sleep (66), and abnormally elevated exploratory and escape-seeking behavior in behavior tests (67). These phenotypes may stem from tissue-specific rather than SCN-derived defects in circadian timing.
|
Putative Mechanism | Like ClockΔ19/Δ19 mice, homozygous urh mutants displayed increased body weights relative to heterozygous and wild type littermates. Both the Δ19 and uhr mutations occur within the glutamine-rich region of CLOCK, specifically deleting aa 514-564 or creating a premature stop codon at aa position 633, respectively. The similarities of phenotype and relative positions of the two mutations in the linear amino acid sequence of CLOCK suggests the possibility that their mechanistic effects are also alike. The uhr mutation may leave the dimerization and DNA binding activities of CLOCKuhr intact while abrogating transactivation activity of the CLOCKuhr-BMAL1 heterodimer, resulting in a dominant negative effect similar to that of the Δ19 mutation; this hypothesis remains to be tested. Circadian timing of feeding and other behaviors, gene expression of core clock components, and CLOCK protein function have not been tested in uhr mice.
|
Primers |
PCR Primer
uhr_pcr_F: CGTAGTGACTGTAGCACTCTGG
uhr_pcr_R: CCAACAACGTTGTGTGTATTTTACC
Sequencing Primer
uhr_seq_F: ACTGTAGCACTCTGGGTACTG
uhr_seq_R: AAGTCTTAGTTTGCCTTCCATCAAG
|
Genotyping | PCR program 1) 94°C 2:00 2) 94°C 0:30 3) 55°C 0:30 4) 72°C 1:00 5) repeat steps (2-4) 40x 6) 72°C 10:00 7) 4°C hold
The following sequence of 411 nucleotides is amplified (chromosome 5, - strand):
1 ccaacaacgt tgtgtgtatt ttacctagct atgaagatgc ttcttttaaa gtcttagttt 61 gccttccatc aaggactcca ggctaagtct gttagtacaa atcagtgtca tttctctctg 121 aatcatgtat gttgctgtct ctcctgctct gccaccatta ctaagtggtg agtagtagag 181 gcgtggtctc ctgtaactgt taggtaattt ccatacgatc ttttctagca gagtcaacag 241 agtgtaatga gtggacacag tcagcagacg tctcttccaa gtcagacacc gagcactctc 301 acagccccac tgtacaatac gatggtgatt tcccagcctg cagctgggag catggtccag 361 attccatcca gtatgccaca gaacagtacc cagagtgcta cagtcactac g
Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red. |
References |
4. Hatanaka, F., Matsubara, C., Myung, J., Yoritaka, T., Kamimura, N., Tsutsumi, S., Kanai, A., Suzuki, Y., Sassone-Corsi, P., Aburatani, H., Sugano, S., and Takumi, T. (2010) Genome-Wide Profiling of the Core Clock Protein BMAL1 Targets Reveals a Strict Relationship with Metabolism. Mol Cell Biol. 30, 5636-5648.
5. Rey, G., Cesbron, F., Rougemont, J., Reinke, H., Brunner, M., and Naef, F. (2011) Genome-Wide and Phase-Specific DNA-Binding Rhythms of BMAL1 Control Circadian Output Functions in Mouse Liver. PLoS Biol. 9, e1000595.
6. Yoo, S. H., Ko, C. H., Lowrey, P. L., Buhr, E. D., Song, E. J., Chang, S., Yoo, O. J., Yamazaki, S., Lee, C., and Takahashi, J. S. (2005) A Noncanonical E-Box Enhancer Drives Mouse Period2 Circadian Oscillations in Vivo. Proc Natl Acad Sci U S A. 102, 2608-2613.
11. Huang, N., Chelliah, Y., Shan, Y., Taylor, C. A., Yoo, S. H., Partch, C., Green, C. B., Zhang, H., and Takahashi, J. S. (2012) Crystal Structure of the Heterodimeric CLOCK:BMAL1 Transcriptional Activator Complex. Science. 337, 189-194.
14. Chen, R., Schirmer, A., Lee, Y., Lee, H., Kumar, V., Yoo, S. H., Takahashi, J. S., and Lee, C. (2009) Rhythmic PER Abundance Defines a Critical Nodal Point for Negative Feedback within the Circadian Clock Mechanism. Mol Cell. 36, 417-430.
