Phenotypic Mutation 'Lilliputian2'

• Allele: Lilliputian2
• Mutation Type: nonsense
• Chromosome: 1
• Coordinate: 158,662,488 bp (GRCm39)
• Base Change: A ⇒ T (forward strand)
• Gene: Pappa2
• Gene Name: pappalysin 2
• Synonym(s): PAPP-A2, placenta-specific 3, pregnancy-associated plasma preproprotein-A2, pregnancy-associated plasma protein-E, PLAC3, Pappe
• Chromosomal Location: 158,539,297-158,788,019 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the pappalysin family of metzincin metalloproteinases. The encoded protein cleaves insulin-like growth factor-binding protein 5 and is thought to be a local regulator of insulin-like growth factor (IGF) bioavailability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2010] ; PHENOTYPE: Mice homozygous for a null mutation are viable and fertile but display postnatal growth retardation that is more pronounced in females compared to males. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Tyrosine changed to Stop codon
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000124022]
• AlphaFold: E9PZ87
• SMART Domains: Protein: ENSMUSP00000124022; Gene: ENSMUSG00000073530; AA Change: Y1162*

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:Laminin_G_3	271	440	1.2e-25	PFAM
NL	572	614	2.81e-5	SMART
Pfam:Peptidase_M43	669	832	1.5e-12	PFAM
Blast:FN3	844	1103	1e-169	BLAST
low complexity region	1130	1139	N/A	INTRINSIC
low complexity region	1361	1370	N/A	INTRINSIC
CCP	1394	1457	4.97e0	SMART
CCP	1462	1519	4.81e-1	SMART
CCP	1523	1588	2.58e-4	SMART
CCP	1593	1644	1.13e0	SMART
NL	1720	1757	2.66e-6	SMART

• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9716
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Semidominant
• Mode of Inheritance: Autosomal Semidominant
• Last Updated: 2019-09-04 9:44 PM by Diantha La Vine
• Record Created: 2016-01-25 10:58 AM
• Record Posted: 2016-06-02
• Science Writers: Anne Murray
• Illustrators: Peter Jurek
• Authors: Emre Turer and Bruce Beutler

Accession Number

NCBI RefSeq: NM_001085376; MGI:3051647

Alleles Listed at MGI

All Mutations and Alleles(6) : Chemically induced (other)(2) Targeted(4)

Phenotypic Description

Figure 1. Lilliputian 2 mice exhibit reduced body weights compared to wild-type littermates . Scaled body weight data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Lilliputian2 phenotype was identified among G3 mice of the pedigree R3707, some of which showed reduced body weights compared to wild-type littermates (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced body weight using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 41 mutations (X-axis) identified in the G1 male of pedigree R3707. Scaled body weight phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 41 mutations. The body weight phenotype was linked to mutations in two genes on chromosome 1: Pappa2 and Pigc. The mutation in Pappa2 was presumed to be causative because the Lilliputian phenotype mimics that of other Pappa2 mouse models (see MGI). The mutation in Pappa2 is a T to A transversion at base pair 158,834,918 (v38) on chromosome 1, or base pair 145,606 in the GenBank genomic region NC_000067 encoding Pappa2. Linkage was found with an additive model of inheritance (P = 4.70 x 10^-4), wherein five variant homozygotes and seven heterozygotes departed phenotypically from 11 homozygous reference mice (Figure 2).

The mutation corresponds to residue 3,486 in the mRNA sequence NM_001085376 in exon 10 of 22 total exons. 

3469 AGCCTTTGCTACAGGTATGAGGGAGATGGGGTT 1157 -S--L--C--Y--R--Y--E--G--D--G--V-

The mutated nucleotide is indicated in red.  The mutation results in substitution of tyrosine 1,162 to a premature stop codon (Y1162*) in the PAPP-A2 protein.

