Phenotypic Mutation 'domino' (pdf version)
Alleledomino
Mutation Type missense
Chromosome1
Coordinate52,140,588 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Stat1
Gene Name signal transducer and activator of transcription 1
Synonym(s) 2010005J02Rik
Chromosomal Location 52,119,440-52,161,865 bp (+)
MGI Phenotype Homozygotes for targeted null mutations are largely unresponsive to interferon, fail to thrive, are susceptible to viral diseases and cutaneous leishmaniasis, and show excess osteoclastogenesis leading to increased bone mass.
Accession Number

NCBI RefSeq: NM_009283; MGI: 103063

Mapped Yes 
Amino Acid Change Valine changed to Glutamic Acid
Institutional SourceBeutler Lab
Ref Sequences
V319E in Ensembl: ENSMUSP00000066743 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
STAT_int 2 122 2.5e-61 SMART
Pfam:STAT_alpha 136 315 2.3e-59 PFAM
Pfam:STAT_bind 317 567 7.5e-116 PFAM
SH2 571 687 1.59e-1 SMART
Pfam:STAT1_TAZ2bind 715 739 2.1e-9 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using Ensembl: ENSMUSP00000066743)
Phenotypic Category decrease in NK cell response, decrease in response to injected CpG DNA, immune system, MCMV proliferation in macrophages- increased, MCMV susceptibility, RVFV susceptibility
Penetrance 100% 
Alleles Listed at MGI

All alleles(8) : Targeted, knock-out(2) Targeted, other(1) Gene trapped(2) Chemically induced(3

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Stat1 APN 1 52122595 missense probably damaging 1.00
IGL01111:Stat1 APN 1 52142961 critical splice donor site probably null 0.00
IGL01451:Stat1 APN 1 52139343 missense probably damaging 1.00
IGL01469:Stat1 APN 1 52147370 missense possibly damaging 0.44
IGL01758:Stat1 APN 1 52136921 missense probably damaging 1.00
IGL01818:Stat1 APN 1 52151278 missense probably damaging 0.97
IGL01913:Stat1 APN 1 52126557 missense possibly damaging 0.93
IGL01914:Stat1 APN 1 52126557 missense possibly damaging 0.93
IGL02304:Stat1 APN 1 52132544 missense probably benign 0.00
IGL02428:Stat1 APN 1 52142966 splice site 0.00
poison UTSW 1 52151225 splice acceptor site probably benign
roccoco UTSW 1 52123209 missense probably damaging 1.00
rollo UTSW 1 52153923 nonsense
R0022:Stat1 UTSW 1 52140630 missense probably damaging 1.00
R0022:Stat1 UTSW 1 52140630 missense probably damaging 1.00
R0039:Stat1 UTSW 1 52140660 missense probably damaging 0.97
R0458:Stat1 UTSW 1 52149052 splice donor site probably benign
R1313:Stat1 UTSW 1 52156006 missense probably damaging 0.98
R1313:Stat1 UTSW 1 52156006 missense probably damaging 0.98
R1824:Stat1 UTSW 1 52126515 splice acceptor site probably benign
R2202:Stat1 UTSW 1 52151226 splice acceptor site probably benign
R2998:Stat1 UTSW 1 52151249 missense probably benign 0.01
R4464:Stat1 UTSW 1 52137416 missense possibly damaging 0.52
R4709:Stat1 UTSW 1 52126521 unclassified probably damaging 0.97
R4934:Stat1 UTSW 1 52153923 nonsense probably null
R5038:Stat1 UTSW 1 52123209 missense probably damaging 1.00
R5075:Stat1 UTSW 1 52122712 missense possibly damaging 0.73
R5223:Stat1 UTSW 1 52144242 missense probably damaging 1.00
R5600:Stat1 UTSW 1 52148942 missense probably benign 0.06
R5702:Stat1 UTSW 1 52150221 missense noncoding transcript
R5866:Stat1 UTSW 1 52139264 missense probably damaging 1.00
X0027:Stat1 UTSW 1 52139271 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice, Embryos, Sperm, gDNA
MMRRC Submission 011917-UCD
Last Updated 08/28/2017 10:59 AM by Anne Murray
Record Created unknown
Record Posted 01/04/2008
Phenotypic Description
The domino phenotype was identified in a screen for susceptibility to mouse cytomegalovirus (MCMV) (MCMV Susceptibility and Resistance Screen) (1). On day four following inoculation with a sublethal dose of MCMV (105 pfu), a 50% incidence of mortality is observed among homozygous domino mice, along with high splenic viral titers, and extensive necrosis of the spleen. These phenotypes are at least as severe as those observed in BALB/c mice, which lack the natural killer (NK) cell-activating receptor, Ly49H (2;3). NK cell cytotoxicity is also diminished in domino mice. Analysis of serum cytokine production induced 1.5 days after MCMV infection demonstrates increased levels of interleukin (IL)-12, type I interferon (IFN-α/β), and IFN-γ compared to wild type mice (Figure 1).
 
