Phenotypic Mutation 'ito' (pdf version)
Alleleito
Mutation Type nonsense
Chromosome15
Coordinate66,638,011 bp (GRCm39)
Base Change C ⇒ T (forward strand)
Gene Tg
Gene Name thyroglobulin
Synonym(s) Tgn
Chromosomal Location 66,542,606-66,722,570 bp (+) (GRCm39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Thyroglobulin (Tg) is a glycoprotein homodimer produced predominantly by the thryroid gland. It acts as a substrate for the synthesis of thyroxine and triiodothyronine as well as the storage of the inactive forms of thyroid hormone and iodine. Thyroglobulin is secreted from the endoplasmic reticulum to its site of iodination, and subsequent thyroxine biosynthesis, in the follicular lumen. Mutations in this gene cause thyroid dyshormonogenesis, manifested as goiter, and are associated with moderate to severe congenital hypothyroidism. Polymorphisms in this gene are associated with susceptibility to autoimmune thyroid diseases (AITD) such as Graves disease and Hashimoto thryoiditis. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit enlarged thyroid gland, hypothyroidism, abnormal thyroid gland morphology, and decreased body weight. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_009375; MGI:98733

MappedYes 
Amino Acid Change Glutamine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000070239] [ENSMUSP00000129868] [ENSMUSP00000126454]
AlphaFold no structure available at present
SMART Domains Protein: ENSMUSP00000070239
Gene: ENSMUSG00000053469
AA Change: Q2275*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TY 50 97 5.9e-16 SMART
TY 118 165 5.59e-17 SMART
Pfam:Thyroglobulin_1 174 252 4e-9 PFAM
TY 317 363 4.36e-19 SMART
low complexity region 495 504 N/A INTRINSIC
TY 617 662 3.58e-15 SMART
TY 684 730 1.47e-16 SMART
TY 880 926 1.51e-4 SMART
TY 1029 1078 1.21e-12 SMART
TY 1106 1150 7.56e-5 SMART
TY 1167 1215 7.26e-16 SMART
low complexity region 1244 1255 N/A INTRINSIC
Pfam:GCC2_GCC3 1464 1509 2.7e-16 PFAM
TY 1519 1568 9.81e-13 SMART
Pfam:COesterase 2181 2717 8.4e-140 PFAM
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000129868
Gene: ENSMUSG00000053469

DomainStartEndE-ValueType
TY 14 63 1.21e-12 SMART
Predicted Effect noncoding transcript
SMART Domains Protein: ENSMUSP00000126454
Gene: ENSMUSG00000053469
AA Change: Q656*

DomainStartEndE-ValueType
internal_repeat_1 93 331 1.53e-6 PROSPERO
Pfam:COesterase 562 1098 2.1e-137 PFAM
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000128410
Gene: ENSMUSG00000053469

