Phenotypic Mutation 'king' (pdf version)
Alleleking
Mutation Type missense
Chromosome5
Coordinate140,891,080 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Card11
Gene Name caspase recruitment domain family, member 11
Synonym(s) CARMA1, BIMP3, 2410011D02Rik, 0610008L17Rik
Chromosomal Location 140,872,999-141,000,596 bp (-)
MGI Phenotype Mice homozygous for a targeted null mutation exhibit defects in antigen receptor signalling in both T and B lymphocytes.
Accession Number

NCBI RefSeq: NM_175362; MGI: 1916978

Mapped Yes 
Amino Acid Change Leucine changed to Glutamine
Institutional SourceBeutler Lab
Ref Sequences
L525Q in NCBI: NP_780571.1 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
Pfam:CARD 23 109 1.5e-20 PFAM
coiled coil region 176 440 N/A INTRINSIC
low complexity region 475 487 N/A INTRINSIC
low complexity region 540 554 N/A INTRINSIC
low complexity region 620 630 N/A INTRINSIC
PDZ 679 760 1.1e-3 SMART
Blast:SH3 781 843 N/A BLAST
low complexity region 844 855 N/A INTRINSIC
low complexity region 925 939 N/A INTRINSIC
SCOP:d1kjwa2 975 1154 1e-16 SMART
Blast:GuKc 978 1148 N/A BLAST
PDB:1JXO|B 1046 1154 N/A PDB
Predicted Effect probably benign

PolyPhen 2 Score 0.022 (Sensitivity: 0.96; Specificity: 0.80)
(Using NCBI: NP_780571.1)
Phenotypic Category decrease in CD8 response, decrease in NK cell response, decrease in NK cells, decrease in NK T cells, hematopoietic system, immune system, skin/coat/nails
Penetrance 100% 
Alleles Listed at MGI