When infected with vesicular stomatitis virus (VSV) ex vivo, thioglycolate-elicited peritoneal macrophages from domino mice display a 25% survival rate, compared with greater than 75% survival of wild type macrophages. Heterozygous domino macrophages show an intermediate phenotype, with 50% survival after VSV infection. The susceptibility of heterozygous, but not homozygous, domino macrophages to VSV can be rescued by pretreatment with 1 U/ml of IFN-β. Notably, VSV-induced transcript levels of IFN-α and IFN-β are normal in domino homozygotes, although the IFN-responsive gene, usp18 (ubiquitin-specific peptidase 18), is not upregulated as observed in wild type cells.
 
After identification of a mutation in Stat1 as the causative genetic lesion in domino animals, IFN-γ-induced Stat1 phosphorylation was examined in domino macrophages. No phosphorylation (on Ser727 and Tyr701) could be detected in IFN-γ-stimulated domino macrophages, even 40 minutes after stimulation, whereas wild type macrophages showed robust phosphorylation.

 

Nature of Mutation
Because phenotypic analysis suggested a defect downstream of type I IFN production, cDNAs encoding the type I IFN receptor (IFNAR1 and IFNAR2, encoding the two receptor chains), TYK2, JAK1, STAT1 and STAT2 (major type I IFN receptor signaling pathway components) were sequenced. The domino mutation was found to correspond to a T to A transversion at position 1306 of the Stat1 transcript on Chromosome 1, in exon 11 of 25 total exons.
 
1290 CAGAGCTCCTTCGTGGTAGAACGACAGCCGTGC
314  -Q--S--S--F--V--V--E--R--Q--P--C-
 
The mutated nucleotide is indicated in red lettering, and results in a conversion of valine to glutamic acid at residue 319 of the STAT1 protein.
Protein Prediction
Figure 2. 3D and domain structure of the STAT1 protein. A) 3D representation of STAT1 based on crystalized structures of human STAT1 residues 1-683 (PDB 1YVL). The residue affected by the domino mutation is shown in red. 3D image was created using UCSF Chimera. B) Domain structure of STAT1. CC=Coiled Coil domain; DBD = DNA binding domain; LD = Linker domain; SH2=Src Homology 2 domain; TAD = Transcriptional activation domain. The critical tyrosine phosphorylation site is found at amino acid 701. The domino mutation causes a valine to glutamic acid substitution at residue 319. This image is interactive. Click on the image to view other mutations found in STAT1 (red). Click on the mutations for more specific information. Click on the 3D structure to view it rotate.
Signal transducer and activator of transcription (STAT)-1 is one of seven STAT family members identified in mammals, proteins which serve the dual functions of signal transduction and activation of transcription. STAT1 is a 755 amino acid protein, and like all STATs, contains an N-terminal helical domain (N-domain), a four helix bundle, a central Ig-like DNA binding domain, a helical linker domain, an SH2 domain, and a C-terminal transactivation domain (TAD) (Figure 2). A critical tyrosine phosphorylation site is found at approximately residue 700 of all STATs, between the SH2 domain and the C-terminal transactivation domain; in STAT1 this tyrosine is amino acid 701.
 