DomainStartEndE-ValueType
Pfam:COesterase 313 849 6e-140 PFAM
Predicted Effect noncoding transcript
Meta Mutation Damage Score 0.9755 question?
Is this an essential gene? Probably nonessential (E-score: 0.096) question?
Phenotypic Category Autosomal Recessive
Candidate Explorer Status loading ...
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(10) Chemically induced (ENU)(1) Chemically induced (other)(3) Gene trapped(1) Radiation induced(2) Spontaneous(1) Targeted(1) Transgenic(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Tg APN 15 66719015 missense probably damaging 1.00
IGL00230:Tg APN 15 66699139 missense probably benign 0.00
IGL00324:Tg APN 15 66565273 missense probably benign
IGL00428:Tg APN 15 66645273 missense probably benign 0.33
IGL00703:Tg APN 15 66568338 missense probably benign 0.34
IGL00808:Tg APN 15 66555662 missense probably damaging 1.00
IGL00833:Tg APN 15 66560650 missense probably benign 0.34
IGL00899:Tg APN 15 66545922 critical splice donor site probably null
IGL00921:Tg APN 15 66636302 missense probably benign 0.28
IGL00975:Tg APN 15 66553731 missense probably benign
IGL01288:Tg APN 15 66608125 missense possibly damaging 0.81
IGL01397:Tg APN 15 66567941 splice site probably benign
IGL01634:Tg APN 15 66601415 missense probably benign 0.34
IGL01646:Tg APN 15 66549936 missense probably damaging 1.00
IGL01704:Tg APN 15 66543200 missense probably damaging 0.98
IGL01958:Tg APN 15 66631335 missense probably benign 0.06
IGL02093:Tg APN 15 66564223 missense possibly damaging 0.83
IGL02113:Tg APN 15 66577179 missense probably benign 0.08
IGL02138:Tg APN 15 66589082 missense probably benign 0.01
IGL02156:Tg APN 15 66577197 missense probably benign 0.19
IGL02169:Tg APN 15 66629792 missense probably benign 0.04
IGL02342:Tg APN 15 66636140 missense probably benign
IGL02434:Tg APN 15 66636191 missense probably damaging 0.97
IGL02506:Tg APN 15 66613443 missense possibly damaging 0.71
IGL02513:Tg APN 15 66577123 missense probably benign
IGL02549:Tg APN 15 66711210 missense probably damaging 1.00
IGL02669:Tg APN 15 66620575 splice site probably benign
IGL02756:Tg APN 15 66606435 missense probably benign
IGL02800:Tg APN 15 66629735 missense probably damaging 1.00
IGL02828:Tg APN 15 66554243 missense probably damaging 1.00
IGL02927:Tg APN 15 66549942 missense probably damaging 1.00
IGL03061:Tg APN 15 66543254 missense probably damaging 1.00
IGL03105:Tg APN 15 66586955 missense probably benign 0.01
IGL03160:Tg APN 15 66711152 nonsense probably null
IGL03242:Tg APN 15 66555647 missense probably damaging 0.99
Also_ran UTSW 15 66550688 missense probably damaging 1.00
bedraggled UTSW 15 66612563 missense probably damaging 1.00
foster UTSW 15 66565109 nonsense probably null
hognose UTSW 15 66589057 missense probably damaging 0.99
ito2 UTSW 15 66543245 missense probably damaging 1.00
ito3 UTSW 15 66645323 missense probably damaging 1.00
ito4 UTSW 15 66568369 missense possibly damaging 0.47
Papua UTSW 15 66545899 missense probably damaging 1.00
Pipistrella UTSW 15 66567984 missense probably damaging 1.00
pluribus UTSW 15 66587012 missense probably damaging 0.98
samarai UTSW 15 66629855 critical splice donor site probably null
sariba UTSW 15 66566719 missense probably benign 0.01
ticker UTSW 15 66699231 nonsense probably null
Vampire UTSW 15 66554676 missense probably damaging 1.00
IGL03134:Tg UTSW 15 66612567 missense probably damaging 1.00
P0019:Tg UTSW 15 66560712 missense probably benign 0.01
R0121:Tg UTSW 15 66612630 missense probably benign 0.04
R0135:Tg UTSW 15 66566719 missense probably benign 0.01
R0227:Tg UTSW 15 66570295 missense possibly damaging 0.84
R0448:Tg UTSW 15 66636291 missense probably damaging 1.00
R0453:Tg UTSW 15 66700382 missense probably benign 0.09
R0504:Tg UTSW 15 66554253 missense probably damaging 0.97
R0543:Tg UTSW 15 66601446 missense probably benign 0.13
