Phenotypic Mutation 'potbelly2' (pdf version)
List |< first << previous [record 28 of 30] next >> last >|
Allelepotbelly2
Mutation Type missense
Chromosome6
Coordinate29,069,090 bp (GRCm38)
Base Change C ⇒ A (forward strand)
Gene Lep
Gene Name leptin
Synonym(s) ob
Chromosomal Location 29,060,220-29,073,877 bp (+)
MGI Phenotype Strain: 1856424
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is secreted by white adipocytes, and which plays a major role in the regulation of body weight. This protein, which acts through the leptin receptor, functions as part of a signaling pathway that can inhibit food intake and/or regulate energy expenditure to maintain constancy of the adipose mass. This protein also has several endocrine functions, and is involved in the regulation of immune and inflammatory responses, hematopoiesis, angiogenesis and wound healing. Mutations in this gene and/or its regulatory regions cause severe obesity, and morbid obesity with hypogonadism. This gene has also been linked to type 2 diabetes mellitus development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes are obese, hyperphagic, have low activity, high metabolic efficiency, impaired thermogenesis, infertility and short lifespan in addition to varying other abnormalities. Strain background affects severity and course of diabetes. Heterozygotes survive fasting longer than control mice. [provided by MGI curators]
Accession Number

NCBI Refseq: NM_008493.3; MGI:104663

Mapped Yes 
Amino Acid Change Histidine changed to Asparagine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000067046] [ENSMUSP00000130087]
SMART Domains Protein: ENSMUSP00000067046
Gene: ENSMUSG00000059201
AA Change: H47N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Leptin 23 167 5.8e-71 PFAM
Predicted Effect probably benign

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)
(Using ENSMUST00000069789)
SMART Domains Protein: ENSMUSP00000130087
Gene: ENSMUSG00000059201
AA Change: H47N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Leptin 22 98 5.9e-50 PFAM
Predicted Effect possibly damaging

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
(Using ENSMUST00000169505)
Phenotypic Category
Phenotypequestion? Literature verified References
Body Weight - increased
Body Weight (DSS) - increased 7560100
growth/size
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(13) : Chemically induced (ENU)(2) Spontaneous (2) Targeted(6) Transgenic (3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
potbelly UTSW 6 29068972 nonsense probably null
R0009:Lep UTSW 6 29068972 nonsense probably null
R1190:Lep UTSW 6 29071174 nonsense probably null
R1545:Lep UTSW 6 29070832 missense probably damaging 1.00
R1585:Lep UTSW 6 29069090 missense possibly damaging 0.95
R5253:Lep UTSW 6 29070863 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2016-05-13 3:09 PM by Anne Murray
Record Created 2016-02-09 5:15 PM
Record Posted 2016-05-06
Phenotypic Description

Figure 1. Potbelly2 mice exhibited increased body weights compared to wild-type littermates. Normalized body weights are shown. Abbreviations: REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The potbelly2 phenotype was identified among G3 mice of the pedigree R1585, some of which exhibited elevated body weights compared to wild-type controls (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the increased body weight using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 82 mutations (X-axis) identified in the G1 male of pedigree R1585.  Normalized weight phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 82 mutations. The body weight phenotype was linked to a mutation in Lep: a C to A transversion at base pair 29,069,090 (v38) on chromosome 6, or base pair 10,628 in the GenBank genomic region NC_000072 encoding Lep. Linkage was found with a recessive model of inheritance (P = 5.69 x 10-4), wherein one affected mouse was homozygous for the variant allele, and 38 unaffected mice were either heterozygous (n = 21) or homozygous (n = 17) for the reference allele (Figure 2).

 

The mutation corresponds to residue 198 in the mRNA sequence NM_008493 in exon 2 of 3 total exons. 

 

183 ATCAATGACATTTCACACACGCAGTCGGTATCC

42  -I--N--D--I--S--H--T--Q--S--V--S-

 

The mutated nucleotide is indicated in red.  The mutation results in a histidine (H) to asparagine (N) substitution at position 47 (H47N) in the leptin protein, and is strongly predicted by PolyPhen-2 to be benign (score = 0.272).

Protein Prediction

Figure 3. Mouse leptin domains. Mouse leptin contains a signal peptide (SP) at aa 1-21 that is cleaved during protein maturation. The residues that consitute the four-helix bundle (helices A-D) are labeled.  The cysteines at aa 117 and 167 form a intramolecular disulfide bond between the C-terminus and the beginning of the CD loop. The residues at 140-142 (i.e., Tyr (Y)-140, Ser (S)-141, and Thr (T)-142) are required for leptin-mediated activation of the LepR. The potbelly2 mutation results in substitution of histidine 47 for an asparagine.