All alleles(6) : Targeted, knock-out(3) Targeted, other(1) Chemically induced(2)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
unmodulated APN 5 140897997 missense probably damaging 1.00
IGL00961:Card11 APN 5 140899709 missense possibly damaging 0.60
IGL01645:Card11 APN 5 140878023 missense probably benign 0.00
IGL01731:Card11 APN 5 140882302 missense possibly damaging 0.64
IGL01782:Card11 APN 5 140927726 missense probably benign 0.01
IGL01935:Card11 APN 5 140883546 missense probably damaging 1.00
IGL01991:Card11 APN 5 140913378 missense possibly damaging 0.84
IGL02447:Card11 APN 5 140906924 missense possibly damaging 0.81
IGL02583:Card11 APN 5 140878126 missense probably benign 0.01
IGL03255:Card11 APN 5 140898331 missense probably benign 0.01
dealer UTSW 5 140885877 missense
hubei UTSW 5 140906767 missense probably damaging 0.98
May UTSW 5 140876495 nonsense probably null
Tumnus UTSW 5 140885945 missense possibly damaging 0.75
unmodulated2 UTSW 5 140883782 intron probably null
R0046:Card11 UTSW 5 140908524 missense possibly damaging 0.92
R0285:Card11 UTSW 5 140887101 missense probably damaging 1.00
R0452:Card11 UTSW 5 140880370 missense probably benign 0.01
R1486:Card11 UTSW 5 140876519 missense probably benign 0.00
R1710:Card11 UTSW 5 140902905 nonsense probably null
R1733:Card11 UTSW 5 140906633 missense possibly damaging 0.88
R1817:Card11 UTSW 5 140885560 missense probably benign 0.00
R1818:Card11 UTSW 5 140885560 missense probably benign 0.00
R2436:Card11 UTSW 5 140882362 missense possibly damaging 0.89
R2904:Card11 UTSW 5 140889133 missense probably benign 0.09
R3706:Card11 UTSW 5 140887135 missense probably damaging 0.99
R3708:Card11 UTSW 5 140887135 missense probably damaging 0.99
R4081:Card11 UTSW 5 140913168 missense noncoding transcript
R4259:Card11 UTSW 5 140927768 makesense noncoding transcript
R4778:Card11 UTSW 5 140883782 unclassified probably null
R4877:Card11 UTSW 5 140885877 missense probably damaging 1.00
R4889:Card11 UTSW 5 140885945 missense possibly damaging 0.75
R4910:Card11 UTSW 5 140874414 missense probably damaging 1.00
R5011:Card11 UTSW 5 140876520 missense noncoding transcript
R5257:Card11 UTSW 5 140876425 missense possibly damaging 0.93
R5258:Card11 UTSW 5 140876425 missense possibly damaging 0.93
R5682:Card11 UTSW 5 140902911 nonsense probably null
R5754:Card11 UTSW 5 140899769 missense probably damaging 0.99
R5873:Card11 UTSW 5 140908638 missense probably damaging 1.00
V7732:Card11 UTSW 5 140876495 nonsense probably null
X0067:Card11 UTSW 5 140885592 missense possibly damaging 0.60
Mode of Inheritance Autosomal Recessive
Local Stock Sperm, gDNA
MMRRC Submission 030114-UCD
Last Updated 09/08/2017 4:03 PM by Diantha La Vine
Record Created unknown
Record Posted 09/04/2008
Phenotypic Description
The king phenotype was identified among ENU-mutagenized G3 mice in a screen for mutations that impair natural killer (NK) or CD8+ T cell effector responses (In vivo NK cell and CD8+ T cell cytotoxicity screen) (1). Mice were immunized with irradiated ovalbumin (OVA)-expressing cells, and one week later, injected with control C57BL/6J cells, NK cell-specific target cells (syngeneic class I MHC-deficient cells), and an antigen-specific OVA-expressing target population (C57BL/6J splenocytes). King mice failed to kill OVA-expressing cells or class I MHC-deficient cells. In a secondary screen, CD8+ T cells were isolated one week after OVA-immunization, expanded in vitro, and tested for production of IFN-γ upon restimulation. CD8+ T cells from king mice did not undergo secondary expansion in vitro, nor produce IFN-γ upon restimulation.
 
Antigen presentation by CD8+ T cells is normal in king mice.  King dendritic cells (DC) efficiently cross-prime CD8+ T cells, and upregulate costimulatory molecules (CD40, CD80, CD86, MHC class I and II) normally after stimulation by apoptotic cells or TLR ligands.  In response to treatment with TCR-crosslinking antibodies (α-CD3/28), king T cells upregulate CD69 and CD44 nearly normally. However, they fail to upregulate CD25 (IL-2Rα chain) and fail to proliferate, indicating that TCR-mediated T cell activation and proliferation are impaired in king mutants. The proliferation defect can be partially rescued by IL-2 treatment of king T cells. King T cells do not produce IL-2.
 
King mice display reduced basal serum immunoglobulin levels (IgM, IgG1, IgG2a, IgG2b, IgG3), impaired B cell proliferation, and fail to mount antigen-specific IgM and IgG responses after immunization with ovalbumin in Complete Freunds Adjuvant. Peritoneal B1 cells are reduced, and double-negative thymocyte populations are shifted to the DN4 stage in king mice. The numbers and percentages of NK, NKT, γδ T cells, memory CD4+ T cells, and mature B cells are reduced in king mice. Macrophage, DC, and neutrophil populations appear normal.
 
CD4+Foxp3+ regulatory T (Treg) cells from king mice are drastically reduced in numbers in the spleen (0.47% of CD4+ T cells in king mice versus 13.3% in wild type mice), and absent in the thymus. Expression of CD25, GITR (glucocorticoid-induced TNF receptor family-related gene) and CTLA-4 (cytotoxic T-lymphocyte-associated protein 4) are also lacking in the king CD4+ T cell population, indicating a block in early in Treg lineage commitment. The reduction of Treg cells represents a cell-intrinsic defect of king mice, as reconstitution of wild type mice with king bone marrow failed to generate Treg cells. King CD4+ Foxp3- cells from the spleen can be converted to Foxp3+ cells by treatment with TGFβ and IL-2, a process that can be blocked by IL-2 neutralizing antibodies. These in vitro-generated Foxp3+ cells are functional, in that they are capable of suppressing T cell proliferation in a co-culture assay.
 