R0638:Tg UTSW 15 66589057 missense probably damaging 0.99
R0639:Tg UTSW 15 66613333 critical splice acceptor site probably null
R0646:Tg UTSW 15 66601475 missense probably damaging 0.99
R0666:Tg UTSW 15 66609370 missense probably benign
R0673:Tg UTSW 15 66613333 critical splice acceptor site probably null
R0689:Tg UTSW 15 66711253 splice site probably benign
R0704:Tg UTSW 15 66629729 missense probably benign 0.02
R0730:Tg UTSW 15 66550638 missense probably damaging 1.00
R0830:Tg UTSW 15 66596993 missense probably damaging 1.00
R0959:Tg UTSW 15 66579859 missense probably damaging 0.98
R1027:Tg UTSW 15 66544258 missense possibly damaging 0.65
R1061:Tg UTSW 15 66570408 missense probably benign 0.09
R1086:Tg UTSW 15 66555911 missense probably benign
R1103:Tg UTSW 15 66591504 missense probably benign 0.45
R1240:Tg UTSW 15 66700397 missense probably benign 0.16
R1281:Tg UTSW 15 66568338 missense probably benign 0.34
R1470:Tg UTSW 15 66721312 missense possibly damaging 0.95
R1470:Tg UTSW 15 66721312 missense possibly damaging 0.95
R1531:Tg UTSW 15 66722351 missense probably benign 0.02
R1544:Tg UTSW 15 66577081 missense probably benign 0.04
R1550:Tg UTSW 15 66565279 missense possibly damaging 0.52
R1575:Tg UTSW 15 66601534 critical splice donor site probably null
R1638:Tg UTSW 15 66568015 nonsense probably null
R1655:Tg UTSW 15 66700417 critical splice donor site probably null
R1671:Tg UTSW 15 66564236 missense possibly damaging 0.89
R1789:Tg UTSW 15 66609397 missense probably benign 0.00
R1883:Tg UTSW 15 66543158 missense probably damaging 1.00
R1984:Tg UTSW 15 66554691 missense probably benign
R2063:Tg UTSW 15 66700402 missense probably damaging 1.00
R2092:Tg UTSW 15 66721456 missense probably null 0.26
R2109:Tg UTSW 15 66601443 missense probably benign 0.02
R2128:Tg UTSW 15 66566743 missense probably benign 0.10
R2129:Tg UTSW 15 66566743 missense probably benign 0.10
R2207:Tg UTSW 15 66553788 missense probably benign 0.15
R2219:Tg UTSW 15 66553782 missense probably benign 0.03
R2228:Tg UTSW 15 66545860 missense probably damaging 0.99
R2229:Tg UTSW 15 66545860 missense probably damaging 0.99
R2259:Tg UTSW 15 66555747 missense probably benign
R2994:Tg UTSW 15 66553802 missense probably benign
R3904:Tg UTSW 15 66638011 nonsense probably null
R3946:Tg UTSW 15 66545872 missense probably damaging 1.00
R3965:Tg UTSW 15 66556039 missense probably benign
R4245:Tg UTSW 15 66568318 missense possibly damaging 0.68
R4451:Tg UTSW 15 66637996 missense probably benign 0.01
R4487:Tg UTSW 15 66543245 missense probably damaging 1.00
R4489:Tg UTSW 15 66579791 missense probably damaging 1.00
R4623:Tg UTSW 15 66607120 missense probably benign 0.23
R4659:Tg UTSW 15 66545769 missense possibly damaging 0.67
R4728:Tg UTSW 15 66554676 missense probably damaging 1.00
R4760:Tg UTSW 15 66565168 missense probably damaging 1.00
R4797:Tg UTSW 15 66629855 critical splice donor site probably null
R4944:Tg UTSW 15 66636186 missense probably damaging 1.00
R4998:Tg UTSW 15 66545899 missense probably damaging 1.00
R5009:Tg UTSW 15 66568435 missense probably benign 0.01
R5025:Tg UTSW 15 66579779 missense probably damaging 1.00
R5035:Tg UTSW 15 66553662 splice site probably null
R5049:Tg UTSW 15 66699231 nonsense probably null
R5073:Tg UTSW 15 66607101 missense probably benign 0.05
R5169:Tg UTSW 15 66550629 nonsense probably null
R5185:Tg UTSW 15 66645323 missense probably damaging 1.00
R5227:Tg UTSW 15 66631416 missense possibly damaging 0.87
R5300:Tg UTSW 15 66550704 missense probably damaging 1.00
R5334:Tg UTSW 15 66549904 missense probably damaging 1.00
R5339:Tg UTSW 15 66549942 missense probably damaging 1.00
R5402:Tg UTSW 15 66611017 missense probably damaging 0.98
R5441:Tg UTSW 15 66568369 missense possibly damaging 0.47
R5509:Tg UTSW 15 66699142 missense probably benign 0.45
R5580:Tg UTSW 15 66557149 missense possibly damaging 0.66
