Phenotypic Mutation 'Dunn'

• Allele: Dunn
• Mutation Type: missense
• Chromosome: 11
• Coordinate: 97,263,950 bp (GRCm39)
• Base Change: T ⇒ C (forward strand)
• Gene: Socs7
• Gene Name: suppressor of cytokine signaling 7
• Synonym(s): Nap4, 2310063P06Rik
• Chromosomal Location: 97,253,261-97,289,368 bp (+) (GRCm39)
• MGI Phenotype: PHENOTYPE: Homozygous null mice display partial penetrance of hydroencephaly, premature death, intracranial hemorrhage, abnormally large islets of Langerhans and fully penetrant disorganization of the subcommissural organ and reduced body weight. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Phenylalanine changed to Leucine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000040896]
• AlphaFold: Q8VHQ2
• SMART Domains: Protein: ENSMUSP00000040896; Gene: ENSMUSG00000038485; AA Change: F281L

Domain	Start	End	E-Value	Type
low complexity region	7	23	N/A	INTRINSIC
low complexity region	54	72	N/A	INTRINSIC
low complexity region	76	104	N/A	INTRINSIC
low complexity region	113	128	N/A	INTRINSIC
low complexity region	136	168	N/A	INTRINSIC
low complexity region	181	193	N/A	INTRINSIC
low complexity region	220	237	N/A	INTRINSIC
low complexity region	298	317	N/A	INTRINSIC
low complexity region	340	355	N/A	INTRINSIC
SH2	396	482	1.89e-19	SMART
SOCS	507	550	3.07e-19	SMART
SOCS_box	513	549	7.37e-9	SMART

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)
  (Using ENSMUST00000045540)
• Meta Mutation Damage Score: 0.1125
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Dominant
• Mode of Inheritance: Autosomal Dominant
• Last Updated: 2019-09-04 9:44 PM by Anne Murray
• Record Created: 2016-01-13 11:53 AM
• Record Posted: 2018-04-11
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine, Peter Jurek
• Authors: Emre Turer and Bruce Beutler

Accession Number

NCBI RefSeq: NM_138657; MGI:2651588

Alleles Listed at MGI

All Mutations and Alleles(14) : Gene trapped(4) Targeted(10)

Phenotypic Description

Figure 1. Dunn mice exhibited body weights compared to wild-type littermates. Scaled weight data are shown. Abbreviations: REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Dunn phenotype was identified among G3 mice of the pedigree R2145, some of which showed reduced body weights compared to wild-type littermates (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced body weights using a dominant model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 113 mutations (X-axis) identified in the G1 male of pedigree R2145. Scaled phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 113 mutations. The body weight phenotype was linked to a mutation in Socs7: a T to C transition at base pair 97,373,124 (v38) on chromosome 11 corresponding to base pair 10,829 in the GenBank genomic region NC_000077 encoding Socs7. Linkage was found with a dominant model of inheritance (P = 2.414 x 10^-5), wherein four variant homozygotes and 12 heterozygous mice departed phenotypically from two homozygous reference mice (Figure 2).

The mutation corresponds to residue 932 in the mRNA sequence NM_138657 within exon 2 of 10 total exons.

917 TCCTTCAGCCCCCTGTTCACAGGTGAGACAGTA 276 -S--F--S--P--L--F--T--G--E--T--V-

The mutated nucleotide is indicated in red.  The mutation results in a phenylalanine (F) to leucine (L) substitution at position 281 (F281L) in the SOCS7 protein, and is strongly predicted by PolyPhen-2 to be benign (score = 0.147).

Protein Prediction

Figure 3. Domain structure of SOCS7. The location of the SH2 domain and the SOCS box are indicated. The mutation in the Dunn mice results in a phenylalanine (F) to leucine (L) substitution at position 281 (F281L).

Socs7 encodes suppressor of cytokine signaling 7 (SOCS7), a member of the SOCS family. There are eight known members of the SOCS family (SOCS1-SOCS7 and CIS). SOCS6 and SOCS7 share a high degree of identity within the SH2 and SOCS-box domains (56% identity and 53% identity, respectively). The high degree of identity is proposed to mediate putative overlapping functions between the two proteins.