15. Michael, A. K., Fribourgh, J. L., Chelliah, Y., Sandate, C. R., Hura, G. L., Schneidman-Duhovny, D., Tripathi, S. M., Takahashi, J. S., and Partch, C. L. (2017) Formation of a Repressive Complex in the Mammalian Circadian Clock is Mediated by the Secondary Pocket of CRY1. Proc Natl Acad Sci U S A. .
16. Key, J., Hefti, M., Purcell, E. B., and Moffat, K. (2007) Structure of the Redox Sensor Domain of Azotobacter Vinelandii NifL at Atomic Resolution: Signaling, Dimerization, and Mechanism. Biochemistry. 46, 3614-3623.
17. King, D. P., Zhao, Y., Sangoram, A. M., Wilsbacher, L. D., Tanaka, M., Antoch, M. P., Steeves, T. D., Vitaterna, M. H., Kornhauser, J. M., Lowrey, P. L., Turek, F. W., and Takahashi, J. S. (1997) Positional Cloning of the Mouse Circadian Clock Gene. Cell. 89, 641-653.
18. Takahata, S., Ozaki, T., Mimura, J., Kikuchi, Y., Sogawa, K., and Fujii-Kuriyama, Y. (2000) Transactivation Mechanisms of Mouse Clock Transcription Factors, mClock and mArnt3. Genes Cells. 5, 739-747.
19. Xu, H., Gustafson, C. L., Sammons, P. J., Khan, S. K., Parsley, N. C., Ramanathan, C., Lee, H. W., Liu, A. C., and Partch, C. L. (2015) Cryptochrome 1 Regulates the Circadian Clock through Dynamic Interactions with the BMAL1 C Terminus. Nat Struct Mol Biol. 22, 476-484.
21. Yoo, S. H., Yamazaki, S., Lowrey, P. L., Shimomura, K., Ko, C. H., Buhr, E. D., Siepka, S. M., Hong, H. K., Oh, W. J., Yoo, O. J., Menaker, M., and Takahashi, J. S. (2004) PERIOD2::LUCIFERASE Real-Time Reporting of Circadian Dynamics Reveals Persistent Circadian Oscillations in Mouse Peripheral Tissues. Proc Natl Acad Sci U S A. 101, 5339-5346.
26. Liu, A. C., Welsh, D. K., Ko, C. H., Tran, H. G., Zhang, E. E., Priest, A. A., Buhr, E. D., Singer, O., Meeker, K., Verma, I. M., Doyle, F. J.,3rd, Takahashi, J. S., and Kay, S. A. (2007) Intercellular Coupling Confers Robustness Against Mutations in the SCN Circadian Clock Network. Cell. 129, 605-616.
29. Brown, S. A., Zumbrunn, G., Fleury-Olela, F., Preitner, N., and Schibler, U. (2002) Rhythms of Mammalian Body Temperature can Sustain Peripheral Circadian Clocks. Curr Biol. 12, 1574-1583.
30. Saini, C., Morf, J., Stratmann, M., Gos, P., and Schibler, U. (2012) Simulated Body Temperature Rhythms Reveal the Phase-Shifting Behavior and Plasticity of Mammalian Circadian Oscillators. Genes Dev. 26, 567-580.
33. Nagoshi, E., Saini, C., Bauer, C., Laroche, T., Naef, F., and Schibler, U. (2004) Circadian Gene Expression in Individual Fibroblasts: Cell-Autonomous and Self-Sustained Oscillators Pass Time to Daughter Cells. Cell. 119, 693-705.
34. Welsh, D. K., Yoo, S. H., Liu, A. C., Takahashi, J. S., and Kay, S. A. (2004) Bioluminescence Imaging of Individual Fibroblasts Reveals Persistent, Independently Phased Circadian Rhythms of Clock Gene Expression. Curr Biol. 14, 2289-2295.
37. Gekakis, N., Staknis, D., Nguyen, H. B., Davis, F. C., Wilsbacher, L. D., King, D. P., Takahashi, J. S., and Weitz, C. J. (1998) Role of the CLOCK Protein in the Mammalian Circadian Mechanism. Science. 280, 1564-1569.
38. Preitner, N., Damiola, F., Lopez-Molina, L., Zakany, J., Duboule, D., Albrecht, U., and Schibler, U. (2002) The Orphan Nuclear Receptor REV-ERBalpha Controls Circadian Transcription within the Positive Limb of the Mammalian Circadian Oscillator. Cell. 110, 251-260.
