Phenotypic Mutation 'plus-sized'

• Allele: plus-sized
• Mutation Type: missense
• Chromosome: 2
• Coordinate: 66,073,023 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Ttc21b
• Gene Name: tetratricopeptide repeat domain 21B
• Synonym(s): Thm1, line 158, aln, 2410066K11Rik
• Chromosomal Location: 66,014,671-66,086,961 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of TTC21 family, containing several tetratricopeptide repeat (TPR) domains. This protein is localized to the cilium axoneme, and may play a role in retrograde intraflagellar transport in cilia. Mutations in this gene are associated with various ciliopathies, nephronophthisis 12, and asphyxiating thoracic dystrophy 4. [provided by RefSeq, Oct 2011] ; PHENOTYPE: Homozygous mutation of this gene is embryonic lethal. Mutant embryos exhibit several deformities including polydactyly, microphthalmia, irregular shape of the long bones, rib fusion and truncation, neural tube defects, and abnormal brain structure. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Leucine changed to Serine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000099779] [ENSMUSP00000131758]
• AlphaFold: Q0HA38
• SMART Domains: Protein: ENSMUSP00000099779; Gene: ENSMUSG00000034848; AA Change: L221S

Domain	Start	End	E-Value	Type
Blast:TPR	109	141	5e-12	BLAST
Blast:TPR	178	211	3e-12	BLAST
TPR	324	357	4.21e1	SMART
low complexity region	379	390	N/A	INTRINSIC
TPR	492	525	8.51e0	SMART
TPR	526	559	5.92e1	SMART
TPR	563	596	7.69e1	SMART
TPR	721	754	3.07e-5	SMART
TPR	755	788	9.45e0	SMART
TPR	790	821	9.24e1	SMART
TPR	830	863	3.05e0	SMART
TPR	883	916	1.55e-1	SMART
TPR	917	950	8.74e0	SMART
TPR	951	984	6.75e1	SMART
Blast:TPR	1023	1054	5e-13	BLAST
Blast:TPR	1156	1189	1e-12	BLAST
TPR	1196	1229	9.7e0	SMART
TPR	1265	1298	1.02e1	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
  (Using ENSMUST00000102718)
• SMART Domains: Protein: ENSMUSP00000131758; Gene: ENSMUSG00000034848; AA Change: L221S

Domain	Start	End	E-Value	Type
Blast:TPR	108	141	3e-12	BLAST
Blast:TPR	178	211	3e-12	BLAST
TPR	324	357	4.21e1	SMART
low complexity region	379	390	N/A	INTRINSIC
TPR	492	525	8.51e0	SMART
TPR	526	559	5.92e1	SMART
TPR	563	596	7.69e1	SMART
TPR	721	754	3.07e-5	SMART
TPR	755	788	9.45e0	SMART
TPR	790	821	9.24e1	SMART
TPR	830	863	3.05e0	SMART
TPR	883	916	1.55e-1	SMART
TPR	917	950	8.74e0	SMART
TPR	951	984	6.75e1	SMART
Blast:TPR	1023	1054	4e-13	BLAST
Blast:TPR	1156	1189	9e-13	BLAST
TPR	1196	1229	9.7e0	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
  (Using ENSMUST00000125446)
• Meta Mutation Damage Score: 0.8328
• Is this an essential gene?: Essential (E-score: 1.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2022-11-11 1:45 PM by Lindsay Scott
• Record Created: 2016-01-26 2:25 PM
• Record Posted: 2018-07-27
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine, Katherine Timer
• Authors: Zhao Zhang, Emre Turer and Bruce Beutler

Accession Number

NCBI RefSeq: NM_001047604 (variant 1), NM_001290669 (variant 2); MGI:1920918

Alleles Listed at MGI

All Mutations and Alleles(7) : Chemically induced (ENU)(1) Chemically induced (other)(1) Targeted(5)

Phenotypic Description

Figure 1. Plus-sized mice exhibited increased body weights compared to wild-type littermates . Scaled weight data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The plus-sized phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R3847, some of which showed increased body weights compared to wild-type littermates (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the body weight phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 85 mutations (X-axis) identified in the G1 male of pedigree R3847. Weight data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Figure 3. CRISPR- Ttc21b mice exhibited increased body weights compared to wild-type littermates . Scaled weight data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Whole exome HiSeq sequencing of the G1 grandsire identified 85 mutations. The body weight phenotype was linked to a mutation in Ttc21b: a T to C transition at base pair 66,242,679 (v38) on chromosome 2, or base pair 13,968 in the GenBank genomic region NC_000068 encoding Ttc21b. Linkage was found with a recessive model of inheritance, wherein four variant homozygotes departed phenotypically from 14 homozygous reference mice and 19 heterozygous mice with a P value of 7.354 x 10^-10 (Figure 2).  