Each member of the SOCS family has a variable length N-terminus, a central SH2 domain (amino acid 398-507), and a highly conserved C-terminal SOCS-box motif (amino acid (502-552) [Figure 3; (1;2)]. SOCS7 has a putative nuclear localization signal, proline-rich regions (amino acids 82-202 and 301-381), poly-proline regions (amino acids 84-97, 301-310, and 341-348), poly-glycine regions (amino acids 141-149), and poly-glutamine regions (amino acids 181-185) within the length of the protein (3). The poly-proline regions at the SOCS7 N-terminus mediate associations with SH3 domain-containing proteins.

The SH2 domain of SOCS7 is required for SOCS7 function and binds to tyrosine phosphorylated sites of JAK kinases (see the record mount_tai for information about JAK3), cytokine receptors, growth hormone receptors, and STATs (see the record for domino for information about STAT1) after cytokine stimulation (1;2;4;5). The SH2 domain preferentially binds to phosphopeptides containing a valine in the phosphotyrosine (pY) +1 position and a hydrophobic residue in the pY +2 and pY +3 positions (6). Yeast two-hybrid has identified several SOCS7-interacting proteins, including the tyrosine kinases epidermal growth factor receptor (EGFR; see the record for Velvet), Lck (see the record for iconoclast), and Hck; insulin receptor substrate 4 (IRS4) and IRS2; the p85 regulatory subunit of PI3K; phospholipase C-γ (PLC-γ; see the record for queen) (7); the multiple SH3 domain–containing cytoskeletal protein vinexin; the signaling molecules growth receptor-binding protein 2 (Grb-2) and STAT3; and the adaptor protein Nck (3;6;8).

The SOCS-box is essential for the inhibitory functions of the SOCS proteins as well as to maintain protein stability (5). The SOCS-box can interact with elongin B and C to form a complex with members of the cullin and Rbx families (5;9;10). Upon SOCS7 binding to elongin B/C, the elongin C associates with cullin2 or cullin5 and Rbx1 to form a complex that can function as an E3 ubiquitin ligase, which mediates the degradation of target proteins by the proteasome (11).

A SOCS7 variant, NAP-4 (Nck-, Ash-, and PLC-γ-binding protein 4), was identified as a Nck binding partner in human brain, fetal lung fibroblasts, and leukocytes (3). NAP-4 also exhibited an affinity for Ash and PLC-γ (3). NAP4 has an SH2 domain, proline-rich sequences, a putative nuclear localization signal, and a Q-run/P-run composite, a motif specific to nuclear proteins.

The Socs7 mutation in the Dunn mice results in a phenylalanine (F) to leucine (L) substitution at position 281 (F281L). F281 is within the N-terminal region, but is not within a defined domain.

Expression/Localization

Quantification of Socs7 expression levels in the mouse by quantitative real-time PCR determined that Socs7 was expressed at high levels in whole brain, isolated pancreatic islets, and skeletal muscle; lower levels were expressed in the liver, whole pancreas, perigonadal fat, skin, and spleen (12). Socs7 expression analysis by Northern blot determined that Socs7 is expressed at high levels in skeletal muscle, brain, kidney, and testis, but at lower levels in other tissues (12).

Expression of Socs7 in resting cells is low, but exposure to cytokines, hormones, and growth factors stimulates the expression of Socs7. In C57BL mice, Socs7 mRNA levels were increased by 4-fold in the muscle, and reduced by half in C57BL whole brain after insulin stimulation, indicating that Socs7 is regulated by insulin signaling. The regulation occurs in a strain-dependent manner, as 129S6 mice stimulated with insulin exhibited a reduction of Socs7 by a third in the muscle, but a 2.5-induction in the whole brain.