Protein Prediction

Figure 3. Domain figure of PAPP-A2. The Lilliputian2 mutation results in substitution of tyrosine 1,162 to a premature stop codon (Y1162*). Abbreviations: SP, signal peptide; Laminin, laminin G-like domain; LNR, Lin12/Notch repeats; FN3, fibronectin 3-like domain; CCP/SCR, complement control protein/short consensus repeat. This image is interactive. Other mutations found in PAPP-A2 are noted. Click on each mutation for more information.

Pappa2 encodes pregnancy-associated plasma protein A2 (PAPP-A2; alternatively, PAPP-E), a member of the pappalysin group of the metzincin protease family along with PAPP-A and ulilysin. PAPP-A2 is a 1,789-amino acid protein that has several domains: a signaling peptide (amino acids 1-18), a laminin G-like domain (amino acids 271-440), a peptidase/proteolytic domain (amino acids 669-832), a fibronectin 3-like domain (FN3; amino acids 844-1103), four complement control protein (CCP) domains (alternatively, short consensus repeat (SCR); amino acids 1394-1457, 1462-1519, 1523-1588, and 1593-1644), and two Lin12/Notch repeats (LNRs; amino acids 572-614 and 1720-1757) (Figure 3) (1).

The mutation in Lilliputian2 results in substitution of tyrosine 1,162 to a premature stop codon (Y1162*). Amino acid 1,162 is within an undefined domain between the FN3 domain and the first CCP domain.

Please see the record Lilliputian for more information about Pappa2.

Putative Mechanism

PAPP-A2 is a protease that acts on insulin-like growth factor binding protein 5 (IGFBP5), a factor involved in bone metabolism (2;3) and IGFBP3 (4). IGFBP5 regulates the IGF-I signaling pathways by binding IGF-I. IGFBP5 also has IGF-I-independent functions. IGFPB5 is able to bind its putative receptor to enter the cytoplasm and subsequently interact with, and regulate, other proteins. Studies have shown that PAPP-A2 has roles in human pregnancy (5), reproductive traits in cattle (6), and postnatal growth in mice (7;8). Pappa2-deficient (Pappa2^-/-) mice are viable and smaller than wild-type mice (8). At 3-18 weeks of age, the male Pappa2^-/- mice had approximately 10% lower body weights than that in age-matched wild-type mice (8). Weight reduction was more pronounced in female mice compared to that in age-matched male mice (8). In the female mice, all organs except ovaries were larger than that in wild-type mice. The Pappa2^-/- mice have shorter femur length than that in wild-type mice, but do not exhibit changes in bone mineral density. Pappa2 deletion does not affect placental or embryonic mass at embryonic day 12.5 (9). At birth, the Pappa2^-/- mice exhibited a trend towards lower birth mass (9). At 3, 6, and 10 weeks of age, the Pappa2^-/- mice exhibited reduced body mass and tail lengths compared to wild-type mice (9). The shape of the pelvic girdle significantly differed between that in the Pappa2^-/- and wild-type mice; the Pappa2^-/- mice had a more feminine shape and was disproportionately small (9). Matings between Pappa2^-/- mice exhibited a delay to first litter, increased number of days between litter, and a reduced number of pups per litter compared to matings between wild-type mice (8). Although Pappa2 deletion results in diminished levels of circulating IGF-I, IGFBP-3, and IGFBP-5, there were no glucose metabolism phenotypes observed (10). In addition, loss of Pappa2 expression did not result in weight gain or adiposity on a high-fat diet (10). Loss of Pappa2 expression in mouse does not effect female fertility, but has subtle effects on male fertility (11). The body weight phenotype of the Lilliputian2 mice indicates loss-of-function of PAPP-A2^Lilliputian2.

