Phenotypic Mutation 'ito'

• Allele: ito
• Mutation Type: nonsense
• Chromosome: 15
• Coordinate: 66,638,011 bp (GRCm39)
• Base Change: C ⇒ T (forward strand)
• Gene: Tg
• Gene Name: thyroglobulin
• Synonym(s): Tgn
• Chromosomal Location: 66,542,606-66,722,570 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Thyroglobulin (Tg) is a glycoprotein homodimer produced predominantly by the thryroid gland. It acts as a substrate for the synthesis of thyroxine and triiodothyronine as well as the storage of the inactive forms of thyroid hormone and iodine. Thyroglobulin is secreted from the endoplasmic reticulum to its site of iodination, and subsequent thyroxine biosynthesis, in the follicular lumen. Mutations in this gene cause thyroid dyshormonogenesis, manifested as goiter, and are associated with moderate to severe congenital hypothyroidism. Polymorphisms in this gene are associated with susceptibility to autoimmune thyroid diseases (AITD) such as Graves disease and Hashimoto thryoiditis. [provided by RefSeq, Nov 2009] ; PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit enlarged thyroid gland, hypothyroidism, abnormal thyroid gland morphology, and decreased body weight. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Glutamine changed to Stop codon
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000070239] [ENSMUSP00000129868] [ENSMUSP00000126454]
• AlphaFold: no structure available at present
• SMART Domains: Protein: ENSMUSP00000070239; Gene: ENSMUSG00000053469; AA Change: Q2275*

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
TY	50	97	5.9e-16	SMART
TY	118	165	5.59e-17	SMART
Pfam:Thyroglobulin_1	174	252	4e-9	PFAM
TY	317	363	4.36e-19	SMART
low complexity region	495	504	N/A	INTRINSIC
TY	617	662	3.58e-15	SMART
TY	684	730	1.47e-16	SMART
TY	880	926	1.51e-4	SMART
TY	1029	1078	1.21e-12	SMART
TY	1106	1150	7.56e-5	SMART
TY	1167	1215	7.26e-16	SMART
low complexity region	1244	1255	N/A	INTRINSIC
Pfam:GCC2_GCC3	1464	1509	2.7e-16	PFAM
TY	1519	1568	9.81e-13	SMART
Pfam:COesterase	2181	2717	8.4e-140	PFAM

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000129868; Gene: ENSMUSG00000053469

Domain	Start	End	E-Value	Type
TY	14	63	1.21e-12	SMART

• Predicted Effect: noncoding transcript
• SMART Domains: Protein: ENSMUSP00000126454; Gene: ENSMUSG00000053469; AA Change: Q656*

Domain	Start	End	E-Value	Type
internal_repeat_1	93	331	1.53e-6	PROSPERO
Pfam:COesterase	562	1098	2.1e-137	PFAM

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000128410; Gene: ENSMUSG00000053469

Domain	Start	End	E-Value	Type
Pfam:COesterase	313	849	6e-140	PFAM

• Predicted Effect: noncoding transcript
• Meta Mutation Damage Score: 0.9755
• Is this an essential gene?: Probably nonessential (E-score: 0.094)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-09-04 9:43 PM by Diantha La Vine
• Record Created: 2016-01-26 1:58 PM
• Record Posted: 2016-09-19
• Science Writers: Anne Murray
• Illustrators: Peter Jurek
• Authors: Emre Turer and Bruce Beutler

Accession Number

NCBI RefSeq: NM_009375; MGI:98733

Alleles Listed at MGI

All Mutations and Alleles(10) Chemically induced (ENU)(1) Chemically induced (other)(3) Gene trapped(1) Radiation induced(2) Spontaneous(1) Targeted(1) Transgenic(1)

Phenotypic Description

Figure 1. Ito mice exhibited reduced body weights compared to their wild-type littermates. Scaled weight data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The ito phenotype was identified among G3 mice of the pedigree R3904, some of which had reduced body weights compared to wild-type controls (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced body weight using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 38 mutations (X-axis) identified in the G1 male of pedigree R3904. Scaled weight data are shown for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 38 mutations. The body weight phenotype was linked to a mutation in Tg: a C to T transition at base pair 66,766,162 (v38) on chromosome 15, or base pair 95,407 in the GenBank genomic region NC_000081 encoding Tg. Linkage was found with a recessive model of inheritance, wherein three variant homozygotes departed phenotypically from nine homozygous reference mice and nine heterozygous mice with a P value of 1.393 x 10^-5 (Figure 2).