Background

Figure 4. The JAK-STAT Pathway. Cytokine receptors are associated with the normally dephosphorylated and inactive JAK tyrosine kinases. Latent STAT1 exists in the cytoplasm as a monomer. Upon receptor stimulation, JAK proteins phosphorylate the receptor cytoplasmic domains. STAT proteins are recruited to the receptor, tyrosine phosphorylated by JAKs, and dimerize for translocation to the nucleus with the assistance of importin-α5 (associated with importin-β). Once STAT1 binds to its DNA target, importin-α5 is recycled to the cytoplasm by the cellular apoptosis susceptibility protein (CAS) export receptor. Suppressors of cytokine signaling (SOCS) proteins can directly bind and suppress JAKs or can compete with STATs for receptor binding. The tyrosine phosphatases SHP1 and SHP2 inhibit signaling by dephosphorylating STAT proteins.

Cytokines regulate growth, differentiation, metabolism, and the immune system. Upon receptor binding, cytokines activate the JAK (Janus kinase)-STAT pathway (Figure 4). The cytokine receptors are associated with JAK tyrosine kinases, which are normally dephosphorylated and inactive. Receptor stimulation results in dimerization/oligomerization and subsequent apposition of JAK proteins, which are now capable of trans-phosphorylation as they are brought in close proximity. This activates JAKs to phosphorylate the receptor cytoplasmic domains, creating phosphotyrosine ligands for the SH2 domains of STAT proteins. Once recruited to the receptor, STAT proteins are also tyrosine phosphorylated by JAKs, a phosphorylation event which occurs on a single tyrosine residue that is found at around residue 700 of all STATs. Tyrosine phosphorylation of STATs may allow formation and/or conformational reorganization of the activated STAT dimer, involving reciprocal SH2 domain-phosphotyrosine interactions between STAT monomers. Although STAT activation downstream of cytokine receptors in the JAK-STAT pathway is the best studied, STATs may also be activated by other means, including growth factor receptors [e.g., EGF and platelet-derived growth factor (PDGF) receptors] potentially through the function of the Src nonreceptor tyrosine kinase, and by G-protein coupled seven-transmembrane receptors (13-15). Phosphorylated, activated STATs enter the nucleus and accumulate there to promote transcription (16). For more information on JAK-STAT signaling, see the record for domino.

Termination of STAT signaling requires ending both transcriptional activation and cytoplasmic STAT signaling. Protein tyrosine phosphatases including SHP1 (see the record for styx) and SHP2 prevent further cytoplasmic STAT tyrosine phosphorylation (17;18). SOCS proteins are recruited to active receptor complexes to induce inhibition. The SOCS proteins can directly bind via phosphorylated tyrosine residues on the receptor and suppress JAKs, or can compete with STATs for receptor binding (19;20).

Figure 5. Signaling activated by leptin. Upon leptin binding to OB-Rb, JAK2 at the OB-R box 1 motif is activated. JAK2 auto-phosphorylates itself, as well as specific tyrosine residues on the intracellular domain of OB-Rb (Tyr974, Tyr985, Tyr1077 and Tyr1138) to provide docking sites for signaling proteins containing Src homology 2 (SH2) domains. Each phosphorylated tyrosine residue then recruits and activates a distinct set of downstream signaling proteins. The phosphorylated tyrosine residues Tyr1077 and Tyr1138 bind and activate signal transducer and activator of transcription (STAT) proteins. The other two phosphorylated residues Tyr974 and Tyr985 recruit SH2 domain-containing phosphatase 2 (SHP2). SHP2 then activates the mitogen-activated protein kinase (MAPK) pathways including extracellular signal-regulated kinase (ERK1/2), p38, MAPK and p42/44 MAPK pathways through interaction with the adaptor protein growth factor receptor-bound protein 2 (GRB2). The auto-phosphorylated JAK2 at the box 1 motif can phosphorylate insulin receptor substrate1/2 (IRS1/2) that leads to activation of phosphatidylinositol 3-kinase (PI3K)/Akt and the MAPK pathways. OB-Rb has also been reported to signal via the AMP-activated protein kinase (AMPK) pathway. OB-Rb activation induces transcription of the specific suppressor of SOCS3 in the hypothalamic area by direct binding of STAT3 to its response element. SOCS3 is an SH2 domain-containing protein that can bind phosphorylated Tyr985 on OB-Rb and other sites on JAK2 to inhibit leptin receptor signaling.

