Phenotypic Mutation 'Yue' (pdf version)
List |< first << previous [record 579 of 584] next >> last >|
AlleleYue
Mutation Type missense
Chromosome17
Coordinate56,271,339 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Ticam1
Gene Name toll-like receptor adaptor molecule 1
Synonym(s) TICAM-1, Trif
Chromosomal Location 56,269,319-56,276,786 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adaptor protein containing a Toll/interleukin-1 receptor (TIR) homology domain, which is an intracellular signaling domain that mediates protein-protein interactions between the Toll-like receptors (TLRs) and signal-transduction components. This protein is involved in native immunity against invading pathogens. It specifically interacts with toll-like receptor 3, but not with other TLRs, and this association mediates dsRNA induction of interferon-beta through activation of nuclear factor kappa-B, during an antiviral immune response. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice are viable but exhibit abnormalities of the innate immune system. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_174989; MGI:2147032

Mapped Yes 
Amino Acid Change Isoleucine changed to Threonine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000055104]
SMART Domains Protein: ENSMUSP00000055104
Gene: ENSMUSG00000047123
AA Change: I252T

DomainStartEndE-ValueType
PDB:4BSX|D 5 153 3e-52 PDB
low complexity region 345 384 N/A INTRINSIC
SCOP:d1fyva_ 386 491 8e-3 SMART
PDB:2M1X|A 391 547 1e-74 PDB
Pfam:RHIM 610 698 4.7e-13 PFAM
Predicted Effect probably benign

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
(Using ENSMUST00000058136)
Phenotypic Category Autosomal Dominant
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(11) : Chemically induced (ENU)(1) Gene trapped(4) Targeted(6)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02160:Ticam1 APN 17 56270560 missense possibly damaging 0.80
IGL02164:Ticam1 APN 17 56270019 missense unknown
Lps2 UTSW 17 56271577 small deletion
Pangu UTSW 17 56276693 critical splice donor site probably damaging 0.98
R0930:Ticam1 UTSW 17 56270226 missense unknown
R0930:Ticam1 UTSW 17 56271687 missense probably damaging 1.00
R1509:Ticam1 UTSW 17 56271113 missense probably benign 0.43
R1837:Ticam1 UTSW 17 56270799 missense possibly damaging 0.87
R1863:Ticam1 UTSW 17 56271436 missense probably damaging 1.00
R1867:Ticam1 UTSW 17 56271718 missense probably benign 0.01
R1872:Ticam1 UTSW 17 56271897 missense probably benign 0.00
R1893:Ticam1 UTSW 17 56271894 missense probably benign 0.36
R1980:Ticam1 UTSW 17 56271555 missense probably damaging 0.99
R1981:Ticam1 UTSW 17 56271555 missense probably damaging 0.99
R1982:Ticam1 UTSW 17 56271555 missense probably damaging 0.99
R2263:Ticam1 UTSW 17 56271888 missense possibly damaging 0.95
R2513:Ticam1 UTSW 17 56271612 missense possibly damaging 0.61
R4294:Ticam1 UTSW 17 56271339 missense probably benign 0.06
R4888:Ticam1 UTSW 17 56271642 missense probably damaging 0.98
R4982:Ticam1 UTSW 17 56272020 missense probably benign 0.10
R5396:Ticam1 UTSW 17 56271117 missense probably benign 0.02
R5604:Ticam1 UTSW 17 56271756 missense probably benign 0.13
R5641:Ticam1 UTSW 17 56270629 frame shift probably null
R5647:Ticam1 UTSW 17 56270629 frame shift probably null
R5648:Ticam1 UTSW 17 56270629 frame shift probably null
R5657:Ticam1 UTSW 17 56270629 frame shift probably null
R5770:Ticam1 UTSW 17 56270629 frame shift probably null
R5771:Ticam1 UTSW 17 56270629 frame shift probably null
R5964:Ticam1 UTSW 17 56271703 missense probably damaging 0.99
R5974:Ticam1 UTSW 17 56271178 missense probably benign
R6217:Ticam1 UTSW 17 56270730 missense probably damaging 1.00
V8831:Ticam1 UTSW 17 56269969 frame shift probably null
Mode of Inheritance Autosomal Dominant
Local Stock
Repository
Last Updated 2016-09-22 10:30 AM by Anne Murray
Record Created 2016-02-10 1:52 PM by Lei Sun
Record Posted 2016-04-27
Phenotypic Description