39. Ye, R., Selby, C. P., Chiou, Y. Y., Ozkan-Dagliyan, I., Gaddameedhi, S., and Sancar, A. (2014) Dual Modes of CLOCK:BMAL1 Inhibition Mediated by Cryptochrome and Period Proteins in the Mammalian Circadian Clock. Genes Dev. 28, 1989-1998.
40. Kume, K., Zylka, M. J., Sriram, S., Shearman, L. P., Weaver, D. R., Jin, X., Maywood, E. S., Hastings, M. H., and Reppert, S. M. (1999) MCRY1 and mCRY2 are Essential Components of the Negative Limb of the Circadian Clock Feedback Loop. Cell. 98, 193-205.
41. Vitaterna, M. H., Selby, C. P., Todo, T., Niwa, H., Thompson, C., Fruechte, E. M., Hitomi, K., Thresher, R. J., Ishikawa, T., Miyazaki, J., Takahashi, J. S., and Sancar, A. (1999) Differential Regulation of Mammalian Period Genes and Circadian Rhythmicity by Cryptochromes 1 and 2. Proc Natl Acad Sci U S A. 96, 12114-12119.
43. Busino, L., Bassermann, F., Maiolica, A., Lee, C., Nolan, P. M., Godinho, S. I., Draetta, G. F., and Pagano, M. (2007) SCFFbxl3 Controls the Oscillation of the Circadian Clock by Directing the Degradation of Cryptochrome Proteins. Science. 316, 900-904.
44. Godinho, S. I., Maywood, E. S., Shaw, L., Tucci, V., Barnard, A. R., Busino, L., Pagano, M., Kendall, R., Quwailid, M. M., Romero, M. R., O'neill, J., Chesham, J. E., Brooker, D., Lalanne, Z., Hastings, M. H., and Nolan, P. M. (2007) The After-Hours Mutant Reveals a Role for Fbxl3 in Determining Mammalian Circadian Period. Science. 316, 897-900.
45. Reischl, S., Vanselow, K., Westermark, P. O., Thierfelder, N., Maier, B., Herzel, H., and Kramer, A. (2007) Beta-TrCP1-Mediated Degradation of PERIOD2 is Essential for Circadian Dynamics. J Biol Rhythms. 22, 375-386.
47. Siepka, S. M., Yoo, S. H., Park, J., Song, W., Kumar, V., Hu, Y., Lee, C., and Takahashi, J. S. (2007) Circadian Mutant Overtime Reveals F-Box Protein FBXL3 Regulation of Cryptochrome and Period Gene Expression. Cell. 129, 1011-1023.
48. Lee, H. M., Chen, R., Kim, H., Etchegaray, J. P., Weaver, D. R., and Lee, C. (2011) The Period of the Circadian Oscillator is Primarily Determined by the Balance between Casein Kinase 1 and Protein Phosphatase 1. Proc Natl Acad Sci U S A. 108, 16451-16456.
49. Partch, C. L., Shields, K. F., Thompson, C. L., Selby, C. P., and Sancar, A. (2006) Posttranslational Regulation of the Mammalian Circadian Clock by Cryptochrome and Protein Phosphatase 5. Proc Natl Acad Sci U S A. 103, 10467-10472.
50. Ueda, H. R., Chen, W., Adachi, A., Wakamatsu, H., Hayashi, S., Takasugi, T., Nagano, M., Nakahama, K., Suzuki, Y., Sugano, S., Iino, M., Shigeyoshi, Y., and Hashimoto, S. (2002) A Transcription Factor Response Element for Gene Expression during Circadian Night. Nature. 418, 534-539.
53. Ukai-Tadenuma, M., Yamada, R. G., Xu, H., Ripperger, J. A., Liu, A. C., and Ueda, H. R. (2011) Delay in Feedback Repression by Cryptochrome 1 is Required for Circadian Clock Function. Cell. 144, 268-281.
54. Fustin, J. M., O'Neill, J. S., Hastings, M. H., Hazlerigg, D. G., and Dardente, H. (2009) Cry1 Circadian Phase in Vitro: Wrapped Up with an E-Box. J Biol Rhythms. 24, 16-24.