The mutation corresponds to residue 6,845 in the NM_009375 mRNA sequence in exon 39 of 48 total exons. 

6830 ACCCCCACACCTCCACAAATCAATGAAGACTGC 2270 -T--P--T--P--P--Q--I--N--E--D--C-

The mutated nucleotide is indicated in red. The mutation results in substitution of glutamine 2,275 to a premature stop codon (Q2275*) in the thyroglobulin protein.

Protein Prediction

Figure 3. The protein domains of TG. The TG protein has a signal peptide (amino acids 1-20), 11 type 1, three type 2, three type 3a, and two type 3b Cys-rich repeats followed by an acetylcholinesterase (AChE)-like domain. Tg can be divided into distinct regions: region I containing 10 type 1 repeats along with linker and hinge segments; region II-III contains the type 2 repeats, the type 1 repeat, and the type 3 repeats; and the AchE-like domain. The location of the ito mutation is indicated. Other mutations found in TG are noted in red. This image is interactive. Click on the mutations for more specific information.

Tg encodes thyroglobulin (Tg), a precursor of two thyroid hormones: 3,5,3’ triiodothyronine (T₃) and 3,5,3’,5’ tetraiodothyronine (thyroxine; T₄). The Tg protein has a signal peptide (amino acids 1-20), 11 type 1, three type 2, three type 3a, and two type 3b Cys-rich repeats followed by an acetylcholinesterase (AChE)-like domain (Figure 3) (1-3). Tg can be divided into distinct regions: region I containing 10 type 1 repeats between amino acids 32 and 1,211 along with linker and hinge segments; region II-III contains the type 2 repeats, the type 1 repeat at amino acids 1,510-1,564, and the type 3 repeats; and the AchE-like domain (amino acids 2,181-2,717) (4).

Each of the type 1 repeats are approximately 50 amino acids in length and have a structural motif that may bind and reversibly inhibit proteases in the lysosomal pathway (5). Type 1 domains are found in several other proteins including testicans, secreted modular calcium-binding proteins (SMOCs), the MHC class II-associated p41 invariant chain, and insulin-like growth factor binding proteins (IGFBP-1, -2, -3, -4, -5, and -6) (6). The type 2 domains are 14-17 amino acids in length and are between amino acids 1,455 and 1,502. The type 2 repeats are distant members of the GRIP and coiled-coil domain-containing protein 2 (GCC2)/GCC3 domain superfamily, which includes SVEP1 (alternatively, polydom) (7). The GCC2/GCC3 domains may assist in trafficking Tg. The type 3 domains vary between 57-160 amino acids in length and reside between amino acids 1,602 and 2,183.

The AChE-like domain mediates protein dimerization and the export of Tg by acting as an intramolecular chaperone (2;7;8). Six cysteines in the AChE-like domain are involved in the formation of interchain disulfide bonds (2;3). Megalin, a regulator of Tg transepithelial transport from the apical to basolateral surface of the thyrocyte, interacts with a heparin-binding region (SRRLKRP) in the C-terminus of Tg (9;10); the megalin-interacting domain is not in human Tg.

Tg is a 660 kDa homodimeric protein. Dimerization occurs in the endoplasmic reticulum, and is required for conformational maturation and intracellular transport of Tg to the lumen of thyroid follicles (8). Within the secretory system, Tg undergoes several posttranslational modifications including glycosylation, sialylation, sulfation, phosphorylation, iodination, and formation of approximately 60 intrachain disulfide binds per monomer. Upon reaching the follicular lumen, several tyrosines are iodinated. Several of the iodinated tyrosines are coupled to form T₃ and T₄. The release of thyroid hormone occurs after several steps including intra-and extracellular proteolytic degradation of Tg by several proteases including cysteine cathepsins B, L, and K and the aspartic protease cathepsin D (see the Background section for more details) (11;12).