The mutation corresponds to residue 745 in the mRNA sequence NM_001047604 within exon 6 of 29 total exons.

729 GAGAAGAAAATGAAATTACAACTGGCTTTACAG 216 -E--K--K--M--K--L--Q--L--A--L--Q-

The mutated nucleotide is indicated in red. The mutation results in a leucine (L) to serine (S) substitution at position 221 (L221S) in the TTC21B protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.998).

The causative mutation for the body weight phenotype was validated to be in Ttc21b by CRISPR-mediated replacement of the Ttc21b^plus-sized allele (Figure 3; P = 0.006238).

Protein Prediction

Figure 4. Domain organization of TTC21B. The location of the plus-sized mutation is indicated. Abbreviations: TPR, tetratricopeptide repeat.

Tetratricopeptide Repeat Domain 21B (TTC21B; alternatively, THM1 or IFT139) has 19 tetratricopeptide repeat (TPR) domains (1). TPRs are 34-amino acid motifs that mediate protein-protein interactions and the assembly of multiprotein complexes (2). The plus-sized mutation results in a leucine (L) to serine (S) substitution at position 221 (L221S) in the TTC21B protein; Leu221 is within TPR3.

Expression/Localization

TTC21B is expressed in the brain and kidney (3). TTC21B localizes to the primary cilium at the axoneme (1;4;5).

Background

Figure 5. TTC21B is a component of the IFT-A complex to mediate retrograde transport in cilia. The BBSome organizes IFT-A, IFT-B and kinesin motors into a functional complex. Entry of protein cargo to the cilium is regulated by active forms of Rab8, a master modulator for the ciliary protein trafficking. Rab8 is recruited to the basal body of primary cilium. The activities of Rab8 are then regulated by Rabin8, and its activity and basal body localization is modulated by the BBSome and Rab11. IFT particles dissociate after reaching the ciliary tip, and then the BBSome and DYF-2 coordinate to reorganize the entire IFT complex to ready it for retrograde transport.

Almost every cell in the body carries a single primary cilium at a certain stage of its life cycle. Primary cilia are required for planar cell polarity, phototransduction, olfaction, adipocyte differentiation, and Hedgehog signaling. Several events occur to facilitate transport of membrane proteins to the cilia, including sorting and packaging into carrier vesicles, docking and fusion of vesicles with the base of the cilium and intraflagellar transport (IFT) of protein complexes from cilia base to cilia tip.

IFT complexes (IFT-A and IFT-B) and the BBSome (see the record for corpulent for information about a component of the BBsome, BBS9) as well as kinesin and dynein motors mediate IFT (Figure 5). The BBSome organizes IFT-A, IFT-B, and the kinesin motors into a functional complex. The BBsome associates with the ciliary membrane and binds to the Rab8 guanosyl exchange factor RAB3IP/Rabin8 (6). The Rab8^GTP localizes to the cilium whereby it promotes the extension of the ciliary membrane as well as docking and fusion of vesicles to the base of the ciliary membrane (6).

IFT-A and IFT-B are comprised of several subunits and peripherally associated proteins. TTC21B is a component of IFT-A, which facilitates retrograde transport of cargo from the ciliary tip to the cell body (1;5). TTC21B is also required for cilia formation (5), early forebrain patterning and development through the restriction of sonic hedgehog activity (1;3), and proper granule cell radial migration in Bergmann glia (7).

Mutations in TTC21B are associated with nephronophthisis-12 [OMIM: #613820; (4)] and short-rib thoracic dysplasia-4 with or without polydactyly [OMIM: #613819; (4)]. Nephronophthisis-12 and short-rib thoracic dysplasia-4 are ciliopathies. Nephronophthisis-12 is a cystic kidney disease that leads to renal failure. Short-rib thoracic dysplasia is a skeletal ciliopathy characterized by a constricted thoracic cage, short ribs, shortened tubular bones, and a 'trident' appearance of the acetabular roof. A TTC21B mutation (p.P209L) was identified in patients with focal segmental glomerulosclerosis (FSGS) and tubulointerstitial lesions (8;9).