King mice do not develop overt autoimmune disease, although approximately 50% of king mice develop severe dermatitis at 4 to 5 months of age. MCMV infection of king mice leads to a 40-fold increase in Foxp3+ CD4+ T cell number.

 

Nature of Mutation
The king mutation was mapped to Chromosome 5, and corresponds to a T to A transversion at position ­­1791 of the Carma1/Card11 transcript, in exon 12 of 25 total exons.
 
1775 TCTGAGTTTCAAGCTCTGATGAGGACAGTCAAG
520  -S--E--F--Q--A--L--M--R--T--V--K-
 
The mutated nucleotide is indicated in red lettering, and causes a leucine to glutamine change at amino acid 525 of the CARD11 protein.
Protein Prediction
Figure 1. Domain structure of CARMA1. The location of the king mutation, within the second predicted α-helix of the linker domain, is indicated with a red asterisk. Four predicted α-helices are represented in pink. Click on the image to view other mutations found in CARMA1. Click on each mututation for more specific information.
CARMA1/CARD11 (hereafter CARMA1) consists of 1159 amino acids. It contains no catalytic domains, but several protein interaction domains [reviewed in (2)]. The N-terminal half of CARMA1 contains a caspase recruitment domain (CARD) (residues 19-105) and a coiled-coil domain (residues 116-439). The CARD domain consists of six or seven antiparallel α-helices that form homo- or heterophillic interactions with signaling partners. The CARD domain was originally identified based on its ability to bind pro-apoptotic or proinflammatory caspases, but is now known to bind to other proteins as well. Coiled-coil domains function as protein oligomerization domains, and CARMA1 is constitutively oligomerized and localized within the cell via the coiled-coil domain (3). A membrane-associated guanylate kinase (MAGUK) domain occupies the bulk of the C-terminal half of CARMA1 (4;5). MAGUK family proteins contain 3 modular protein interaction domains, of which the hallmark is an approximately 300 amino acid region with homology to yeast guanylate kinase (GUK), but which is catalytically inactive. In addition, up to three PDZ domains and an SH3 domain are always present in tandem with the guanylate kinase domain. CARMA1 contains one PDZ (residues 660-742), one SH3 (residues 766-834) and one GUK domain (residues 954-1142) (4;5).
 
The N- and C-terminal halves of CARMA1 are connected by a region of 232 amino acids between the CARD and coiled-coil domains designated the linker domain (residues 440-671). Several PKCβ and PKCθ phosphorylation sites critical for subsequent NF-κB activation have been identified within the linker domain (6;7). 75% of the linker domain is predicted to form random coils or loops, while 9% and 14% are predicted to form β strands and α helices, respectively (7). The linker domain has been shown to interact intramolecularly with the CARD domain, and PKC phosphorylation of linker residues releases or alters this interaction, activating CARMA1 to promote downstream signaling (7). A NORS (no regular secondary structure) subdomain is found at the N-terminus of the linker domain (residues 44-519). NORS domains are evolutionarily conserved regions thought to modulate the orientation and activity of associated domains, and in CARMA1 the NORS domain likely permits the flexibility required for the protein to form autoinhibitory intramolecular interactions. In support of this idea, deletion of the linker domain, or of just 19 amino acids from the NORS domain, results in a constitutively active CARMA1 protein (7) (see Background for information about CARMA1-mediated signaling). Thus, the linker domain modulates CARMA1 function through regulation of intramolecular interactions.
 