R5582:Tg UTSW 15 66565284 missense probably damaging 1.00
R5624:Tg UTSW 15 66709906 missense probably benign 0.11
R5686:Tg UTSW 15 66560738 missense probably benign 0.28
R6042:Tg UTSW 15 66555842 missense probably benign 0.01
R6122:Tg UTSW 15 66700306 missense probably damaging 1.00
R6146:Tg UTSW 15 66545216 splice site probably null
R6159:Tg UTSW 15 66607096 missense possibly damaging 0.71
R6223:Tg UTSW 15 66579771 missense probably benign 0.15
R6480:Tg UTSW 15 66543160 missense probably damaging 1.00
R6505:Tg UTSW 15 66631407 missense probably damaging 0.99
R6531:Tg UTSW 15 66711211 missense probably damaging 0.99
R6614:Tg UTSW 15 66607108 missense probably damaging 0.99
R6698:Tg UTSW 15 66711211 missense probably damaging 1.00
R6798:Tg UTSW 15 66550688 missense probably damaging 1.00
R6837:Tg UTSW 15 66567984 missense probably damaging 1.00
R6861:Tg UTSW 15 66560740 missense probably benign 0.00
R6888:Tg UTSW 15 66568095 missense probably damaging 0.99
R6933:Tg UTSW 15 66636158 missense possibly damaging 0.73
R6983:Tg UTSW 15 66565207 missense probably benign 0.01
R7078:Tg UTSW 15 66545392 missense probably damaging 1.00
R7244:Tg UTSW 15 66612563 missense probably damaging 1.00
R7320:Tg UTSW 15 66566633 missense possibly damaging 0.71
R7334:Tg UTSW 15 66597121 missense probably benign 0.01
R7418:Tg UTSW 15 66568432 missense probably damaging 0.99
R7485:Tg UTSW 15 66568437 missense probably benign 0.04
R7524:Tg UTSW 15 66568010 missense probably benign 0.01
R7529:Tg UTSW 15 66566617 missense probably damaging 0.99
R7540:Tg UTSW 15 66561776 missense probably benign 0.16
R7583:Tg UTSW 15 66636267 missense probably damaging 1.00
R7594:Tg UTSW 15 66601432 missense probably benign 0.20
R7667:Tg UTSW 15 66587012 missense probably damaging 0.98
R7722:Tg UTSW 15 66636158 missense possibly damaging 0.73
R7790:Tg UTSW 15 66721453 missense probably damaging 0.99
R7838:Tg UTSW 15 66565112 missense probably benign 0.00
R7890:Tg UTSW 15 66555663 missense probably damaging 1.00
R7904:Tg UTSW 15 66577128 missense probably benign 0.08
R7919:Tg UTSW 15 66555923 missense possibly damaging 0.73
R7921:Tg UTSW 15 66555642 missense probably benign 0.08
R8037:Tg UTSW 15 66560724 missense probably benign 0.00
R8038:Tg UTSW 15 66560724 missense probably benign 0.00
R8214:Tg UTSW 15 66645247 missense probably damaging 1.00
R8304:Tg UTSW 15 66565109 nonsense probably null
R8688:Tg UTSW 15 66566802 critical splice donor site probably benign
R8709:Tg UTSW 15 66553786 missense probably benign 0.08
R8714:Tg UTSW 15 66555891 missense probably damaging 0.97
R8901:Tg UTSW 15 66557184 missense probably damaging 1.00
R8917:Tg UTSW 15 66645332 critical splice donor site probably null
R9023:Tg UTSW 15 66555522 missense probably damaging 1.00
R9232:Tg UTSW 15 66570310 missense probably benign 0.01
R9310:Tg UTSW 15 66699118 missense possibly damaging 0.69
R9361:Tg UTSW 15 66557246 missense possibly damaging 0.50
R9389:Tg UTSW 15 66561173 missense probably benign 0.04
R9501:Tg UTSW 15 66718923 missense possibly damaging 0.52
R9510:Tg UTSW 15 66545913 missense probably damaging 1.00
R9594:Tg UTSW 15 66607109 nonsense probably null
R9629:Tg UTSW 15 66555587 missense possibly damaging 0.95
R9701:Tg UTSW 15 66637991 missense probably benign 0.03
R9743:Tg UTSW 15 66561839 missense probably benign 0.18
R9748:Tg UTSW 15 66719008 missense possibly damaging 0.91
T0975:Tg UTSW 15 66560712 missense probably benign 0.01
X0005:Tg UTSW 15 66560712 missense probably benign 0.01
X0065:Tg UTSW 15 66554303 missense probably damaging 1.00
X0067:Tg UTSW 15 66620592 missense probably benign 0.10
Z1177:Tg UTSW 15 66721396 missense probably benign 0.02
Z1177:Tg UTSW 15 66557159 missense possibly damaging 0.49
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2019-09-04 9:43 PM by Diantha La Vine
Record Created 2016-01-26 1:58 PM
Record Posted 2016-09-19
Phenotypic Description