An alternative transcript (designated kTg) has been identified in the mouse kidney (13). The kTg transcript transcription start site is within intron 41 of Tg and continues in-frame with the remaining thyroid-derived Tg beginning with exon 42. The encoded kTg protein is 367 amino acids in length, with a unique 13 amino acid signal peptide sequence at the N-terminus followed by a 354 amino acid sequence corresponding to the C-terminus of thyroid Tg.

The ito mutation results in substitution of glutamine 2,275 to a premature stop codon (Q2275*). Amino acid 2,275 is within the AChE-like domain.

Expression/Localization

Tg synthesis is restricted to the thyroid gland. Tg is secreted and stored in the colloid inside of the thyroid follicles. Newly secreted Tg remains near the apical membrane of thyroid cells, where it undergoes hormone formation and is internalized and/or degraded rapidly. Tg in the center of the follicle is stored in the form of aggregates to function as an iodine and hormone reservoir.

Background

Figure 4. The steps of thyroid hormone synthesis. Initial Tg synthesis occurs in the endoplasmic reticulum. After relesase into secretory vesicles, thyroid pyroxidase, TPO, and iodine coverts Tg to MIT and DIT within the colloid. Uptake in the cell is followed by proteolysis, converting the MID and DIT to T3 and T4, respectively. The T3 and T4 diffuse into the capillaries. See the text for more details.

Within the thyroid gland, epithelial cells synthesize thyroid hormones and are arranged as thyroid follicles. Between the thyroid follicles are parafollicular (alternatively, C cells), which secrete the hormone calcitonin. Tg is secreted by the thyroid cell into the follicular lumen by regulated (nonconstitutive), merocrine secretion (14;15). Upon stimulation by thyroid-stimulating hormone (TSH), Tg is reabsorbed by endocytosis/pinocytosis or phagocytosis (rodents only) to form endocytic/pinocytic vesicles or phagosomes, respectively (16;17). Thyroid hormone synthesis is regulated by the hypothalamic-pituitary-thyroid axis (HPT) negative feedback system, which involves interactions between the thyroid gland and circulating hormones. In the HPT, thyroid hormone synthesis is induced by TSH, which is secreted from anterior pituitary endocrine cells called thyrotropes. Increased thyroid hormone levels suppress further TSH secretion by acting on the hypothalamus, subsequently inhibiting the release of TSH-releasing hormone (TRH). TSH binding to the TSHR at the basal membrane of the thyroid follicle stimulates Tg expression via an increase in the intracellular level of cyclic adenosine monophosphate (cAMP) as well as the stimulation of thyroid peroxidase (TPO) and the sodium/iodide symporter (NIS) (18). After synthesis, Tg is transported to the apical membrane whereby it is released into the follicular lumen. At the apical membrane TPO and H₂O₂ catalyze the iodination of tyrosine residues on Tg to produce mono- (MIT) and di-iodotyrosines (DIT). Subsequent coupling of MIT and DIT catalyzes the production of T₃ and T₄. The iodinated Tg is pinocytosed through the apical membrane and into lysosomes where it undergoes proteolysis to release T₃ and T₄ through the basal membrane into the blood for action at peripheral target tissues whereby they control metabolism (19).

In rat thyroid FRTL-5 cells, Tg (at physiologic concentrations) suppresses the mRNA expression levels of several genes involved in TH synthesis, including Tg, Tpo, and Slc5a5 (NIS) (20-22). Tg is proposed to regulate cell growth and gene transcription by mimicking transforming growth factor (TGF)-β in certain cell types (23;24). Tg binds several proteins on the surface of thyroid cells (e.g., asialoglycoprotein receptor (ASGPR; (25)), megalin (gp300; (26)), and an N-acetylglucosamine receptor (27)), but none are significantly associated with intracellular signaling. These Tg-binding proteins are not specific to Tg, and are able to bind other large glycoproteins.