The king mutation results in a leucine to glutamine substitution at position 525 of CARMA1, which lies in the second predicted α-helix, just C-terminal to the NORS domain of the linker. As determined by Western blotting, King mice lack CARMA1 protein expression in the spleen and lymph nodes, and have reduced expression in the thymus. The protein interactions of CARMA1 from king mice have not been examined.
Expression/Localization
In humans, CARMA1 mRNA is detected in thymus, spleen, liver, lung and in peripheral blood leukocytes (4). In mice, CARMA1 mRNA is found in thymus, spleen, and peripheral blood leukocytes, with a lower level of expression in liver and kidney (5). Upon expression of tagged CARMA1 in HeLa cells, CARMA1 localizes to the perinuclear region (5). CARMA1 is constitutively localized to lipid rafts in both B and T cells (7;8).
Background
Figure 2. Canonical and non-canonical NF-kB signaling pathways. In the canonical pathway, several membrane receptors, including TNFR (tumor-necrosis factor receptor), IL-1R (interleukin-1 receptor) and TLRs (toll-like receptors), signal through kinases and adaptors (TRAFs), resulting in IKK activation. This activation occurs after the K63 ubiquitination of TRAFs and RIP. TAK1 and its adaptor proteins TAB1 and TAB2 bind ubiquitin chains to TRAF and NEMO (IKKγ) resulting in the activation of the IKK complex (NEMO, IKKα and IKKβ). Ubiquitination can be inhibited by deubiquitinating enzymes (DUB). Stimulation of the T-cell receptor (TCR) and B-cell receptor (BCR) results in the recruitment of Src and Syk family kinases. These kinases activate a phosphorylation cascade which leads to the activation of protein kinase C (PKC). The phosphorylation of CARMA1 (CARD (caspase-recruitment domain)-MAGUK (membrane-associated guanylate kinase) protein 1) recruits BCL 10 (B-cell lymphoma 10) and MALT1 (mucosa-associated lymphoid tissue lymphoma translocation gene 1), forming the CBM complex and activating the IKK complex. The IKK complex phosphorylates both IκB, p105 and TPL2 (or MAP3K8), resulting in IκB and p105 ubiquitination and degradation (small pink circles) by 26S proteasome. Degradation of IκB releases activated NF-κB dimers for translocation to the nucleus. A subset of TNFRs such as the lymphotoxin-β receptor (LT-bR),CD40, B-cell-activating factor receptor (BAFFR) and receptor activator of Nf-κB (RANK) can activate the canonical or non-canonical NF-κB signaling pathways. In the non-canonical pathway, the receptors bind to TRAFs to regulate NIK activity. TRAF3 and TRAF2 are recruited to the receptor along with cIAP1/2. TRAF2 undergoes K63 self-ubiquitination and is responsible for the K63 ubiquitination of cIAP1/2. TRAF3 is degraded by K48 ubiquitination, enhanced by the K63 ubiquitination of TRAF2 and cIAP1/2. (Gray arrows represent ubiquitination dependence.) As TRAF levels decrease, NIK is released and phosphorylates IKKa which phosphorylates p100. Phosphorylation and ubiquitination of p100 leads to the 26S proteasomal degradation of p100 and the processing of p52. P52 and RelB are released for translocation to the nucleus. This image is interactive. Click on the image to view mutations in the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information.
NF-κB controls the proliferation, differentiation and survival of B and T cells by activating the transcription of target genes, including various cytokines (Figure 2). In unstimulated cells, NF-κB is sequestered in the cytoplasm by the inhibitory protein IκB, which binds to NF-κB and prevents its translocation to the nucleus. Stimulation of B cell receptors (BCR) or T cell receptors (TCR) together with costimulatory molecules leads to the activation of IκB kinase (IKK) to phosphorylate IκB, triggering the ubiquitination and degradation of IκB, ultimately resulting in activation of NF-κB by releasing it for translocation to the nucleus. BCR or TCR engagement results in the formation of a lipid raft-associated multiprotein complex (called the “immunological synapse” in T cells) at the site of cell-cell contact that controls the events leading to activation of NF-κB (9). Scaffold proteins are essential for the formation of these complexes, promoting the coordinated receptor- and cell-specific assembly of signaling molecules.
 