Figure 1. Ito mice exhibited reduced body weights compared to their wild-type littermates. Scaled weight data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The ito phenotype was identified among G3 mice of the pedigree R3904, some of which had reduced body weights compared to wild-type controls (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced body weight using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 38 mutations (X-axis) identified in the G1 male of pedigree R3904. Scaled weight data are shown for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 38 mutations. The body weight phenotype was linked to a mutation in Tg: a C to T transition at base pair 66,766,162 (v38) on chromosome 15, or base pair 95,407 in the GenBank genomic region NC_000081 encoding Tg. Linkage was found with a recessive model of inheritance, wherein three variant homozygotes departed phenotypically from nine homozygous reference mice and nine heterozygous mice with a P value of 1.393 x 10-5 (Figure 2).

The mutation corresponds to residue 6,845 in the NM_009375 mRNA sequence in exon 39 of 48 total exons. 

 

6830 ACCCCCACACCTCCACAAATCAATGAAGACTGC

2270 -T--P--T--P--P--Q--I--N--E--D--C-

The mutated nucleotide is indicated in red. The mutation results in substitution of glutamine 2,275 to a premature stop codon (Q2275*) in the thyroglobulin protein.

Illustration of Mutations in
Gene & Protein
Protein Prediction
Figure 3. The protein domains of TG. The TG protein has a signal peptide (amino acids 1-20), 11 type 1, three type 2, three type 3a, and two type 3b Cys-rich repeats followed by an acetylcholinesterase (AChE)-like domain. Tg can be divided into distinct regions: region I containing 10 type 1 repeats along with linker and hinge segments; region II-III contains the type 2 repeats, the type 1 repeat, and the type 3 repeats; and the AchE-like domain. The location of the ito mutation is indicated. Other mutations found in TG are noted in red. This image is interactive. Click on the mutations for more specific information.

Tg encodes thyroglobulin (Tg), a precursor of two thyroid hormones: 3,5,3’ triiodothyronine (T3) and 3,5,3’,5’ tetraiodothyronine (thyroxine; T4). The Tg protein has a signal peptide (amino acids 1-20), 11 type 1, three type 2, three type 3a, and two type 3b Cys-rich repeats followed by an acetylcholinesterase (AChE)-like domain (Figure 3) (1-3). Tg can be divided into distinct regions: region I containing 10 type 1 repeats between amino acids 32 and 1,211 along with linker and hinge segments; region II-III contains the type 2 repeats, the type 1 repeat at amino acids 1,510-1,564, and the type 3 repeats; and the AchE-like domain (amino acids 2,181-2,717) (4).

Each of the type 1 repeats are approximately 50 amino acids in length and have a structural motif that may bind and reversibly inhibit proteases in the lysosomal pathway (5). Type 1 domains are found in several other proteins including testicans, secreted modular calcium-binding proteins (SMOCs), the MHC class II-associated p41 invariant chain, and insulin-like growth factor binding proteins (IGFBP-1, -2, -3, -4, -5, and -6) (6). The type 2 domains are 14-17 amino acids in length and are between amino acids 1,455 and 1,502. The type 2 repeats are distant members of the GRIP and coiled-coil domain-containing protein 2 (GCC2)/GCC3 domain superfamily, which includes SVEP1 (alternatively, polydom) (7). The GCC2/GCC3 domains may assist in trafficking Tg. The type 3 domains vary between 57-160 amino acids in length and reside between amino acids 1,602 and 2,183.

The AChE-like domain mediates protein dimerization and the export of Tg by acting as an intramolecular chaperone (2;7;8). Six cysteines in the AChE-like domain are involved in the formation of interchain disulfide bonds (2;3). Megalin, a regulator of Tg transepithelial transport from the apical to basolateral surface of the thyrocyte, interacts with a heparin-binding region (SRRLKRP) in the C-terminus of Tg (9;10); the megalin-interacting domain is not in human Tg.