Mutations in TG have been linked to congenital goiter with hypothyroidism (euthyroidism) (OMIM: #274700) (28-30) as well as endemic and euthyroid nonendemic simple goiter (31-33). Most known pathogenic Tg mutations occur within region I and the AChE-like domain (18). Congenital hypothyroidism is the most frequent endocrine disease in infants with a prevalence of 1:2000-1:4000 in newborns (34;35). Congenital hypothyroidism is an autosomal recessive trait and is characterized by increased levels of TSH due to reduced thyroid function. Congenital hypothyroidism patients that are left untreated can exhibit abnormal growth and development as well as mental retardation. Early treatment with L-thyroxine results in normal development. Simple goiter is an enlargement of the thyroid gland that is not caused by an inflammatory or neoplastic process. TG is also a susceptibility gene for familial autoimmune thyroid disease (AITD) (36). Tg is an autoantigen in immune diseases of the thyroid [(21;22); reviewed in (13)]. The 8q24 locus, which contains TG, is linked to autoimmune thyroid disease (AITD) including Graves’ disease and Hashimoto’s thyroiditis. TG is an AITD susceptibility gene in both humans and mice (37) (OMIM: #608175). Graves’ disease is characterized by the production of TSHR-stimulating antibodies subsequently leading to hyperthyroidism. Hashimoto’s is characterized by apoptosis of thyrocytes leading to hypothyroidism. Both Graves’ and Hashimoto’s share many features including T cell infiltration of the thyroid and antithyroid autoantibody (anti-Tg and -TPO antibodies) production.

Putative Mechanism

The cog/cog (Tg^cog; MGI:1856829) mouse model has a point mutation in Tg that causes a Leu to Pro substitution at amino acid 2,263 (38;39). The cog/cog mouse exhibits congenital hypothyroidism with goiter as well as abnormal growth, mild anemia, and defects in central nervous system development (e.g., microcephalic cerebrum with hypomyelination) (40;41).  Tg expression is normal in the cog/cog mice, but the Tg protein exhibits increased proteolysis (42;43). Furthermore, the Tg^cog/cog protein exhibited abnormal folding, dimerization, and export. The cog/cog mouse also had increased levels of several ER molecular chaperones. Taken together, the phenotypes of the cog/cog mouse are indicative of an ER storage defect (15). As a result, the levels of total serum T₄ and T₃ are low with a concomitant increase in serum TSH levels (41). A second mouse model has an ENU-induced mutation in Tg (Tg^R1471X; MGI:5694939). The Tg^R1471X mice exhibited stunted growth (44). The ito phenotype is similar to that of these two mouse models indicating that Tg function is impaired. Expression and localization of Tg^ito has not been examined.

Primers

PCR Primer
ito_pcr_F: GCCATAGACATGCTGCTACTC
ito_pcr_R: ACAAAGGGAGCTCAGTGTCC

Sequencing Primer
ito_seq_F: AATGACCTGGAGCTTCCTCAGTG
ito_seq_R: CAGTGTCCCTAAGGATAATACTGTGG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 405 nucleotides is amplified (chromosome 15, + strand):

1   gccatagaca tgctgctact cctactttct ggccgtatca atgacctgga gcttcctcag
61  tgctccagag ctacagaaaa accaggcctt tcactctggc cacaagaatg gttttggagg
121 agagggaaag atagcaaccc cccttgctat ttctctgaaa atcctgtgcc ttatttctgc
181 agggccagct gctggcagcc aggtacccgt acccccacac ctccacaaat caatgaagac
241 tgcttatatc tcaatgtgtt tgtccctgag aacctggtaa gttaagaatc aggatgtgtt
301 gtctggtgaa tagctccctt tggaaatcct tttcccacct tccctgggct ctatgggacc
361 tgtgctccca cagtattatc cttagggaca ctgagctccc tttgt

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Malthiery, Y., and Lissitzky, S. (1987) Primary Structure of Human Thyroglobulin Deduced from the Sequence of its 8448-Base Complementary DNA. Eur J Biochem. 165, 491-498.