Mice expressing an ENU-induced mutant Ttc21b allele (designated alien) have cilia with bulb-like structures at their tips and exhibit craniofacial abnormalities, polydactyly, defects in the length and shape of long bones, rib fusions, truncated ribs, misaligned vertebrae, neural tube defects, disorganized brain architecture, reduced brain sizes, absent olfactory bulbs, and polycystic kidneys (1;3;10;11). The brain phenotype observed in the alien mice was attributed to increased Sonic hedgehog and FGF8 signaling (3).

Putative Mechanism

Deletion of Ttc21b during adulthood causes obesity, diabetes, hypertension and fatty liver disease in mice; gender differences to weight gain susceptibility and metabolic dysfunction were observed (12). Primary cilia were shortened and neurons of the hypothalamic arcuate nucleus had bulbous distal tips. Expression of anorexogenic pro-opiomelanocortin was reduced in the arcuate nucleus of the Ttc21b conditional knockout mice and the mice were hyperphagic. The obesity phenotype observed in the plus-sized mice is putatively due to reduced expression of the anorexogenic pro-opiomelanocortin (Pomc) in the arcuate nucleus, resulting in hyperphagia.

Primers

PCR Primer
plus-sized_pcr_F: CTTCACACTGAGGCAGTATGGTTTC
plus-sized_pcr_R: AGAATGATGTGCAACCTTGTTG

Sequencing Primer
plus-sized_seq_F: CTGTCTATGTTCCCACAAATGAGGG
plus-sized_seq_R: TATTCTGAAATAGCCCGGGC

Genotyping

Genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the mutation.

PCR Primers

ICSI-R3847-plus-sized_PCR_F: 5’- CTTCACACTGAGGCAGTATGGTTTC-3’

ICSI-R3847-plus-sized_PCR_R: 5’- AGAATGATGTGCAACCTTGTTG-3’

Sequencing Primers

ICSI-R3847-plus-sized_SEQ_F: 5’- CTGTCTATGTTCCCACAAATGAGGG-3’
 

ICSI-R3847-plus-sized_SEQ_R: 5’- TATTCTGAAATAGCCCGGGC-3’
 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               hold

The following sequence of 647 nucleotides is amplified (NCBI RefSeq: NC_000068, chromosome 2:66242305-66242951):

cttcacactg aggcagtatg gtttcctttg ggaactccct gtctatgttc ccacaaatga       

gggttattga gaagttcaga atcaccaggc ttgatagcaa gcactttaat cactaagtca      

cctctccagc cctaattctg tttttaaaaa caatacagtt ttaaatactt tttcacttct      

atgatgcttg caataaaatc acttattact tgaaaaatta aattttatgc tgtgtaagtc      

ttgtaatgga ctgaacaaaa tctgattttc tttgttctca tgtctaacta gatccaaaga      

ggatgtgata tcattttaca cataaccttt gtgctgtctc cactgtctga tcccaatcct      

gtaaagccag ttgtaatttc attttcttct caaaggcagg aaggaagctt ggaaagttta      

caattatctg gctcacggtc tccagagctc cggaataatt ctgtcgaatc tcaaggcaca      

gaacctaata ggaggagaaa aatgatgtca aagcatggcc ttgtacatca ggtcctctca      

ggccagccta ggctacagag taagttccag atcagcccgg gctatttcag aatactgcta      

cttagcattt tatgatattt tttttcaaca aggttgcaca tcattct

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (Chr. (+) = A>G).

References

  1. Tran, P. V., Haycraft, C. J., Besschetnova, T. Y., Turbe-Doan, A., Stottmann, R. W., Herron, B. J., Chesebro, A. L., Qiu, H., Scherz, P. J., Shah, J. V., Yoder, B. K., and Beier, D. R. (2008) THM1 Negatively Modulates Mouse Sonic Hedgehog Signal Transduction and Affects Retrograde Intraflagellar Transport in Cilia. Nat Genet. 40, 403-410.

  2. D'Andrea, L. D., and Regan, L. (2003) TPR Proteins: The Versatile Helix. Trends Biochem Sci. 28, 655-662.

  3. Stottmann, R. W., Tran, P. V., Turbe-Doan, A., and Beier, D. R. (2009) Ttc21b is Required to Restrict Sonic Hedgehog Activity in the Developing Mouse Forebrain. Dev Biol. 335, 166-178.

