Phenotypic Mutation 'Puddel_hunde' (pdf version)
AllelePuddel_hunde
Mutation Type missense
Chromosome9
Coordinate8,004,284 bp (GRCm38)
Base Change C ⇒ T (forward strand)
Gene Yap1
Gene Name yes-associated protein 1
Synonym(s) Yki, Yap, yorkie
Chromosomal Location 7,931,999-8,004,596 bp (-)
MGI Phenotype FUNCTION: This gene encodes a protein which binds to the SH3 domain of the Yes proto-oncogene product, a tyrosine kinase. This protein contains a WW domain, consisting of four conserved aromatic amino acids including two tryptophan residues. This conserved WW domain is found in various structural, regulatory and signaling molecules in various species, and may play a role in protein-protein interaction. Following cellular damage, phosphorylation of this encoded protein may suppress apoptosis. This protein may be involved in malignant transformation in cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
PHENOTYPE: Embryos homozygous for a null mutation of this gene die between embryonic days E9.5 and E10.5 due to yolk sac avasculogenesis and failure of attachment between the allantois and the chorion. Heterozygous mice are viable, appear normal and are fertile. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001171147 (variant 1), NM_009534 (variant 2); MGI:103262

Mapped Yes 
Amino Acid Change Glycine changed to Aspartic acid
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000069554] [ENSMUSP00000083772] [ENSMUSP00000134007] [ENSMUSP00000134237] [ENSMUSP00000133959]
PDB Structure
Structural basis of YAP recognition by TEAD4 in the Hippo pathway [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000069554
Gene: ENSMUSG00000053110
AA Change: G36D

DomainStartEndE-ValueType
low complexity region 3 35 N/A INTRINSIC
PDB:3KYS|D 36 156 4e-68 PDB
WW 157 189 5.63e-12 SMART
WW 216 248 8.66e-13 SMART
coiled coil region 283 316 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000065353)
SMART Domains Protein: ENSMUSP00000083772
Gene: ENSMUSG00000053110
AA Change: G36D

DomainStartEndE-ValueType
low complexity region 3 35 N/A INTRINSIC
PDB:3KYS|D 36 156 3e-68 PDB
WW 157 189 5.63e-12 SMART
WW 216 248 8.66e-13 SMART
coiled coil region 283 314 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000086580)
SMART Domains Protein: ENSMUSP00000134007
Gene: ENSMUSG00000053110
AA Change: G36D

DomainStartEndE-ValueType
low complexity region 3 35 N/A INTRINSIC
PDB:3KYS|D 36 156 2e-69 PDB
WW 157 189 5.63e-12 SMART
WW 216 248 8.66e-13 SMART
coiled coil region 283 314 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000173085)
SMART Domains Protein: ENSMUSP00000134237
Gene: ENSMUSG00000053110
AA Change: G36D

DomainStartEndE-ValueType
low complexity region 3 35 N/A INTRINSIC
PDB:3KYS|D 36 156 3e-69 PDB
WW 157 189 5.63e-12 SMART
WW 216 248 8.66e-13 SMART
coiled coil region 283 316 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
(Using ENSMUST00000173264)
SMART Domains Protein: ENSMUSP00000133959
Gene: ENSMUSG00000053110
AA Change: G36D

DomainStartEndE-ValueType
low complexity region 3 35 N/A INTRINSIC
PDB:3KYS|D 36 156 2e-69 PDB
WW 157 189 5.63e-12 SMART
WW 216 248 8.66e-13 SMART
coiled coil region 283 314 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000174577)
SMART Domains Protein: ENSMUSP00000134250
Gene: ENSMUSG00000053110