  2. Park, Y. N., and Arvan, P. (2004) The Acetylcholinesterase Homology Region is Essential for Normal Conformational Maturation and Secretion of Thyroglobulin. J Biol Chem. 279, 17085-17089.

  3. Swillens, S., Ludgate, M., Mercken, L., Dumont, J. E., and Vassart, G. (1986) Analysis of Sequence and Structure Homologies between Thyroglobulin and Acetylcholinesterase: Possible Functional and Clinical Significance. Biochem Biophys Res Commun. 137, 142-148.

  4. Lee, J., and Arvan, P. (2011) Repeat Motif-Containing Regions within Thyroglobulin. J Biol Chem. 286, 26327-26333.

  5. Mihelic, M., and Turk, D. (2007) Two Decades of Thyroglobulin Type-1 Domain Research. Biol Chem. 388, 1123-1130.

  6. Novinec, M., Kordis, D., Turk, V., and Lenarcic, B. (2006) Diversity and Evolution of the Thyroglobulin Type-1 Domain Superfamily. Mol Biol Evol. 23, 744-755.

  7. Lee, J., Di Jeso, B., and Arvan, P. (2011) Maturation of Thyroglobulin Protein Region I. J Biol Chem. 286, 33045-33052.

  8. Lee, J., Di Jeso, B., and Arvan, P. (2008) The Cholinesterase-Like Domain of Thyroglobulin Functions as an Intramolecular Chaperone. J Clin Invest. 118, 2950-2958.

  9. Marino, M., Friedlander, J. A., McCluskey, R. T., and Andrews, D. (1999) Identification of a Heparin-Binding Region of Rat Thyroglobulin Involved in Megalin Binding. J Biol Chem. 274, 30377-30386.

  10. Marino, M., Zheng, G., Chiovato, L., Pinchera, A., Brown, D., Andrews, D., and McCluskey, R. T. (2000) Role of Megalin (gp330) in Transcytosis of Thyroglobulin by Thyroid Cells. A Novel Function in the Control of Thyroid Hormone Release. J Biol Chem. 275, 7125-7137.

  11. Brix, K., Lemansky, P., and Herzog, V. (1996) Evidence for Extracellularly Acting Cathepsins Mediating Thyroid Hormone Liberation in Thyroid Epithelial Cells. Endocrinology. 137, 1963-1974.

  12. Tepel, C., Bromme, D., Herzog, V., and Brix, K. (2000) Cathepsin K in Thyroid Epithelial Cells: Sequence, Localization and Possible Function in Extracellular Proteolysis of Thyroglobulin. J Cell Sci. 113 Pt 24, 4487-4498.

  13. Wu, H., Suzuki, S., Sellitti, D. F., Doi, S. Q., Tanigawa, K., Aizawa, S., Akama, T., Kawashima, A., Mishima, M., Ishii, N., Yoshida, A., Hisatome, I., Koles, N. L., Katoh, R., and Suzuki, K. (2009) Expression of a Thyroglobulin (Tg) Variant in Mouse Kidney Glomerulus. Biochem Biophys Res Commun. 389, 269-273.

  14. Arvan, P., Kim, P. S., Kuliawat, R., Prabakaran, D., Muresan, Z., Yoo, S. E., and Abu Hossain, S. (1997) Intracellular Protein Transport to the Thyrocyte Plasma Membrane: Potential Implications for Thyroid Physiology. Thyroid. 7, 89-105.

  15. Kim, P. S., Kwon, O. Y., and Arvan, P. (1996) An Endoplasmic Reticulum Storage Disease Causing Congenital Goiter with Hypothyroidism. J Cell Biol. 133, 517-527.