SOCS7 can inhibit JAK2/STAT3 (12;21) and JAK2/STAT5 (21;22), inhibit prolactin- and leptin-induced STAT5 and STAT3 phosphorylation (21), and alter the nuclear localization of pSTAT3 (21;23).

Through interaction with STAT3 and STAT5, SOCS7 inhibits prolactin, growth hormone (see the record for gnome), or leptin (see the record for Potbelly) signaling (21). SOCS7 is one of several SOCS proteins (i.e., SOCS1, SOCS3, and SOCS6) that function in the attenuation of leptin signaling (12). The growth hormone- and prolactin-associated signaling pathways transduce through the JAK2/STAT5 pathway, while leptin transduces through JAK2/STAT3. Leptin, a systemic hormone, regulates multiple functions of the body including energy utilization and storage, various endocrine axes, bone metabolism, thermoregulation, angiogenesis, immunity and inflammation [reviewed in (24-26)]. Leptin exerts its action on the body by binding to the long form of the leptin receptor, OB-Rb, and initiating various signal transduction pathways [Figure 5; (27)]. Upon leptin binding to OB-Rb, JAK2 is activated (28;29). JAK2 auto-phosphorylates itself, as well as specific tyrosine residues on the intracellular domain of OB-Rb (Tyr974, Tyr985, Tyr1077 and Tyr1138) to provide docking sites for signaling proteins containing Src homology 2 (SH2) domains.  Each phosphorylated tyrosine residue then recruits and activates a distinct set of downstream signaling proteins.  The phosphorylated tyrosine residues Tyr1077 and Tyr1138 bind and activate signal transducer and activator of transcription (STAT) proteins. Both Tyr1077 and Tyr1138 bind to STAT5, while only Tyr1138 recruits STAT1 and STAT3 (30). The other two phosphorylated residues Tyr974 and Tyr985 recruit SH2 domain-containing phosphatase 2 (SHP2). SHP2 then activates the mitogen-activated protein kinase (MAPK) pathways including extracellular signal-regulated kinase (ERK1/2), p38, MAPK and p42/44 MAPK pathways through interaction with Grb2 (30;31). The auto-phosphorylated JAK2 at the box 1 motif can phosphorylate insulin receptor substrate1/2 (IRS1/2) that leads to activation of phosphatidylinositol 3-kinase (PI3K)/Akt and the MAPK pathways. OB-Rb has also been reported to signal via the AMP-activated protein kinase (AMPK) pathway (30;31). In the hypothalamus, leptin binding to OB-Rb on the appropriate neurons, including the ARC and VMH nuclei, causes diminished feeding activity, and accelerated basal metabolic rate by regulating numerous neuropeptides involved in feeding. Other CNS functions of leptin include direct leptin signaling in areas of the brain regulating motivation to feed, and indirect regulation of gonadotropin-releasing hormone (GnRH) neurons of the neuroendocrine reproductive axis, and of the activity of the sympathetic nervous system. 

Figure 6. Inhibition of insulin signaling pathway by SOCS7. SOCS7 interferes with the binding between the insulin receptor and IRS1/2 proteins. SOCS7 also inhibits the tyrosine kinase activity of the insulin receptor. SOCS7 can interact with the tyrosine-phosphorylated IRS proteins leading to their degradation by the proteasome. The resulting effect is a decrease in the insulin-induced activation of the IRS1/2-PI3K-PKB axis leading to a reduction in the metabolic effects of insulin.