CARMA1 belongs to the membrane-associated guanylate kinase (MAGUK) protein family, whose members function as molecular scaffolds for the localized assembly of such multiprotein complexes [reviewed in (10)]. CARMA1 was identified in a CARD domain homology search for Bcl10-interacting proteins (4;5). Upon T cell activation by TCR and costimulatory molecule engagement, CARMA1 associates with a complex containing Bcl10 and MALT1 (Mucosa-Associated Lymphoid tissue lymphoma Translocation-associated gene 1; also known as MLT or Paracaspase) and recruits these proteins to lipid rafts of the immunological synapse, where they activate the IKK complex, leading to degradation of IκB and subsequent activation of NF-κB (8;11-13). Mutation or deletion of the CARD domain of CARMA1 prevents its association with Bcl10 and blocks TCR-mediated NF-κB activation, although TNFR- or IL-1R-induced NF-κB activation remains normal (8;13;14). Conversely, overexpression of CARMA1 enhances PMA/ionomycin- and Bcl10-dependent NF-κB activation (8;15). Thus, CARMA1 functions in a signaling pathway specifically activated by the antigen receptor. The CARMA1/Bcl10/MALT1 complex functions similarly in B cells to activate NF-κB in response to BCR engagement (7).
 
In addition to the CARMA1/Bcl10/MALT1 complex, protein kinase C (PKC) is a critical component of the immunological synapse required for the activation of NF-κB. The PKC isoform PKCβ operates specifically in BCR-dependent NF-κB signaling (16), while PKCθ functions specifically in TCR-dependent NF-κB signaling (17;18). PKCβ-/- or PKCθ-/- mice lack BCR- or TCR-dependent NF-κB activation, respectively (19;20). Upon lymphocyte activation, the linker domain of CARMA1 is phosphorylated at several sites (including Ser552, 555, 564, 565, 649, and 657) by PKCβ or PKCθ. These phosphorylation events are required for release of the inhibitory intramolecular CARD domain-linker domain interactions within CARMA1, allowing CARMA1 to assemble the CARMA1/Bcl10/MALT1 complex required to activate NF-κB (6;7).
 
TCR stimulation also leads to CARMA1-dependent activation of c-Jun N-terminal kinase 2 (JNK2) (21). In unstimulated cells, JNK2 binds to and thereby promotes the ubiquitination and degradation of c-Jun. Stimulation results in dissociation of JNK2 from c-Jun and phosphorylation of c-Jun by JNK1, resulting in c-Jun stabilization. CARMA1-deficient lymphocytes display reduced JNK2 activation following TCR stimulation. CARMA1 mediates the interaction of Bcl10 and JNK2, and the formation of a complex with MKK7 and TAK1 around them. Through an unknown mechanism, these interactions promote the accumulation of c-Jun protein induced by TCR ligation (21).
 
The physiological functions of CARMA1 have been extensively investigated using several Carma1 mutant mice. A targeted mutant with a null allele (11;22), an ENU-induced mutant with a point mutation in the coiled-coil domain (see unmodulated) (23), and a knock-in mutant expressing a CARD-deleted CARMA1 protein (24) have been generated. All exhibit similar phenotypes. CARMA1 mutants have normal numbers and differentiation of B cells in the bone marrow, but IgDhighIgMlow splenocytes and serum immunoglobulins (IgM, IgG1, IgG2a, IgG2b, IgG3, and IgA) are reduced in CARMA1 mutants. Peritoneal CD5+ B1 B cells are absent, and NK cells are reduced in number in CARMA1 mutant mice. CARMA1 mutant B cells fail to proliferate in response to BCR stimulation with anti-IgM, or upon CD40 stimulation. T cell development is largely normal in CARMA1 mutants, which have normal numbers of single- and double-positive thymocytes. However, within the double negative (CD4-CD8-) compartment, the proportion of DN3 cells (CD25+CD44lo) is reduced, while that of DN4 cells (CD25-CD44lo) is increased. Mutant T cells also display greatly reduced proliferation and IL-2 production induced by PMA/ionomycin, TCR stimulation, or costimulation of the CD28 receptor. Treatment with exogenous IL-2 restores the proliferative response of CARMA1 mutant T cells to TCR stimulation. Co-culture experiments of CARMA1-mutant and wild type T cells demonstrate that CARMA1-dependent phenotypic defects are cell-autonomous (23). Finally, the ENU-induced point mutation in unmodulated mice causes dermatitis of the ear and neck at 10 to 20 weeks of age. 
 