  4. Davis, E. E., Zhang, Q., Liu, Q., Diplas, B. H., Davey, L. M., Hartley, J., Stoetzel, C., Szymanska, K., Ramaswami, G., Logan, C. V., Muzny, D. M., Young, A. C., Wheeler, D. A., Cruz, P., Morgan, M., Lewis, L. R., Cherukuri, P., Maskeri, B., Hansen, N. F., Mullikin, J. C., Blakesley, R. W., Bouffard, G. G., NISC Comparative Sequencing Program, Gyapay, G., Rieger, S., Tonshoff, B., Kern, I., Soliman, N. A., Neuhaus, T. J., Swoboda, K. J., Kayserili, H., Gallagher, T. E., Lewis, R. A., Bergmann, C., Otto, E. A., Saunier, S., Scambler, P. J., Beales, P. L., Gleeson, J. G., Maher, E. R., Attie-Bitach, T., Dollfus, H., Johnson, C. A., Green, E. D., Gibbs, R. A., Hildebrandt, F., Pierce, E. A., and Katsanis, N. (2011) TTC21B Contributes both Causal and Modifying Alleles Across the Ciliopathy Spectrum. Nat Genet. 43, 189-196.

  5. Niwa, S. (2016) The Nephronophthisis-Related Gene Ift-139 is Required for Ciliogenesis in Caenorhabditis Elegans. Sci Rep. 6, 31544.

  6. Nachury, M. V., Loktev, A. V., Zhang, Q., Westlake, C. J., Peranen, J., Merdes, A., Slusarski, D. C., Scheller, R. H., Bazan, J. F., Sheffield, V. C., and Jackson, P. K. (2007) A Core Complex of BBS Proteins Cooperates with the GTPase Rab8 to Promote Ciliary Membrane Biogenesis. Cell. 129, 1201-1213.

  7. Driver, A. M., Shumrick, C., and Stottmann, R. W. (2017) Ttc21b is Required in Bergmann Glia for Proper Granule Cell Radial Migration. J Dev Biol. 5, 10.3390/jdb5040018.

  8. Bullich, G., Vargas, I., Trujillano, D., Mendizabal, S., Pinero-Fernandez, J. A., Fraga, G., Garcia-Solano, J., Ballarin, J., Estivill, X., Torra, R., and Ars, E. (2017) Contribution of the TTC21B Gene to Glomerular and Cystic Kidney Diseases. Nephrol Dial Transplant. 32, 151-156.

  9. Huynh Cong, E., Bizet, A. A., Boyer, O., Woerner, S., Gribouval, O., Filhol, E., Arrondel, C., Thomas, S., Silbermann, F., Canaud, G., Hachicha, J., Ben Dhia, N., Peraldi, M. N., Harzallah, K., Iftene, D., Daniel, L., Willems, M., Noel, L. H., Bole-Feysot, C., Nitschke, P., Gubler, M. C., Mollet, G., Saunier, S., and Antignac, C. (2014) A Homozygous Missense Mutation in the Ciliary Gene TTC21B Causes Familial FSGS. J Am Soc Nephrol. 25, 2435-2443.

  10. Tran, P. V., Talbott, G. C., Turbe-Doan, A., Jacobs, D. T., Schonfeld, M. P., Silva, L. M., Chatterjee, A., Prysak, M., Allard, B. A., and Beier, D. R. (2014) Downregulating Hedgehog Signaling Reduces Renal Cystogenic Potential of Mouse Models. J Am Soc Nephrol. 25, 2201-2212.

  11. Herron, B. J., Lu, W., Rao, C., Liu, S., Peters, H., Bronson, R. T., Justice, M. J., McDonald, J. D., and Beier, D. R. (2002) Efficient Generation and Mapping of Recessive Developmental Mutations using ENU Mutagenesis. Nat Genet. 30, 185-189.

  12. Jacobs, D. T., Silva, L. M., Allard, B. A., Schonfeld, M. P., Chatterjee, A., Talbott, G. C., Beier, D. R., and Tran, P. V. (2016) Dysfunction of Intraflagellar Transport-A Causes Hyperphagia-Induced Obesity and Metabolic Syndrome. Dis Model Mech. 9, 789-798.