Tg is a 660 kDa homodimeric protein. Dimerization occurs in the endoplasmic reticulum, and is required for conformational maturation and intracellular transport of Tg to the lumen of thyroid follicles (8). Within the secretory system, Tg undergoes several posttranslational modifications including glycosylation, sialylation, sulfation, phosphorylation, iodination, and formation of approximately 60 intrachain disulfide binds per monomer. Upon reaching the follicular lumen, several tyrosines are iodinated. Several of the iodinated tyrosines are coupled to form T3 and T4. The release of thyroid hormone occurs after several steps including intra-and extracellular proteolytic degradation of Tg by several proteases including cysteine cathepsins B, L, and K and the aspartic protease cathepsin D (see the Background section for more details) (11;12).

An alternative transcript (designated kTg) has been identified in the mouse kidney (13). The kTg transcript transcription start site is within intron 41 of Tg and continues in-frame with the remaining thyroid-derived Tg beginning with exon 42. The encoded kTg protein is 367 amino acids in length, with a unique 13 amino acid signal peptide sequence at the N-terminus followed by a 354 amino acid sequence corresponding to the C-terminus of thyroid Tg.

The ito mutation results in substitution of glutamine 2,275 to a premature stop codon (Q2275*). Amino acid 2,275 is within the AChE-like domain.

Expression/Localization

Tg synthesis is restricted to the thyroid gland. Tg is secreted and stored in the colloid inside of the thyroid follicles. Newly secreted Tg remains near the apical membrane of thyroid cells, where it undergoes hormone formation and is internalized and/or degraded rapidly. Tg in the center of the follicle is stored in the form of aggregates to function as an iodine and hormone reservoir.

Background
Figure 4. The steps of thyroid hormone synthesis. Initial Tg synthesis occurs in the endoplasmic reticulum. After relesase into secretory vesicles, thyroid pyroxidase, TPO, and iodine coverts Tg to MIT and DIT within the colloid. Uptake in the cell is followed by proteolysis, converting the MID and DIT to T3 and T4, respectively. The T3 and T4 diffuse into the capillaries. See the text for more details.

Within the thyroid gland, epithelial cells synthesize thyroid hormones and are arranged as thyroid follicles. Between the thyroid follicles are parafollicular (alternatively, C cells), which secrete the hormone calcitonin. Tg is secreted by the thyroid cell into the follicular lumen by regulated (nonconstitutive), merocrine secretion (14;15). Upon stimulation by thyroid-stimulating hormone (TSH), Tg is reabsorbed by endocytosis/pinocytosis or phagocytosis (rodents only) to form endocytic/pinocytic vesicles or phagosomes, respectively (16;17). Thyroid hormone synthesis is regulated by the hypothalamic-pituitary-thyroid axis (HPT) negative feedback system, which involves interactions between the thyroid gland and circulating hormones. In the HPT, thyroid hormone synthesis is induced by TSH, which is secreted from anterior pituitary endocrine cells called thyrotropes. Increased thyroid hormone levels suppress further TSH secretion by acting on the hypothalamus, subsequently inhibiting the release of TSH-releasing hormone (TRH). TSH binding to the TSHR at the basal membrane of the thyroid follicle stimulates Tg expression via an increase in the intracellular level of cyclic adenosine monophosphate (cAMP) as well as the stimulation of thyroid peroxidase (TPO) and the sodium/iodide symporter (NIS) (18). After synthesis, Tg is transported to the apical membrane whereby it is released into the follicular lumen. At the apical membrane TPO and H2O2 catalyze the iodination of tyrosine residues on Tg to produce mono- (MIT) and di-iodotyrosines (DIT). Subsequent coupling of MIT and DIT catalyzes the production of T3 and T4. The iodinated Tg is pinocytosed through the apical membrane and into lysosomes where it undergoes proteolysis to release T3 and T4 through the basal membrane into the blood for action at peripheral target tissues whereby they control metabolism (19).

In rat thyroid FRTL-5 cells, Tg (at physiologic concentrations) suppresses the mRNA expression levels of several genes involved in TH synthesis, including Tg, Tpo, and Slc5a5 (NIS) (20-22). Tg is proposed to regulate cell growth and gene transcription by mimicking transforming growth factor (TGF)-β in certain cell types (23;24). Tg binds several proteins on the surface of thyroid cells (e.g., asialoglycoprotein receptor (ASGPR; (25)), megalin (gp300; (26)), and an N-acetylglucosamine receptor (27)), but none are significantly associated with intracellular signaling. These Tg-binding proteins are not specific to Tg, and are able to bind other large glycoproteins.