  16. Ericson, L. E., and Johansson, B. R. (1977) Early Effects of Thyroid Stimulating Hormone (TSH) on Exocytosis and Endocytosis in the Thyroid. Acta Endocrinol (Copenh). 86, 112-118.

  17. Ericson, L. E., Ring, K. M., and Ofverholm, T. (1983) Selective Macropinocytosis of Thyroglobulin in Rat Thyroid Follicles. Endocrinology. 113, 1746-1753.

  18. Targovnik, H. M., Esperante, S. A., and Rivolta, C. M. (2010) Genetics and Phenomics of Hypothyroidism and Goiter due to Thyroglobulin Mutations. Mol Cell Endocrinol. 322, 44-55.

  19. Marino, M., and McCluskey, R. T. (2000) Role of Thyroglobulin Endocytic Pathways in the Control of Thyroid Hormone Release. Am J Physiol Cell Physiol. 279, C1295-306.

  20. Sellitti, D. F., and Suzuki, K. (2014) Intrinsic Regulation of Thyroid Function by Thyroglobulin. Thyroid. 24, 625-638.

  21. Suzuki, K., Lavaroni, S., Mori, A., Ohta, M., Saito, J., Pietrarelli, M., Singer, D. S., Kimura, S., Katoh, R., Kawaoi, A., and Kohn, L. D. (1998) Autoregulation of Thyroid-Specific Gene Transcription by Thyroglobulin. Proc Natl Acad Sci U S A. 95, 8251-8256.

  22. Suzuki, K., Mori, A., Saito, J., Moriyama, E., Ullianich, L., and Kohn, L. D. (1999) Follicular Thyroglobulin Suppresses Iodide Uptake by Suppressing Expression of the sodium/iodide Symporter Gene. Endocrinology. 140, 5422-5430.

  23. Sellitti, D. F., Puggina, E., Lagranha, C., Doi, S., Pithon-Curi, T., Kohn, L. D., and Suzuki, K. (2007) TGF-Beta-Like Transcriptional Effects of Thyroglobulin (Tg) in Mouse Mesangial Cells. Endocr J. 54, 449-458.

  24. Sellitti, D. F., Suzuki, K., Doi, S. Q., LaGranha, C., Machado, M., Matos, T., and Kohn, L. D. (2001) Thyroglobulin Increases Cell Proliferation and Suppresses Pax-8 in Mesangial Cells. Biochem Biophys Res Commun. 285, 795-799.

  25. Consiglio, E., Salvatore, G., Rall, J. E., and Kohn, L. D. (1979) Thyroglobulin Interactions with Thyroid Plasma Membranes. the Existence of Specific Receptors and their Potential Role. J Biol Chem. 254, 5065-5076.

  26. Zheng, G., Marino', M., Zhao, J., and McCluskey, R. T. (1998) Megalin (gp330): A Putative Endocytic Receptor for Thyroglobulin (Tg). Endocrinology. 139, 1462-1465.

  27. Miquelis, R., Alquier, C., and Monsigny, M. (1987) The N-Acetylglucosamine-Specific Receptor of the Thyroid. Binding Characteristics, Partial Characterization, and Potential Role. J Biol Chem. 262, 15291-15298.

  28. Ieiri, T., Cochaux, P., Targovnik, H. M., Suzuki, M., Shimoda, S., Perret, J., and Vassart, G. (1991) A 3' Splice Site Mutation in the Thyroglobulin Gene Responsible for Congenital Goiter with Hypothyroidism. J Clin Invest. 88, 1901-1905.

  29. Medeiros-Neto, G., Targovnik, H. M., and Vassart, G. (1993) Defective Thyroglobulin Synthesis and Secretion Causing Goiter and Hypothyroidism. Endocr Rev. 14, 165-183.

  30. Rivolta, C. M., and Targovnik, H. M. (2006) Molecular Advances in Thyroglobulin Disorders. Clin Chim Acta. 374, 8-24.