In insulin/IGF-1-associated signaling, insulin or IGF-1 binds to their respective receptors, stimulating receptor autophosphorylation and activation (Figure 6). After activation, the insulin or IGF-1 receptor phosphorylates downstream targets including insulin receptor substrate (IRS) family members. Phosphorylated IRS proteins then bind to SH2 domain-containing proteins including Grb-2, Nck, SHP-2, and the p85 subunit of PI3K. Insulin and IGF-1-associated signaling regulate several cellular processes, including survival, proliferation, transport of GLUT-4 from intracellular vesicles to the plasma membrane, and glycogen synthesis. The SOCS proteins inhibit insulin signaling by binding to the insulin receptor via the SH2 domain, by inhibiting insulin receptor tyrosine kinase activity, and/or by targeting insulin receptor substrate-1 (IRS-1) and IRS-2 for proteasomal degradation. SOCS7 coimmunoprecipitates with both IRS-1 and the insulin receptor (INSR) (12).

SOCS7 mediates the nuclear transport of Nck. The septin 2/6/7 complex restricts the nuclear accumulation of Nck by interacting with SOCS7 to maintain it in the cytoplasm (32). Loss of septin filaments allows for SOCS7 to recruit Nck into the nucleus. Actin and septin rearrangement as well as nuclear accumulation of Nck and SOCS7 occurs after DNA damage. The septin-SOCS7-Nck axis intersects with the canonical DNA damage cascade downstream of ATM/ATR and is essential for p53 Ser15 phosphorylation.

Socs7-deficient (Socs7^-/-) mice exhibit improved glucose tolerance and increased insulin sensitivity compared to wild-type mice (12). The Socs7^-/- mice had increased pancreatic islet size. Mouse embryonic fibroblasts (MEFs) from the Socs7^-/- mice also exhibited increased insulin-induced adipogenesis. The increased insulin action upon loss of Socs7 expression is proposed to be due to altered IRS protein stability (12). Approximately 50% of Socs7^-/- mice on the 129/Bl6 mixed background developed severe dermatitis characterized by loss of hair and whiskers, skin thickening, and excoriation (22). Histopathology of the affected regions determined that there was an increased number of skin mast cells as well as increased of mast cell degranulation compared to disease-free skin of Socs7^-/- mice (22). Furthermore, there was increased amount of IgG1 and IgE levels in the serum of the affected mice (22). The increased Ig production was attributed to elevated production of TSLP, an IL-7-like cytokine that promotes B cell growth and differentiation, which resulted in an IgG1 and IgE class switching.

Significant associations between SOCS7 common variants (rs8074124 and rs12051836) and obesity, insulin resistance, and lipid metabolism disorders have been found in nondiabetic men from Argentina (33).

Putative Mechanism

On a mixed genetic background (129S6 x C57BL), the Socs7^-/- mice were comparable in length, weight, and body composition to wild-type mice up to six months of age (12). Socs7^-/- mice on the C57BL background exhibited hydrocephalus and growth retardation as well as hypoglycemia, which led to perinatal lethality within 15 weeks of age (34). Socs7^-/- mice on the C57BL background were normal at birth, but between weeks 3-15 they exhibited lethargy and weight loss with macrocephalus. Some of the mice with hydrocephalus did not exhibit enlargement of the cranium, but postmortem examination showed increased levels of ventricular cerebrospinal fluid. Postmortem examination of the mice also showed that organs from the Socs7^-/- mice were smaller than those from wild-type littermates. The Socs7^-/- mice weighed an average of 7-10% less than sex-matched wild-type and heterozygous mice from 4-14 weeks of age (34). The phenotype of the Dunn mice indicates that SOCS7^Dunn exhibits loss of function.