The crystal structure of the core protein fragment (residues 132-713, excluding the N-domain and the C-terminal TAD) of the tyrosine phosphorylated human STAT1 dimer bound to DNA has been solved (Figure 3), as well as that of the unphosphorylated protein (residues 1-683) complexed with an IFN-γ-derived phosphopeptide (Figure 4), revealing some of the functions of the domains (4;5). The four helix bundle forms a coiled-coil structure projecting outward from the DNA binding domain, and presents a predominantly hydrophilic surface area that likely mediates heterotypic protein-protein interactions (4). The DNA binding domain contains several β-sheets folded in a manner similar to the DNA binding domains of NF-κB or p53; these β-sheets are connected by loops that make contact with both the major and minor grooves of bound DNA (4). The linker domain has a highly conserved structure, but its function is unknown. The SH2 domain mediates dimerization of two STAT1 molecules via reciprocal binding to phosphorylated tyrosine 701 between the two monomers (4). No other protein contacts were observed in the phosphorylated DNA-bound dimer.
 
The N-domain serves at least two functions. Based on the crystal structure of the similar STAT4 amino terminus (residues 1-130), the N-domain is thought to allow STAT tetramer formation (6;7). Many genes contain tandem STAT binding sites approximately 20 amino acids apart, which are occupied by STAT tetramers (dimer-dimer pairs). Tetramer formation strengthens STAT-DNA interactions (8), and is necessary for optimal transcriptional activation of some promoters (9). In addition to this function, the N-domain is also reported to mediate antiparallel dimer formation of unphosphorylated STAT1 molecules prior to activation (5). N-domain interactions appear to stabilize interactions between the core protein fragments. Crystallographic studies of the mouse STAT5a core fragment (lacking the N-domain and TAD domain) support such N-domain interactions. STAT5a dimerizes in an antiparallel fashion similar to unphosphorylated STAT1, and FRET measurements demonstrate that STAT5a N-domains separate after activation and nuclear translocation (10).
 
The C-terminal TAD in all STATs is relatively acidic and proline-rich, and is therefore structurally flexible. The TAD is thought to mediate interactions of STATs with other transcriptional machinery. For example, the STAT6 TAD has been reported to bind directly to the transcriptional coactivator nuclear coactivator 1 (NCoA-1), and has been crystallized in this complex (11). The TAD also contains a serine residue, conserved in a subset of STATs, which must be phosphorylated full STAT activation (12;13).
 
The Stat1 gene undergoes alternative splicing at its 3’ end, yielding two isoforms designated α and β. The α isoform encodes the full length protein, but the β isoform is truncated by 38 amino acids in the C-terminal TAD (14). Because of this, STAT1β lacks the phosphoserine residue in the TAD, but it can still be tyrosine phosphorylated, form homo- and heterodimers, and bind DNA.
 
The domino mutation causes substitution of valine 319 with glutamic acid. Valine 319 lies at the beginning of the DNA binding domain (residues 317-488), and is conserved among all STATs except STAT5α and STAT5β (Figure 2).
Expression/Localization
Stat1 transcript is detectable by RT-PCR in most tissues examined. The protein is cytosolic until activation results in its translocation to the nucleus.
Background
STAT1 was the first STAT family protein to be identified as a member of an IFN-α-responsive transcriptional activator complex (14;15) (see the record for macro-1). Since then, seven STAT family proteins have been discovered, all of which are transcription factors found latent in the cytoplasm until they are activated by extracellular signaling proteins such as cytokines, growth factors and peptides [reviewed in (16)]. Stimulation by these extracellular signaling proteins leads to activation of intracellular tyrosine kinases that in turn phosphorylate STATs, causing them to move into the nucleus and activate transcription of target genes.
 