  31. Corral, J., Martin, C., Perez, R., Sanchez, I., Mories, M. T., San Millan, J. L., Miralles, J. M., and Gonzalez-Sarmiento, R. (1993) Thyroglobulin Gene Point Mutation Associated with Non-Endemic Simple Goitre. Lancet. 341, 462-464.

  32. Perez-Centeno, C., Gonzalez-Sarmiento, R., Mories, M. T., Corrales, J. J., and Miralles-Garcia, J. M. (1996) Thyroglobulin Exon 10 Gene Point Mutation in a Patient with Endemic Goiter. Thyroid. 6, 423-427.

  33. Gonzalez-Sarmiento, R., Corral, J., Mories, M. T., Corrales, J. J., Miguel-Velado, E., and Miralles-Garcia, J. M. (2001) Monoallelic Deletion in the 5' Region of the Thyroglobulin Gene as a Cause of Sporadic Nonendemic Simple Goiter. Thyroid. 11, 789-793.

  34. Park, S. M., and Chatterjee, V. K. (2005) Genetics of Congenital Hypothyroidism. J Med Genet. 42, 379-389.

  35. Rastogi, M. V., and LaFranchi, S. H. (2010) Congenital Hypothyroidism. Orphanet J Rare Dis. 5, 17-1172-5-17.

  36. Tomer, Y., Greenberg, D. A., Concepcion, E., Ban, Y., and Davies, T. F. (2002) Thyroglobulin is a Thyroid Specific Gene for the Familial Autoimmune Thyroid Diseases. J Clin Endocrinol Metab. 87, 404-407.

  37. Ban, Y., Greenberg, D. A., Concepcion, E., Skrabanek, L., Villanueva, R., and Tomer, Y. (2003) Amino Acid Substitutions in the Thyroglobulin Gene are Associated with Susceptibility to Human and Murine Autoimmune Thyroid Disease. Proc Natl Acad Sci U S A. 100, 15119-15124.

  38. Kim, P. S., Hossain, S. A., Park, Y. N., Lee, I., Yoo, S. E., and Arvan, P. (1998) A Single Amino Acid Change in the Acetylcholinesterase-Like Domain of Thyroglobulin Causes Congenital Goiter with Hypothyroidism in the cog/cog Mouse: A Model of Human Endoplasmic Reticulum Storage Diseases. Proc Natl Acad Sci U S A. 95, 9909-9913.

  39. Taylor, B. A., and Rowe, L. (1987) The Congenital Goiter Mutation is Linked to the Thyroglobulin Gene in the Mouse. Proc Natl Acad Sci U S A. 84, 1986-1990.

  40. Sugisaki, T., Beamer, W. G., and Noguchi, T. (1992) Microcephalic Cerebrum with Hypomyelination in the Congenital Goiter Mouse (Cog). Neurochem Res. 17, 1037-1040.

  41. Beamer, W. G., Maltais, L. J., DeBaets, M. H., and Eicher, E. M. (1987) Inherited Congenital Goiter in Mice. Endocrinology. 120, 838-840.

  42. Adkison, L. R., Taylor, S., and Beamer, W. G. (1990) Mutant Gene-Induced Disorders of Structure, Function and Thyroglobulin Synthesis in Congenital Goitre (cog/cog) in Mice. J Endocrinol. 126, 51-58.

  43. Basche, M., Beamer, W. G., and Schneider, A. B. (1989) Abnormal Properties of Thyroglobulin in Mice with Inherited Congenital Goiter (cog/cog). Endocrinology. 124, 1822-1829.

  44. Andrews, T. D., Whittle, B., Field, M. A., Balakishnan, B., Zhang, Y., Shao, Y., Cho, V., Kirk, M., Singh, M., Xia, Y., Hager, J., Winslade, S., Sjollema, G., Beutler, B., Enders, A., and Goodnow, C. C. (2012) Massively Parallel Sequencing of the Mouse Exome to Accurately Identify Rare, Induced Mutations: An Immediate Source for Thousands of New Mouse Models. Open Biol. 2, 120061.