Primers

PCR Primer
Dunn_pcr_F: AGGCTTTATTACAGAAGTGTTGCC
Dunn_pcr_R: GCAGCCTTTACCTTCCAGTG

Sequencing Primer
Dunn_seq_F: CAGAAGTGTTGCCAATATGTCTG
Dunn_seq_R: AGCCTTTACCTTCCAGTGTAATGG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 412 nucleotides is amplified (chromosome 11, + strand):

1   aggctttatt acagaagtgt tgccaatatg tctgtaataa agggtttgct ttgtgattca
61  ggaggtctgg aatccagtgt tctagtgatt taactgcata tgtgttcgtt tcccctagga
121 aacccaggtt gacaagaact caaagtgcct tttccccggt ctccttcagc cccctgttca
181 caggtaagga ccctgtcttt ctctctactc tgacaactga aagtgggggt gtcctgagac
241 ctcgcagcaa acacccttgc atggcattgc tgggggagct ctagtctcct ctcctctctg
301 gctgtctgta atagtttcct tcatcccatg cccctgggtt tggggaggtt ttcctggcat
361 atggagtgtg tgctttgatt tcagatccat tacactggaa ggtaaaggct gc

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Minamoto, S., Ikegame, K., Ueno, K., Narazaki, M., Naka, T., Yamamoto, H., Matsumoto, T., Saito, H., Hosoe, S., and Kishimoto, T. (1997) Cloning and Functional Analysis of New Members of STAT Induced STAT Inhibitor (SSI) Family: SSI-2 and SSI-3. Biochem Biophys Res Commun. 237, 79-83.

  2. Masuhara, M., Sakamoto, H., Matsumoto, A., Suzuki, R., Yasukawa, H., Mitsui, K., Wakioka, T., Tanimura, S., Sasaki, A., Misawa, H., Yokouchi, M., Ohtsubo, M., and Yoshimura, A. (1997) Cloning and Characterization of Novel CIS Family Genes. Biochem Biophys Res Commun. 239, 439-446.

  3. Matuoka, K., Miki, H., Takahashi, K., and Takenawa, T. (1997) A Novel Ligand for an SH3 Domain of the Adaptor Protein Nck Bears an SH2 Domain and Nuclear Signaling Motifs. Biochem Biophys Res Commun. 239, 488-492.

  4. Biener, E., Maurice, S., Sandowski, Y., Cohen, Y., Gusakowsky, E. E., Hooghe, R., Yoshimura, A., Livnah, O., and Gertler, A. (2002) Recombinant Human CIS2 (SOCS2) Protein: Subcloning, Expression, Purification, and Characterization. Protein Expr Purif. 25, 305-312.

  5. Greenhalgh, C. J., Rico-Bautista, E., Lorentzon, M., Thaus, A. L., Morgan, P. O., Willson, T. A., Zervoudakis, P., Metcalf, D., Street, I., Nicola, N. A., Nash, A. D., Fabri, L. J., Norstedt, G., Ohlsson, C., Flores-Morales, A., Alexander, W. S., and Hilton, D. J. (2005) SOCS2 Negatively Regulates Growth Hormone Action in Vitro and in Vivo. J Clin Invest. 115, 397-406.

  6. Krebs, D. L., Uren, R. T., Metcalf, D., Rakar, S., Zhang, J. G., Starr, R., De Souza, D. P., Hanzinikolas, K., Eyles, J., Connolly, L. M., Simpson, R. J., Nicola, N. A., Nicholson, S. E., Baca, M., Hilton, D. J., and Alexander, W. S. (2002) SOCS-6 Binds to Insulin Receptor Substrate 4, and Mice Lacking the SOCS-6 Gene Exhibit Mild Growth Retardation. Mol Cell Biol. 22, 4567-4578.

  7. Martens, N., Wery, M., Wang, P., Braet, F., Gertler, A., Hooghe, R., Vandenhaute, J., and Hooghe-Peters, E. L. (2004) The Suppressor of Cytokine Signaling (SOCS)-7 Interacts with the Actin Cytoskeleton through Vinexin. Exp Cell Res. 298, 239-248.

  8. Sasi, W., Ye, L., Jiang, W. G., Sharma, A. K., and Mokbel, K. (2014) In Vitro and in Vivo Effects of Suppressor of Cytokine Signalling 7 Knockdown in Breast Cancer: The Influence on Cellular Response to Hepatocyte Growth Factor. Biomed Res Int. 2014, 648040.