Mutations in TG have been linked to congenital goiter with hypothyroidism (euthyroidism) (OMIM: #274700) (28-30) as well as endemic and euthyroid nonendemic simple goiter (31-33). Most known pathogenic Tg mutations occur within region I and the AChE-like domain (18). Congenital hypothyroidism is the most frequent endocrine disease in infants with a prevalence of 1:2000-1:4000 in newborns (34;35). Congenital hypothyroidism is an autosomal recessive trait and is characterized by increased levels of TSH due to reduced thyroid function. Congenital hypothyroidism patients that are left untreated can exhibit abnormal growth and development as well as mental retardation. Early treatment with L-thyroxine results in normal development. Simple goiter is an enlargement of the thyroid gland that is not caused by an inflammatory or neoplastic process. TG is also a susceptibility gene for familial autoimmune thyroid disease (AITD) (36). Tg is an autoantigen in immune diseases of the thyroid [(21;22); reviewed in (13)]. The 8q24 locus, which contains TG, is linked to autoimmune thyroid disease (AITD) including Graves’ disease and Hashimoto’s thyroiditis. TG is an AITD susceptibility gene in both humans and mice (37) (OMIM: #608175). Graves’ disease is characterized by the production of TSHR-stimulating antibodies subsequently leading to hyperthyroidism. Hashimoto’s is characterized by apoptosis of thyrocytes leading to hypothyroidism. Both Graves’ and Hashimoto’s share many features including T cell infiltration of the thyroid and antithyroid autoantibody (anti-Tg and -TPO antibodies) production.

Putative Mechanism

The cog/cog (Tgcog; MGI:1856829) mouse model has a point mutation in Tg that causes a Leu to Pro substitution at amino acid 2,263 (38;39). The cog/cog mouse exhibits congenital hypothyroidism with goiter as well as abnormal growth, mild anemia, and defects in central nervous system development (e.g., microcephalic cerebrum with hypomyelination) (40;41)Tg expression is normal in the cog/cog mice, but the Tg protein exhibits increased proteolysis (42;43). Furthermore, the Tgcog/cog protein exhibited abnormal folding, dimerization, and export. The cog/cog mouse also had increased levels of several ER molecular chaperones. Taken together, the phenotypes of the cog/cog mouse are indicative of an ER storage defect (15). As a result, the levels of total serum T4 and T3 are low with a concomitant increase in serum TSH levels (41). A second mouse model has an ENU-induced mutation in Tg (TgR1471X; MGI:5694939). The TgR1471X mice exhibited stunted growth (44). The ito phenotype is similar to that of these two mouse models indicating that Tg function is impaired. Expression and localization of Tgito has not been examined.

Primers PCR Primer
ito_pcr_F: GCCATAGACATGCTGCTACTC
ito_pcr_R: ACAAAGGGAGCTCAGTGTCC

Sequencing Primer
ito_seq_F: AATGACCTGGAGCTTCCTCAGTG
ito_seq_R: CAGTGTCCCTAAGGATAATACTGTGG
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 405 nucleotides is amplified (chromosome 15, + strand):


1   gccatagaca tgctgctact cctactttct ggccgtatca atgacctgga gcttcctcag
61  tgctccagag ctacagaaaa accaggcctt tcactctggc cacaagaatg gttttggagg
121 agagggaaag atagcaaccc cccttgctat ttctctgaaa atcctgtgcc ttatttctgc
181 agggccagct gctggcagcc aggtacccgt acccccacac ctccacaaat caatgaagac
241 tgcttatatc tcaatgtgtt tgtccctgag aacctggtaa gttaagaatc aggatgtgtt
301 gtctggtgaa tagctccctt tggaaatcct tttcccacct tccctgggct ctatgggacc
361 tgtgctccca cagtattatc cttagggaca ctgagctccc tttgt


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
  20. Sellitti, D. F., and Suzuki, K. (2014) Intrinsic Regulation of Thyroid Function by Thyroglobulin. Thyroid. 24, 625-638.
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsEmre Turer and Bruce Beutler