Figure 1. Yue mice exhibited decreased TNFα secretion in response to TLR3 ligand, poly(I:C). TNFα levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Yue phenotype was identified among G3 mice of the pedigree R4294, some of which showed reduced TNFα secretion from macrophages in response to the Toll-like receptor 3 (TLR3) ligand, poly(I:C) (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced TNFα secretion after poly(I:C) stimulation using a dominant model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 43 mutations (X-axis) identified in the G1 male of pedigree R4294. Normalized phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 43 mutations. The diminished TNFα secretion in response to poly(I:C) phenotype was linked by continuous variable mapping to a mutation in Ticam1:  a T to C transition at base pair 56,271,339 (v38) on chromosome 17, or base pair 5,429 in the GenBank genomic region NC_000083 encoding the Ticam1 gene. Linkage was found with a dominant model of inheritance, wherein three variant homozygotes and 13 heterozygotes departed phenotypically from 12 homozygous reference mice with a P value of 4.33 x 10-4 (Figure 2).  

 

The mutation corresponds to residue 953 in the mRNA sequence NM_174989 within exon 2 of 2 total exons.

 
937 CAAGAACCTGAGGAGATAAGCTGGCCTCCATCA

247 -Q--E--P--E--E--I--S--W--P--P--S-

 

The mutated nucleotide is indicated in red.  The mutation results in an isoleucine (I) to threonine (T) substitution at position 252 (I252T) in the TRIF protein, and is strongly predicted by PolyPhen-2 to be benign (score = 0.063).

Protein Prediction

Figure 3. Protein domains of TICAM-1. TICAM-1 (alternatively, TRIF) is a 732-amino acid protein that contains an N- and C-terminal proline-rich domain (PR).  TRIF contains a 200 amino acid Toll/IL-1 receptor (TIR) domain. TRIF has three TRAF6 binding motifs at the N-terminus. The Yue mutation results in an isoleucine (I) to threonine (T) substitution at position 252 (I252T). Locations of domains/motifs are from Uniprot: Q80UF7. Click on the image to view other mutations found in TICAM-1. Click on each mututation for more specific information.

Ticam1 encodes the 732-amino acid protein TICAM-1 [Toll-interleukin 1 receptor (TIR) domain-containing adaptor molecule-1; hereafter TRIF (TIR domain-containing adaptor inducing IFN-β)], an adaptor in TLR3 and TLR4 signaling (Figure 3). Mouse TRIF contains a conserved C-terminal proline-rich domain. TRIF also contains a Toll/IL-1 receptor (TIR) domain, a conserved region of approximately 200 amino acids which mediates homo- and heterotypic protein interactions during signal transduction (1;2). TRIF reportedly harbors between one and three TNF receptor-associated factor-6 (TRAF6) binding motifs at its N-terminus (3;4), defined by the sequence P-X-E-X-X-acidic/aromatic (5).

 

The Yue mutation results in an isoleucine to threonine substitution at position 252 (I252T); amino acid 252 is predicted to be within one of the TRAF6 binding motifs.

 

Please see the record Lps2 for more information about Ticam1.

Putative Mechanism

The twelve mouse TLRs and ten human TLRs recognize a wide range of structurally distinct molecules, and all signal through only four adaptor proteins known to date: MyD88, Tirap (Mal), TICAM-1 (TRIF) and TRAM (6). TRIF and MyD88, act in LPS-induced TLR4 signaling leading to NF-κB and IRF-3 activation, and upregulation of costimulatory molecules (7-9). TRIF is the only adaptor serving TLR3 (7;9). The TRIF-mediated MyD88-independent pathway induces a late-phase activation of NF-κB and MAP kinases. Lps2 or Trif-null macrophages fail to activate NF-κB or IRF-3, or induce IFN-β in response to poly I:C (7;9).

 

Similar to the Lps2 mice, Yue mice have reduced TNF-α production in response to poly(I:C), indicating reduced TRIFYue function. The Yue mice were not assessed for IFN-β induction in response to poly I:C. The mutated residue in Yue is in a putative TRAF6-binding motif (P-X-E-X-X-acidic/aromatic) (5). Mutation of the glutamate residues in the putative TRAF6 binding motifs to alanine results in loss of co-immunoprecipitated with TRAF6, and failure to activate an NF-κB luciferase reporter (3;4). However, recent data obtained using TRAF6-/- macrophages demonstrate that TRAF6 is not required for TRIF-dependent NF-κB activation (10), suggesting that the TRIF-TRAF6 interaction has a separate, yet unknown function, or that in TRAF6-/- cells another protein can fulfill this role.