  9. Vesterlund, M., Zadjali, F., Persson, T., Nielsen, M. L., Kessler, B. M., Norstedt, G., and Flores-Morales, A. (2011) The SOCS2 Ubiquitin Ligase Complex Regulates Growth Hormone Receptor Levels. PLoS One. 6, e25358.

  10. Zhang, J. G., Farley, A., Nicholson, S. E., Willson, T. A., Zugaro, L. M., Simpson, R. J., Moritz, R. L., Cary, D., Richardson, R., Hausmann, G., Kile, B. J., Kent, S. B., Alexander, W. S., Metcalf, D., Hilton, D. J., Nicola, N. A., and Baca, M. (1999) The Conserved SOCS Box Motif in Suppressors of Cytokine Signaling Binds to Elongins B and C and may Couple Bound Proteins to Proteasomal Degradation. Proc Natl Acad Sci U S A. 96, 2071-2076.

  11. Kamura, T., Burian, D., Yan, Q., Schmidt, S. L., Lane, W. S., Querido, E., Branton, P. E., Shilatifard, A., Conaway, R. C., and Conaway, J. W. (2001) Muf1, a Novel Elongin BC-Interacting Leucine-Rich Repeat Protein that can Assemble with Cul5 and Rbx1 to Reconstitute a Ubiquitin Ligase. J Biol Chem. 276, 29748-29753.

  12. Banks, A. S., Li, J., McKeag, L., Hribal, M. L., Kashiwada, M., Accili, D., and Rothman, P. B. (2005) Deletion of SOCS7 Leads to Enhanced Insulin Action and Enlarged Islets of Langerhans. J Clin Invest. 115, 2462-2471.

  13. Vignais, M. L., Sadowski, H. B., Watling, D., Rogers, N. C., and Gilman, M. (1996) Platelet-Derived Growth Factor Induces Phosphorylation of Multiple JAK Family Kinases and STAT Proteins. Mol Cell Biol. 16, 1759-1769.

  14. Leaman, D. W., Pisharody, S., Flickinger, T. W., Commane, M. A., Schlessinger, J., Kerr, I. M., Levy, D. E., and Stark, G. R. (1996) Roles of JAKs in Activation of STATs and Stimulation of c-Fos Gene Expression by Epidermal Growth Factor. Mol Cell Biol. 16, 369-375.

  15. Madamanchi, N. R., Li, S., Patterson, C., and Runge, M. S. (2001) Thrombin Regulates Vascular Smooth Muscle Cell Growth and Heat Shock Proteins Via the JAK-STAT Pathway. J Biol Chem. 276, 18915-18924.

  16. Schindler, C., Shuai, K., Prezioso, V. R., and Darnell, J. E.,Jr. (1992) Interferon-Dependent Tyrosine Phosphorylation of a Latent Cytoplasmic Transcription Factor. Science. 257, 809-813.

  17. David, M., Chen, H. E., Goelz, S., Larner, A. C., and Neel, B. G. (1995) Differential Regulation of the alpha/beta Interferon-Stimulated Jak/Stat Pathway by the SH2 Domain-Containing Tyrosine Phosphatase SHPTP1. Mol Cell Biol. 15, 7050-7058.

  18. You, M., Yu, D. H., and Feng, G. S. (1999) Shp-2 Tyrosine Phosphatase Functions as a Negative Regulator of the Interferon-Stimulated Jak/STAT Pathway. Mol Cell Biol. 19, 2416-2424.

  19. Endo, T. A., Masuhara, M., Yokouchi, M., Suzuki, R., Sakamoto, H., Mitsui, K., Matsumoto, A., Tanimura, S., Ohtsubo, M., Misawa, H., Miyazaki, T., Leonor, N., Taniguchi, T., Fujita, T., Kanakura, Y., Komiya, S., and Yoshimura, A. (1997) A New Protein Containing an SH2 Domain that Inhibits JAK Kinases. Nature. 387, 921-924.

  20. Naka, T., Narazaki, M., Hirata, M., Matsumoto, T., Minamoto, S., Aono, A., Nishimoto, N., Kajita, T., Taga, T., Yoshizaki, K., Akira, S., and Kishimoto, T. (1997) Structure and Function of a New STAT-Induced STAT Inhibitor. Nature. 387, 924-929.