The phenotypes of CARMA1, Bcl10, MALT1, PKCβ, and PKCθ mutant mice, or cells derived from these mice, provide support for the intermolecular interactions between these proteins revealed by studies in B and T cell lines. For example, PKCβ-/- mice display selective loss of peritoneal B1 cells and reduced immunoglobulin levels (25). Both Bcl10-/- and MALT1-/- mice have increased DN4 relative to DN3 cells, and reduced basal levels of immunoglobulins (19;26). B cells from Bcl10-/- mice and T cells from PKCθ-/- mice fail to proliferate in response to BCR or TCR activation, respectively (19;20). Importantly, primary B or T cells from CARMA1, Bcl10, MALT1, PKCβ, and PKCθ mutants all exhibit impaired NF-κB and JNK activation induced by either PMA/ionomycin or antigen receptor ligation (11;16;19;22-24;26). These findings support the conclusion that CARMA1, Bcl10, MALT1 and PKC function in the same pathway (in a complex at the immunological synapse), to activate NF-κB in response to antigen receptor stimulation.
Putative Mechanism
The phenotypes of king mice are similar to those observed in the other CARMA1 mutants, strongly suggesting that the king mutation causes a loss of function of the CARMA1 protein. IκB degradation and JNK activation are both defective in king CD4+ T cells, and failure to activate NF-κB and JNK thus likely underlie the phenotypic defects of king mice, as these proteins are critical effectors of TCR, BCR and costimulatory signaling pathways in the development and activation of T and B cells (1). Phosphorylation of the linker domain of CARMA1 releases autoinhibitory intramolecular interactions, activating CARMA1 to perform its function as a scaffold for the assembly of a complex containing Bcl10 and MALT1 and the IKK complex. The king mutation occurs in the second α-helix of the linker domain. A deletion mutant of CARMA1 lacking the second α-helix is reported to behave similarly to wild type CARMA1 in its ability to activate an NF-κB reporter in response to TCR stimulation in Jurkat T cells (7), suggesting that this α-helix does not directly participate in the binding interaction between the linker and CARD domains. The king mutation abrogates CARMA1 expression in the spleen and lymph nodes, and reduces expression in the thymus, suggesting instead that the integrity of the second α-helix is important for maintaining the stability of CARMA1. The king mutation may destabilize the protein and cause its premature degradation, effectively resulting in a CARMA1 null animal.
 
The lack of Foxp3+ Treg cells observed in king mice adds a new dimension to the function of CARMA1 and suggests a likely requirement for TCR signaling and NF-κB activation in Treg cell ontogeny. Since the first studies of CARMA1 mutant mice were performed, progress in research on the functions, development and maintenance of Treg cells has been rapid and productive. Development of Treg cells depends on the function of Foxp3, a forkhead family transcription factor, without which Treg cells are absent, causing autoimmune disease (27).
 