Figure 5. JAK-STAT Pathway. Cytokine receptors are associated with the normally dephosphorylated and inactive JAK tyrosine kinases. Latent STAT1 exists in the cytoplasm as a monomer. Upon receptor stimulation, JAK proteins phosphorylate the receptor cytoplasmic domains. STAT proteins are recruited to the receptor, tyrosine phosphorylated by JAKs, and dimerize for translocation to the nucleus with the assistance of importin-α5 (associated with importin-β). Once STAT1 binds to its DNA target, importin-α5 is recycled to the cytoplasm by the cellular apoptosis susceptibility protein (CAS) export receptor. Suppressors of cytokine signaling (SOCS) proteins can directly bind and suppress JAKs or can compete with STATs for receptor binding. The tyrosine phosphatases SHP1 and SHP2 inhibit signaling by dephosphorylating STAT proteins.
The canonical signaling pathway activating STAT proteins, called the JAK (Janus kinase)-STAT pathway (Figure 5), begins with the binding of one or more cytokines to their cognate cell-surface receptors. These receptors are associated with JAK tyrosine kinases, which are normally dephosphorylated and inactive. Receptor stimulation results in dimerization/oligomerization and subsequent apposition of JAK proteins, which are now capable of trans-phosphorylation as they are brought in close proximity. This activates JAKs to phosphorylate the receptor cytoplasmic domains, creating phosphotyrosine ligands for the SH2 domains of STAT proteins. Once recruited to the receptor, STAT proteins are also tyrosine phosphorylated by JAKs, a phosphorylation event which occurs on a single tyrosine residue that is found at around residue 700 of all STATs. Tyrosine phosphorylation of STATs may allow formation and/or conformational reorganization of the activated STAT dimer, involving reciprocal SH2 domain-phosphotyrosine interactions between STAT monomers. In addition to tyrosine phosphorylation, several STATs including STAT1, also require phosphorylation on a serine in the TAD for full activation (12;13). In STAT1, this serine is residue 727, and it exists within a consensus MAPK phosphorylation site (12). Although STAT activation downstream of cytokine receptors in the JAK-STAT pathway is the best studied, STATs may also be activated by other means, including growth factor receptors [e.g. epidermal growth factor (EGF) and platelet-derived growth factor (PDGF) receptors] potentially through the function of the Src nonreceptor tyrosine kinase, and by G-protein coupled seven-transmembrane receptors (17-19).
 
Phosphorylated, activated STATs enter the nucleus and accumulate there to promote transcription (20). They do so by facilitated transport involving importin-α5, a subunit of the nucleocytoplasmic transport machinery (21). Despite the requirement for facilitated transport, nuclear accumulation of STATs is rapid, with for example 20-25% of total STAT1 found in the nucleus by thirty minutes after receptor stimulation (22). Interestingly, it has been postulated that importin-bound STAT dimers cannot bind DNA, and that DNA binding may be necessary for release of STATs from importins (21). Termination of transcriptional activation appears to require nuclear dephosphorylation by at least one nuclear phosphatase, TC45 (23). MEFs from mice deficient in TC45 retain tyrosine phosphorylated STAT1 longer than wild type cells (23). Once dephosphorylated, STAT1 may be exported through the chromosome region maintenance 1 (CRM1) export receptor (24). Additional STAT protein nuclear inhibitors are the PIAS (protein inhibitor of activated STAT) proteins (25). PIAS proteins interact directly with phosphorylated STATs and block DNA binding.
 
Termination of STAT signaling requires ending both transcriptional activation and cytoplasmic STAT signaling. In the cytoplasm, there are several mechanisms to halt signaling. First, the suppressors of cytokine signaling (SOCS) proteins can directly bind and suppress JAKs or can compete with STATs for receptor binding (26;27). SOCS proteins are induced transcriptionally by cytokine stimulation, and recruited to active receptor complexes to induce inhibition. Second, protein tyrosine phosphatases including SHP1 and SHP2 prevent further cytoplasmic STAT tyrosine phosphorylation (28;29). Third, the β isoforms of some STATs can function as dominant negative inhibitors in certain circumstances. STAT1β apparently activates a distinct set of genes from STAT1α, and STAT1β fails to complement impaired IFN-γ-induced α-specific gene activation in STAT1-deficient cells (30).
Putative Mechanism
Study of mice with mutations or targeted deletion of Stat1 demonstrates that an important physiological function of STAT1 is in the control of microbial infections. Stat1-/- mice have no gross developmental abnormalities, but are highly sensitive to bacterial and viral infections such as Listeria monocytogenes and VSV infection (31;32). Cells from these mice are unresponsive to IFN-α and IFN-γ, although they respond normally to several other stimuli including EGF and interleukin 10 (31;32). In humans, rare STAT1 deficiency and several STAT1 point mutations have been identified in patients with recurrent bacterial and/or viral infections (33-35). Cells from these patients fail to respond to IFN-α or IFN-γ. Interestingly, one patient with complete STAT1 deficiency was able to clear at least some viruses including polio virus type III (from vaccination) and parainfluenza type II (35).
 