The Lep (alternatively, ob) gene encodes leptin, a highly conserved adipocyte-secreted hormone and member of the class I helical cytokine family [Figure 3; (1-3)]. Leptin regulates several physiological processes including appetite, energy homeostasis, body weight, neuroendocrine systems [i.e., the growth hormone axis, thyroid axis, hypothalamic-pituitary-gonadal axis, and adrenal axis (4-7)], immune functions (i.e., thymic homeostasis, secretion of IL-1 and TNF-α, and promotion of Th1-cell differentiation [reviewed in (8)]), and glycaemia [reviewed in (9)].

 

The 167 amino acid leptin has a 21 amino acid N-terminal signal sequence that is cleaved during leptin maturation (10).  Vertebrate leptins have two conserved cysteine residues (Cys117 and Cys167 in mouse leptin) that form an intramolecular disulfide bond between the C-terminus and the beginning of the CD loop (11;12). Three conserved leptin receptor (LepR; see the records for Business class, Cherub, and Well-upholstered) binding sites on leptin have been identified: site I is on the face of helix D and is proposed to bind the cytokine receptor homology 1 (CRH1) or CRH2 domain of the LepR, site II is composed of residues on the surface of helices A and C and binds the CRH2 domain of LepR, and site III is at the N-terminus of helix D at the interface of the N-terminus of helix D and the AB loop and binds the immunoglobulin-like domain of LepR (1;13). Binding site II is proposed to be the main high affinity binding site for receptor-ligand interaction (14;15), while site III is proposed to function in forming the active multimeric complex and activating the receptor (16).  Mutagenesis of mouse and human leptins in the proximity of binding site III have identified Tyr-140, Ser-141, and Thr-142 as essential for activation, but not binding, of leptin to LepR (16). In addition to the three binding sites in leptin, the highly conserved GLDFIP sequence at aa 38-43 in human leptin is required for LepR activation (1;17;18).

 

The leptin tertiary structure resembles that of other class I cytokines in that it has a four-helix bundle (helices A-D) with an up-up-down-down topology (19;20). A nuclear magnetic resonance (NMR) study determined that in mouse leptin, Helix A is amino acids 3-24, Helix B is aa 51-67, Helix C is aa 72-94, and Helix D is aa 122-141 (19). Parallel to the helical bundle is a hydrophobic cylindrical core formed from conserved residues of the four alpha helices (11). Leptin differs structurally from other class I cytokines in that it has a small helical segment (i.e., helix E) within the loop between helices C and D [aa 95-121 (11)]. 

 

The potbelly2 mutation results in substitution of histidine 47 for an asparagine. Residue 47 is between helices A and B.

 

For more information about Lep, please see the record for Potbelly.

Putative Mechanism

Leptin, a systemic hormone, regulates multiple functions of the body including energy utilization and storage, various endocrine axes, bone metabolism, thermoregulation, angiogenesis, immunity and inflammation [reviewed in (21)]. In humans, mutations in LEP are linked to morbid obesity, with or without hypogonadism [OMIM: +164160; (22-24)]. The Lepob (ob) mouse strain (MGI:1856424) is morbidly obese and is characterized by hyperinsulinemia, hyperglucocorticoidemia, hypothalamic hypothyroidism, defects in cell-mediated and humoral immunity, impaired thermogenesis, hyperglycemia, insulin resistance, altered central nervous system activity, reduced metabolic rate of brown adipose tissue, infertility, and lethargy (25;26). The obesity phenotype of the potbelly2 mice mimics that of other Lep mouse models (27-29). Expression and secretion of leptin in the potbelly2 mice has not been examined, but the phenotype suggests that expression and/or secretion of leptin is reduced in the potbelly2 mice.

Primers PCR Primer
potbelly2(F):5'- ATCCTATAGCAGGATGGCAGCAGG -3'
potbelly2(R):5'- TTTCAGCAGGCAGCAGTGACAAG -3'

Sequencing Primer
potbelly2_seq(F):5'- CATATTGGGCTCTTGAAAAGTGTC -3'
potbelly2_seq(R):5'- AGTGACAAGAGCCATGACC -3'
References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsEmre Turer and Bruce Beutler
List |< first << previous [record 28 of 30] next >> last >|