IL-2 has recently been shown to play an important role in the maintenance, but not the lineage commitment or suppressive activity, of Foxp3+ Treg cells (28). In contrast, CARMA1 appears to function in the lineage commitment of Foxp3+ Treg cells. In king mice, Foxp3+ Treg cells are largely absent from the thymus, while some remain in the periphery. In reciprocal bone marrow chimeras, the king phenotype (absence of thymic Treg cells with preservation of a small population of peripheral Treg cells) is dependent upon stem cell genotype, indicating that the wild type thymic milieu is insufficient to promote generation of thymic king Foxp3+ cells, and that the king defect is cell-autonomous. However, king CD4+ Foxp3- cells from the periphery can be converted to Foxp3+ cells by treatment with TGFβ and IL-2, but not TNFα, CpG DNA, IFNα or IFNγ. These data support the hypothesis that there is an essential role for CARMA1-mediated signaling in directing the commitment of “central” Treg cell precursors, whereas alternative pathways may suffice to cause the commitment of “peripheral” Treg precursors. This in turn implies that CARMA1 is required for the activation of the Foxp3 gene in the thymic T cells, but that redundant pathways may achieve this effect in peripheral T cells. Peripheral Treg development may proceed through an accessory (CARMA1-independent) pathway that is activated by TGF-β (which is known to activate NF-κB via TAK-1). Furthermore, IL-2 has an essential permissive effect in the process, possibly driving the expansion of Treg cells once commitment has occurred.
 
As discussed above, CARMA1 is phosphorylated by PKCθ and/or PKCβ to regulate both NF-κB and JNK activation.The thymic and splenic Foxp3+ CD4+ T cell populations are reduced in PKCθ-/- mice, but about 10-fold less severely than in king mice. Jnk2-/- mice have normal thymic and splenic Foxp3+ CD4+ T cell numbers. These data suggest that CARMA1-dependent Treg development is driven by PKCθ, but is not strictly dependent upon it, in that other upstream pathways for CARMA1 activation are sufficient to substitute for PKCθ. Moreover, CARMA1-mediated JNK2 activation is not required for Treg development. Almost no Foxp3+ CD4+ Treg cells are found in the thymi of T cell-specific TAK1-deficient mice, indicating that TAK1 contributes to the development of Treg cells (29). TAK1 is required for the activation of NF-κB and JNK in thymocytes (29;30), and does so through activation of IKK through signaling minimally requiring Bcl10, MALT1, TRAF6 and TRAF2 (31). MALT1-mediated oligomerization of TRAF6 is required to activate its ubiquitin ligase activity and stimulate IKK (31). These data suggest that CARMA1 may function to unite a complex involving TAK1, Bcl10, MALT1 and TRAF6 in order to activate NF-κB during Treg cell lineage commitment.
 
Some microbes, including filarial parasites and the trypanosome Leishmania major, can promote immune hyporesponsiveness by increasing Treg numbers through upregulation of CD25, CTLA-4 and GITR in CD4+ cells, or by selective recruitment of CD4+CD25+ cells to the site of infection (32;33). Expansion of Treg cells may be one mechanism by which microbes subvert the immune system and establish latent infections. Interestingly, MCMV infection of king mice leads to a 40-fold increase in Foxp3+ CD4+ T cell number. King mice are more susceptible to MCMV infection, although likely because of diminished NK cell numbers and function rather than because MCMV drives Treg cell expansion. It thus appears that MCMV can activate Treg cells in a CARMA1-independent manner. Of interest in this respect, viral homologues of Bcl10 (for example, the equine herpesvirus-2 E10 gene product) are capable of activating NF-κB and JNK (34). It is possible that this is an important mechanism by which herpesviruses enforce latency.
 