DomainStartEndE-ValueType
low complexity region 36 49 N/A INTRINSIC
WW 64 96 5.63e-12 SMART
WW 123 155 8.66e-13 SMART
coiled coil region 191 224 N/A INTRINSIC
Predicted Effect probably benign
Meta Mutation Damage Score 0.0232 question?
Is this an essential gene? Essential (E-score: 1.000) question?
Phenotypic Category
Phenotypequestion? Literature verified References
DSS: sensitive day 10 21041407
DSS: sensitive day 7 21041407
Candidate Explorer Status CE: excellent candidate; human score: 0.5; ML prob: 0.362
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(47) Gene trapped(31) Targeted(15) Transgenic(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Yap1 APN 9 7934741 splice site probably benign
IGL01404:Yap1 APN 9 7934741 splice site probably benign
IGL02338:Yap1 APN 9 7962281 critical splice donor site probably null
IGL02398:Yap1 APN 9 7950535 missense probably benign 0.06
IGL02793:Yap1 APN 9 7973906 missense probably benign 0.44
R0410:Yap1 UTSW 9 8001467 missense probably damaging 1.00
R1507:Yap1 UTSW 9 7953140 splice site probably benign
R1837:Yap1 UTSW 9 7962349 missense probably damaging 1.00
R3968:Yap1 UTSW 9 7973876 missense probably damaging 1.00
R3978:Yap1 UTSW 9 8004284 missense probably damaging 1.00
R4111:Yap1 UTSW 9 7938431 makesense probably null
R4113:Yap1 UTSW 9 7938431 makesense probably null
R4573:Yap1 UTSW 9 7934681 missense probably damaging 1.00
R5028:Yap1 UTSW 9 8001689 missense probably benign 0.05
R6397:Yap1 UTSW 9 8001466 missense probably damaging 1.00
R6407:Yap1 UTSW 9 7962372 missense possibly damaging 0.46
X0020:Yap1 UTSW 9 7938435 missense possibly damaging 0.93
Mode of Inheritance Autosomal Semidominant
Local Stock
Repository
Last Updated 2018-11-05 2:12 PM by Anne Murray
Record Created 2016-02-11 4:09 PM
Record Posted 2018-11-05
Phenotypic Description

Figure 1. Puddel_hunde mice exhibited susceptibility to dextran sodium sulfate (DSS)-induced colitis at 7 days after DSS treatment. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Puddel_hunde mice exhibited susceptibility to dextran sodium sulfate (DSS)-induced colitis at 10 days after DSS treatment. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Puddel_hunde phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R3978 some of which showed susceptibility to dextran sodium sulfate (DSS)-induced colitis at 7 (Figure 1) and 10 (Figure 2) days after DSS treatment.

Nature of Mutation

Figure 3. Linkage mapping of the DSS susceptibility phenotype at day 7 using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 73 mutations (X-axis) identified in the G1 male of pedigree R3978. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 73 mutations. The DSS susceptibility phenotype was linked by continuous variable mapping to a mutation in Yap1: a G to A transition at base pair 8,004,284 (v38) on chromosome 9, or base pair 313 in the GenBank genomic region NC_000075 encoding Yap1. The strongest association was found with an additive model of inheritance to the DSS susceptibility phenotype at day 7, wherein eight variant homozygotes and seven heterozygous mice departed phenotypically from four homozygous reference mice with a P value of 3.386 x 10-5 (Figure 3).  

 

The mutation corresponds to residue 313 in the mRNA sequence NM_001171147 within exon 1 of 9 total exons.

 

297 CCCGCACCCCCGGCCGGCCACCAGGTCGTGCAC

31  -P--A--P--P--A--G--H--Q--V--V--H-

 

The mutated nucleotide is indicated in red. The mutation results in a glycine to aspartic acid substitution at amino acid 36 (G36D) in the YAP1 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction
Figure 4. Domain organization of YAP1. The location of the Puddel_hunde mutation is indicated. Domain information is from SMART and UniProt.

Yap1 encodes the transcription coactivator Yes-associated protein (YAP1). YAP1 has a proline-rich N-terminus, a TEAD transcription factor-binding domain, an AKT phosphorylation/14-3-3-binding site, two WW domains (in mouse; human YAP1 putatively has only one WW domain), a SH3-binding motif, a transcription activation domain, a coiled coil region, and a PDZ-binding motif (Figure 4) (2;3). The 14-3-3 binding site is required for phosphorylation-induced cytoplasmic translocation of YAP1 (4). The YAP1 WW domains mediate protein-protein interactions with proline-rich peptides including large tumor suppressor 1/2 (LATS1/2) (5-7). The PDZ-binding motif is required for the cytoplasmic-nuclear translocation of YAP1 (8).

 