Primers PCR Primer
Yue(F):5'- AACACTTTCTGTGGTGGACG -3'
Yue(R):5'- GACTGGAGTTGGGGACATAC -3'

Sequencing Primer
Yue_seq(F):5'- ACTTTCTGTGGTGGACGTCAGG -3'
Yue_seq(R):5'- AGTTGGGGACATACGTTACACTCC -3'
References

1. Oshiumi, H., Matsumoto, M., Funami, K., Akazawa, T., and Seya, T. (2003) TICAM-1, an Adaptor Molecule that Participates in Toll-Like Receptor 3-Mediated Interferon-Beta Induction. Nat Immunol. 4, 161-171.

  2. Yamamoto, M., Sato, S., Mori, K., Hoshino, K., Takeuchi, O., Takeda, K., and Akira, S. (2002) Cutting Edge: A Novel Toll/IL-1 Receptor Domain-Containing Adapter that Preferentially Activates the IFN-Beta Promoter in the Toll-Like Receptor Signaling. J Immunol. 169, 6668-6672.

  3. Sato, S., Sugiyama, M., Yamamoto, M., Watanabe, Y., Kawai, T., Takeda, K., and Akira, S. (2003) Toll/IL-1 Receptor Domain-Containing Adaptor Inducing IFN-Beta (TRIF) Associates with TNF Receptor-Associated Factor 6 and TANK-Binding Kinase 1, and Activates Two Distinct Transcription Factors, NF-Kappa B and IFN-Regulatory Factor-3, in the Toll-Like Receptor Signaling. J Immunol. 171, 4304-4310.

  4. Jiang, Z., Mak, T. W., Sen, G., and Li, X. (2004) Toll-Like Receptor 3-Mediated Activation of NF-kappaB and IRF3 Diverges at Toll-IL-1 Receptor Domain-Containing Adapter Inducing IFN-Beta. Proc Natl Acad Sci U S A. 101, 3533-3538.

  5. Ye, H., Arron, J. R., Lamothe, B., Cirilli, M., Kobayashi, T., Shevde, N. K., Segal, D., Dzivenu, O. K., Vologodskaia, M., Yim, M., Du, K., Singh, S., Pike, J. W., Darnay, B. G., Choi, Y., and Wu, H. (2002) Distinct Molecular Mechanism for Initiating TRAF6 Signalling. Nature. 418, 443-447.

  6. Beutler, B., Jiang, Z., Georgel, P., Crozat, K., Croker, B., Rutschmann, S., Du, X., and Hoebe, K. (2006) Genetic Analysis of Host Resistance: Toll-Like Receptor Signaling and Immunity at Large. Annu Rev Immunol. 24, 353-389.

  7. Hoebe, K., Du, X., Georgel, P., Janssen, E., Tabeta, K., Kim, S. O., Goode, J., Lin, P., Mann, N., Mudd, S., Crozat, K., Sovath, S., Han, J., and Beutler, B. (2003) Identification of Lps2 as a Key Transducer of MyD88-Independent TIR Signaling. Nature. 424, 743-748.

 

  8. Hoebe, K., Jannsen, E. M., Kim, S. O., Alexopoulou, L., Flavell, R. A., Han, J., and Beutler, B. (2003) Upregulation of Costimulatory Molecules Induced by Lipopolysaccharide and Double-Stranded RNA Occurs by Trif-Dependent and Trif-Independent Pathways. Nat Immunol. 4, 1223-1229.

  9. Yamamoto, M., Sato, S., Hemmi, H., Hoshino, K., Kaisho, T., Sanjo, H., Takeuchi, O., Sugiyama, M., Okabe, M., Takeda, K., and Akira, S. (2003) Role of Adaptor TRIF in the MyD88-Independent Toll-Like Receptor Signaling Pathway. Science. 301, 640-643.

10.  Gohda, J., Matsumura, T., and Inoue, J. (2004) Cutting edge: TNFR-associated factor (TRAF) 6 is essential for MyD88-dependent pathway but not toll/IL-1 receptor domain-containing adaptor-inducing IFN-beta (TRIF)-dependent pathway in TLR signaling, J Immunol. 173, 2913-2917.

Science Writers Anne Murray
Illustrators Peter Jurek, Katherine Timer
AuthorsLei Sun and Bruce Beutler
List |< first << previous [record 579 of 584] next >> last >|