Unexpectedly, Stat1-/- mice have increased bone mass compared to wild type mice. IFN-α/β and IFN-γ negatively regulate osteoclastogenesis, and although STAT1-deficient mice display excessive osteoclastogenesis, the bone mass of Stat1-/- mice is increased (36). The increase is actually due to excessive osteoblast differentiation caused by increased activity of the transcription factor Runx1, which is normally inhibited by STAT1 in the cytoplasm (36).
 
STAT1-deficient mice are also more susceptible to chemically induced tumors and develop tumors that are more immunogenic than wild type mice (37;38), as might be expected given the role of STATs in both regulating innate immune responses and signaling from growth factor receptors to the nucleus. Human cancer cells frequently exhibit unregulated, activated STAT signaling, supporting a role for STATs in promoting oncogenesis (39).
 
The domino mutation changes a highly conserved amino acid located at the beginning of the DNA binding domain. It is the first point mutation, outside of point mutations of the SH2 domain or TAD domain (5;21;40;41), to block tyrosine and serine phosphorylation of STAT1 and impair STAT1 function. Based on the crystal structure of STAT1 (4), valine 319 does not contact DNA directly, but is found within a β-strand that lies in the hydrophobic core of the STAT1 structure (Figure 2). This core has been postulated to fuse the four domains of the core STAT1 protein fragment together via extensive interdomain interfaces, thereby holding the protein in its proper structure (4). The mutation may destabilize the DNA binding domain of STAT1, if not the entire protein, resulting in impaired protein function. Stat1domino/domino mice are useful for testing the requirement for IFN signaling in physiological processes. For example, they were crossed to Kcnj8mayday/mayday mice to demonstrate that IFN signaling is not required for the rapid and sudden death induced by mouse cytomegalovirus infection in these animals.
Primers Primers cannot be located by automatic search.
Genotyping
Domino genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. The same primers used for PCR amplification can be used for sequencing.
 
Primers for PCR amplification
Dom(F): 5’- CTACACTTGCAGCCCACGTTACTTCTACC -3’
Dom(R): 5’- ATGAAAGGGCTAGATGTATTCCAGCACTTG -3’
 
PCR program
1) 94°C             1:00
2) 94°C             0:30
3) 60°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 35X
6) 72°C             5:00
7) 4°C              ∞
 
Primers for sequencing
Dom_seq(F): 5’- CAATGCTCCAATGTTTTTATAGCCTTTC -3’
Dom_seq(R): 5’- TGAAAGGGCTAGATGTATTCCAGCAC -3’
 
The following sequence of 431 nucleotides (from Genbank genomic region NC_000067 for linear genomic sequence of Stat1) is amplified:
 
20948        cta cacttgcagc ccacgttact tctacccagt ttgtcagact ctcaaaatat
21001 tactcaatgc tccaatgttt ttatagcctt tcaagttttc cgtctattgt ctctgtaggg
21061 agaagttact aatttatttt tttactgtgt taactgtgat gcaaaagcta atttatctgt
21121 gtttccgggt cactgacagc tccttcgtgg tagaacgaca gccgtgcatg cccactcacc
21181 cgcagaggcc cctggtcttg aagactgggg tacagttcac tgtcaagctg aggtaacgaa
21241 catagagctc catatgctgc ctgtcccaga atttgtgcct ttaatccgcc cccttctttt
21301 tttcatccca acttgcttca aatatataat actcctggct cagcttgcca agtgctggaa
21361 tacatctagc cctttcat
 
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is shown in red text.
References
Science Writers Eva Marie Y. Moresco
Illustrators Diantha La Vine, Peter Jurek, Katherine Timer
AuthorsKarine Crozat, Bruce Beutler
Edit History
01/04/2011 1:59 PM (current)
01/04/2011 1:59 PM
07/22/2010 8:17 AM
02/03/2010 9:21 AM