  21. Martens, N., Uzan, G., Wery, M., Hooghe, R., Hooghe-Peters, E. L., and Gertler, A. (2005) Suppressor of Cytokine Signaling 7 Inhibits Prolactin, Growth Hormone, and Leptin Signaling by Interacting with STAT5 Or STAT3 and Attenuating their Nuclear Translocation. J Biol Chem. 280, 13817-13823.

  22. Knisz, J., Banks, A., McKeag, L., Metcalfe, D. D., Rothman, P. B., and Brown, J. M. (2009) Loss of SOCS7 in Mice Results in Severe Cutaneous Disease and Increased Mast Cell Activation. Clin Immunol. 132, 277-284.

  23. Howard, J. K., and Flier, J. S. (2006) Attenuation of Leptin and Insulin Signaling by SOCS Proteins. Trends Endocrinol Metab. 17, 365-371.

  24. Zhang, F., Chen, Y., Heiman, M., and Dimarchi, R. (2005) Leptin: Structure, Function and Biology. Vitam Horm. 71, 345-372.

  25. Malendowicz, L. K., Rucinski, M., Belloni, A. S., Ziolkowska, A., and Nussdorfer, G. G. (2007) Leptin and the Regulation of the Hypothalamic-Pituitary-Adrenal Axis. Int Rev Cytol. 263, 63-102.

  26. Lam, Q. L., and Lu, L. (2007) Role of Leptin in Immunity. Cell Mol Immunol. 4, 1-13.

  27. Murakami, T., Yamashita, T., Iida, M., Kuwajima, M., and Shima, K. (1997) A Short Form of Leptin Receptor Performs Signal Transduction. Biochem Biophys Res Commun. 231, 26-29.

  28. Bjorbaek, C., Uotani, S., da, S. B., and Flier, J. S. (1997) Divergent Signaling Capacities of the Long and Short Isoforms of the Leptin Receptor. J Biol Chem. 272, 32686-32695.

  29. Kloek, C., Haq, A. K., Dunn, S. L., Lavery, H. J., Banks, A. S., and Myers, M. G.,Jr. (2002) Regulation of Jak Kinases by Intracellular Leptin Receptor Sequences. J Biol Chem. 277, 41547-41555.

  30. Hekerman, P., Zeidler, J., Bamberg-Lemper, S., Knobelspies, H., Lavens, D., Tavernier, J., Joost, H. G., and Becker, W. (2005) Pleiotropy of Leptin Receptor Signalling is Defined by Distinct Roles of the Intracellular Tyrosines. FEBS J. 272, 109-119.

  31. Banks, A. S., Davis, S. M., Bates, S. H., and Myers, M. G.,Jr. (2000) Activation of Downstream Signals by the Long Form of the Leptin Receptor. J Biol Chem. 275, 14563-14572.

  32. Kremer, B. E., Adang, L. A., and Macara, I. G. (2007) Septins Regulate Actin Organization and Cell-Cycle Arrest through Nuclear Accumulation of NCK Mediated by SOCS7. Cell. 130, 837-850.

  33. Tellechea, M. L., Steinhardt, A. P., Rodriguez, G., Taverna, M. J., Poskus, E., and Frechtel, G. (2013) Common Variants in SOCS7 Gene Predict Obesity, Disturbances in Lipid Metabolism and Insulin Resistance. Nutr Metab Cardiovasc Dis. 23, 424-431.

  34. Krebs, D. L., Metcalf, D., Merson, T. D., Voss, A. K., Thomas, T., Zhang, J. G., Rakar, S., O'bryan, M. K., Willson, T. A., Viney, E. M., Mielke, L. A., Nicola, N. A., Hilton, D. J., and Alexander, W. S. (2004) Development of Hydrocephalus in Mice Lacking SOCS7. Proc Natl Acad Sci U S A. 101, 15446-15451.