In contrast to the upregulation of Treg cells by pathogens, Foxp3-deficient mice lacking Treg cells have 6.5-fold more lymphocytes than wild type mice and develop autoimmune disease (28). Thus, it seems paradoxical that king mice display both reduced Treg cell numbers and reduced ability to activate T and B cells. These phenotypes suggest that CARMA1 has independent functions in two separate processes: to promote Treg lineage commitment in the thymus, and to support B and T cell activation. The small peripheral Treg population in king mice may be sufficient to prevent autoimmune disease, or impaired king B cell function may prevent escalation of immune responses leading to disease. The molecular interactions of CARMA1 continue to be investigated, with recent work revealing a role for CaMKII (Ca2+-calmodulin-dependent protein kinase II), PDK1 (phosphoinositide-dependent kinase-1), Akt, and as yet unidentified kinase(s) in regulating CARMA1-dependent NF-kB activation [reviewed in (35)]. The development and maintenance of Foxp3+ Treg cells also continues to be intensively investigated, and new discoveries demonstrate that the transcription factors NFAT (nuclear factor of activated T cells) and Runx1 (Runt-related transcription factor 1) cooperate with Foxp3 to regulate Treg cell development (36;37). Although CARMA1 is not likely to regulate NFAT signaling (23), its role in controlling NF-kB activity supports the possibility that it signals to other transcription factors, such as Runx1 and/or other Foxp3 partners.
Primers Primers cannot be located by automatic search.
Genotyping
The king mutation introduces a Dde I restriction enzyme site in the Card11 genomic DNA sequence.  King genotyping is performed by amplifying the region containing the mutation using PCR, followed by Dde I restriction enzyme digestion.
 
Primers
King_F: 5’- ATGCTTCTTCATTGGGTGGA -3’
King_R: 5’- AATTACGGCAGCTCACCATC -3’
 
PCR master mix
Use SIGMA RedTaq, associated buffers and dNTPs.
RedTaq                         2.5 μL
dNTP mix                      2.5 μL
10X RedTaq Buffer         5.0 μL
Primer King_F (50mM)   0.5 μL
Primer King_R (50mM)   0.5 μL
Genomic DNA                2.0 μL
ddH20                            37 μL
 
PCR program
1) 94°C             10:00
2) 94°C             0:30
3) 55°C             0:30
4) 68°C             1:00
5) repeat steps (2-4) 34X
6) 68°C             7:00
7) 4°C              ∞
 

The following sequence of 444 nucleotides (from Genbank genomic region NC_000071 for Card11 linear genomic sequence) is amplified:

109080                                                                 a
109081 tgcttcttca ttgggtggag gtgggaatgg gggggggacc ccctccatga gtcctcaaag
109141 acaggtgaca tggtttagtc ttgactggag ccgcccttaa ccggcctggc ttggggcagg
109201 atatgctatc ctgaagaaca gaaaaatagc gccacctgca cgcgaaggag aagcagggac
109261 tttactaatg ttgcttcctg ggtttccaca ggggacagaa cagtcccctg cccacccatg
109321 tcaggagaac cccaagtaga ggttttaact cccctccccc tcccgctccc ccctcccttt
109381 tctctctcct ctgttttctg ggcccgcggc tctgatgagg acagtcaagg ggcacgaaga
109441 ggatttcaca gacggcagcc ccagttcctc ccgctcgctg cctgtcacca gctctttctc
109501 caagatggtg agctgccgta att
 
Primer binding sites are underlined; the novel Dde I site is highlighted in gray; the mutated T is indicated in red lettering.
 
Restriction Digest
Digest PCR reactions with Dde I. Run on 3% agarose gel with heterozygous and C57BL/6J controls.
Products: king allele- 332 bp, 113 bp.  Wild type allele- 444 bp.
References
 26.  Ruefli-Brasse, A. A., French, D. M., and Dixit, V. M. (2003) Regulation of NF-kappaB-dependent lymphocyte activation and development by paracaspase, Science 302, 1581-1584.
Science Writers Eva Marie Y. Moresco
Illustrators Diantha La Vine
AuthorsMichael J. Barnes, Kasper Hoebe, Bruce Beutler
Edit History
03/07/2011 10:15 AM (current)
01/17/2011 12:26 PM
01/11/2011 9:28 AM
01/07/2011 9:15 AM
12/28/2010 11:02 AM
12/28/2010 10:53 AM
12/28/2010 10:52 AM
02/25/2010 3:03 PM