55. Liu, A. C., Tran, H. G., Zhang, E. E., Priest, A. A., Welsh, D. K., and Kay, S. A. (2008) Redundant Function of REV-ERBalpha and Beta and Non-Essential Role for Bmal1 Cycling in Transcriptional Regulation of Intracellular Circadian Rhythms. PLoS Genet. 4, e1000023.
56. Vitaterna, M. H., King, D. P., Chang, A. M., Kornhauser, J. M., Lowrey, P. L., McDonald, J. D., Dove, W. F., Pinto, L. H., Turek, F. W., and Takahashi, J. S. (1994) Mutagenesis and Mapping of a Mouse Gene, Clock, Essential for Circadian Behavior. Science. 264, 719-725.
57. King, D. P., Vitaterna, M. H., Chang, A. M., Dove, W. F., Pinto, L. H., Turek, F. W., and Takahashi, J. S. (1997) The Mouse Clock Mutation Behaves as an Antimorph and Maps within the W19H Deletion, Distal of Kit. Genetics. 146, 1049-1060.
58. Vitaterna, M. H., Ko, C. H., Chang, A. M., Buhr, E. D., Fruechte, E. M., Schook, A., Antoch, M. P., Turek, F. W., and Takahashi, J. S. (2006) The Mouse Clock Mutation Reduces Circadian Pacemaker Amplitude and Enhances Efficacy of Resetting Stimuli and Phase-Response Curve Amplitude. Proc Natl Acad Sci U S A. 103, 9327-9332.
59. Bunger, M. K., Wilsbacher, L. D., Moran, S. M., Clendenin, C., Radcliffe, L. A., Hogenesch, J. B., Simon, M. C., Takahashi, J. S., and Bradfield, C. A. (2000) Mop3 is an Essential Component of the Master Circadian Pacemaker in Mammals. Cell. 103, 1009-1017.
61. Debruyne, J. P., Noton, E., Lambert, C. M., Maywood, E. S., Weaver, D. R., and Reppert, S. M. (2006) A Clock Shock: Mouse CLOCK is Not Required for Circadian Oscillator Function. Neuron. 50, 465-477.
62. Hogenesch, J. B., Chan, W. K., Jackiw, V. H., Brown, R. C., Gu, Y. Z., Pray-Grant, M., Perdew, G. H., and Bradfield, C. A. (1997) Characterization of a Subset of the Basic-Helix-Loop-Helix-PAS Superfamily that Interacts with Components of the Dioxin Signaling Pathway. J Biol Chem. 272, 8581-8593.
63. Zhou, Y. D., Barnard, M., Tian, H., Li, X., Ring, H. Z., Francke, U., Shelton, J., Richardson, J., Russell, D. W., and McKnight, S. L. (1997) Molecular Characterization of Two Mammalian bHLH-PAS Domain Proteins Selectively Expressed in the Central Nervous System. Proc Natl Acad Sci U S A. 94, 713-718.
64. Turek, F. W., Joshu, C., Kohsaka, A., Lin, E., Ivanova, G., McDearmon, E., Laposky, A., Losee-Olson, S., Easton, A., Jensen, D. R., Eckel, R. H., Takahashi, J. S., and Bass, J. (2005) Obesity and Metabolic Syndrome in Circadian Clock Mutant Mice. Science. 308, 1043-1045.
65. Curtis, A. M., Cheng, Y., Kapoor, S., Reilly, D., Price, T. S., and Fitzgerald, G. A. (2007) Circadian Variation of Blood Pressure and the Vascular Response to Asynchronous Stress. Proc Natl Acad Sci U S A. 104, 3450-3455.
66. Naylor, E., Bergmann, B. M., Krauski, K., Zee, P. C., Takahashi, J. S., Vitaterna, M. H., and Turek, F. W. (2000) The Circadian Clock Mutation Alters Sleep Homeostasis in the Mouse. J Neurosci. 20, 8138-8143.
68. Kondratov, R. V., Chernov, M. V., Kondratova, A. A., Gorbacheva, V. Y., Gudkov, A. V., and Antoch, M. P. (2003) BMAL1-Dependent Circadian Oscillation of Nuclear CLOCK: Posttranslational Events Induced by Dimerization of Transcriptional Activators of the Mammalian Clock System. Genes Dev. 17, 1921-1932.
|
Science Writers | Eva Marie Y. Moresco |
Illustrators | Katherine Timer |
Authors | Emre Turer, Bruce Beutler |