Primers

PCR Primer
Lilliputian2_pcr_F: AGCCATGACTCCATTCTTCTGG
Lilliputian2_pcr_R: TGCTTCTTCCCTCATAAAGAGTG

Sequencing Primer
Lilliputian2_seq_F: CTGGCTTAACTTACCATTGAATGAGG
Lilliputian2_seq_R: TCTTCCCTCATAAAGAGTGAAAAAC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 422 nucleotides is amplified (chromosome 1, - strand):

1   tgcttcttcc ctcataaaga gtgaaaaacc cctcctctcc aacagtgttg gggttggagt
61  tttggctggt actgcactct tcaattatca caagattgtc tttagagagt tgaagaattg
121 ctgggaatac tctcatttta aatttcccct aaaagatatg aaaaaaaagt cctaaatgct
181 atccatgttt ttgcagggga gccaagcctt tgctacaggt atgagggaga tggggtttgt
241 gaagattttg agaaggaaag catcatcaca gactgtggcc tccacactcc tgaaggatat
301 ttggatcagt gggctagcca ggcttattcc taccatgaag acaaggagaa atgtcctgtt
361 tccctggtaa caggagaacc tcattcaatg gtaagttaag ccagaagaat ggagtcatgg
421 ct

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Farr, M., Strube, J., Geppert, H. G., Kocourek, A., Mahne, M., and Tschesche, H. (2000) Pregnancy-Associated Plasma Protein-E (PAPP-E). Biochim Biophys Acta. 1493, 356-362.

  2. Conover, C. A. (2008) Insulin-Like Growth Factor-Binding Proteins and Bone Metabolism. Am J Physiol Endocrinol Metab. 294, E10-4.

  3. Govoni, K. E., Baylink, D. J., and Mohan, S. (2005) The Multi-Functional Role of Insulin-Like Growth Factor Binding Proteins in Bone. Pediatr Nephrol. 20, 261-268.

  4. Overgaard, M. T., Boldt, H. B., Laursen, L. S., Sottrup-Jensen, L., Conover, C. A., and Oxvig, C. (2001) Pregnancy-Associated Plasma Protein-A2 (PAPP-A2), a Novel Insulin-Like Growth Factor-Binding Protein-5 Proteinase. J Biol Chem. 276, 21849-21853.

  5. Yan, X., Baxter, R. C., and Firth, S. M. (2010) Involvement of Pregnancy-Associated Plasma Protein-A2 in Insulin-Like Growth Factor (IGF) Binding Protein-5 Proteolysis during Pregnancy: A Potential Mechanism for Increasing IGF Bioavailability. J Clin Endocrinol Metab. 95, 1412-1420.

  6. Wickramasinghe, S., Rincon, G., and Medrano, J. F. (2011) Variants in the Pregnancy-Associated Plasma Protein-A2 Gene on Bos Taurus Autosome 16 are Associated with Daughter Calving Ease and Productive Life in Holstein Cattle. J Dairy Sci. 94, 1552-1558.

  7. Christians, J. K., Hoeflich, A., and Keightley, P. D. (2006) PAPPA2, an Enzyme that Cleaves an Insulin-Like Growth-Factor-Binding Protein, is a Candidate Gene for a Quantitative Trait Locus Affecting Body Size in Mice. Genetics. 173, 1547-1553.

  8. Conover, C. A., Boldt, H. B., Bale, L. K., Clifton, K. B., Grell, J. A., Mader, J. R., Mason, E. J., and Powell, D. R. (2011) Pregnancy-Associated Plasma Protein-A2 (PAPP-A2): Tissue Expression and Biological Consequences of Gene Knockout in Mice. Endocrinology. 152, 2837-2844.

  9. Christians, J. K., de Zwaan, D. R., and Fung, S. H. (2013) Pregnancy Associated Plasma Protein A2 (PAPP-A2) Affects Bone Size and Shape and Contributes to Natural Variation in Postnatal Growth in Mice. PLoS One. 8, e56260.

  10. Christians, J. K., Bath, A. K., and Amiri, N. (2015) Pappa2 Deletion Alters IGFBPs but has Little Effect on Glucose Disposal Or Adiposity. Growth Horm IGF Res. 25, 232-239.

  11. Christians, J. K., King, A. Y., Rogowska, M. D., and Hessels, S. M. (2015) Pappa2 Deletion in Mice Affects Male but Not Female Fertility. Reprod Biol Endocrinol. 13, 109-015-0108-y.