YAP1 is phosphorylated at Ser127 and Ser381 by LATS1/2 (4). LATS1/2-mediated phosphorylation at Ser381 primes phosphorylation of YAP1 at Ser384, which primes YAP1 for subsequent phosphorylation by casein kinase 1δ/ε (CK1δ/ε) (9). CK1δ/ε-induced YAP1 phosphorylation results in recruitment of the E3 ubiquitin ligase SCFβ-TRCP and YAP1 degradation by the ubiquitin–proteasome system. YAP1 is also phosphorylated by Yes, Src, Akt, c-Abl, JNK, p38, and CDK1. Yes-associated YAP1 phosphorylation increases YAP1-TEAD2-dependent transcription (10). Yes-mediated phosphorylation also induces formation of a YAP1-β-catenin-T-box5 (TBX5) complex on the promoters of anti-apoptotic genes (11). Src-associated YAP1 phosphorylation regulates the repression of Runx2 by YAP1 (12). Akt-mediated YAP1 phosphorylation at Ser127 results in YAP1 being trapped by 14-3-3, YAP1-associated transcription being switched off, and attenuation of p73-mediated apoptosis (13). YAP1 is phosphorylated by c-Abl at Tyr407 in response to DNA damage (14). Tyr407 phosphorylation increases the YAP1-p73 interaction, prevents Itch (see the record for scratch)-mediated ubiquitination of p73, and activates pro-apoptotic transcription (15;16). JNK phosphorylates Thr119, Ser138, Thr154, Ser317, and Thr362 to promote or protect from apoptosis in a cell-dependent manner (17;18). CDK1 phosphorylates Thr119, Ser289, and Ser367 when the cell cycle is arrested at G2/M phase, which causes mitotic defects and promotes cell motility (19). Thr119 and Ser289 are phosphorylated by CDK1 during normal mitosis. The protein phosphatases PP1A and PP2A dephosphorylate YAP1 at Ser127 to counteract the LATS kinases (20). Non-receptor protein tyrosine phosphatase 14 (PTPN14) binds to the WW domains of YAP1 and dephosphorylates Src-induced tyrosine phosphorylation (21). PTPN14 increases cytoplasmic phosphorylated YAP1 during contact inhibition.

 

YAP1 is acetylated at Lys494 and Lys497 after DNA damage, which regulates TEAD-reporter activity and methyl methanesulfonate-induced cell death (22). Lys494 is also methylated by SET-domain-containing lysine methyltransferase (SET7) (23). YAP1 methylation is necessary for the cytoplasmic retention of YAP1. YAP1 is also SUMOylated by the tumor suppressor promyelocytic leukemia (PML), which stabilizes YAP1 (24).

 

The Puddel_hunde mutation results in a glycine to aspartic acid substitution at amino acid 36 (G36D) in the YAP1 protein; amino acid 36 is an undefined region of YAP1 following the proline-rich N-terminus.

Expression/Localization

YAP1 is highly expressed in the placenta, prostate, testis, ovary, and small intestine, and at lower levels in the brain, liver, and spleen; YAP1 was not expressed in peripheral blood leukocytes (2;25).

 

YAP1 mostly localizes to the cytoplasm, but it can shuttle between the cytoplasm and the nucleus.

Background
Figure 5. YAP/TAZ and FOXO signaling pathways. Signals from GPCRs, the Wnt pathway, mechanical stress, tight junctions, adherent junctions, as well as some soluble growth factors promote the phosphorylation of MST1/2. MST1/2 phosphorylates LATS1/2, subsequently inhibiting the transcriptional function of YAP/TAZ by creating a 14-3-3 binding site, which promotes cytoplasmic localization of YAP/TAZ, resulting in YAP/TAZ cytoplasmic retention and degradation. In the FOXO signaling pathway, MST1/2 phosphorylates AKT and subsequently disrupts its function of interaction between FOXO3 with 14-3-3 proteins. In T cells, MST1/2 promotes T cell migration via the MST1-MOB1-DOCK8-Rac1 axis or by activating and clustering LFA-1 through DENND1C-RAB13, RIAM-Kindlin-3-Talin or VASP signaling. MST1/2 enhances Treg differentiation via promoting Foxp3’s acetylation and activity. In dendritice cells, MST1/2 modulates Th17 differentiation in an MST1/2-p38-IL6-IL-6R-STAT3-dependent manner. This image is interactive. Mutations found in the pathway are noted in red. Click on each mutation for more information.

The Hippo pathway restricts cell proliferation and promotes apoptosis during development, growth, repair, and homeostasis to control organ size (Figure 5). Aberrant Hippo pathway activation can result in uncontrolled cell growth and malignant transformation. The Hippo pathway is activated by G protein-coupled receptors (GPCRs [Gα12/13 and Gαq/11]), cell-cell contact, cell polarity, stress, mechanotransduction, hormones, growth factors, and adhesion and junction proteins (26). Hippo pathway stimulation results in activation of the serine/threonine kinases TAOK1/2/3. TAOK1/2/3 phosphorylate Thr183 of the Hippo homologue STE20-like protein kinase 1 (MST1; alternatively, STK4; see the record for hallon) and Thr180 in MST2 (alternatively, STK3), resulting in MST1/2 activation (27). MST1/2 in complex with the regulatory scaffold protein salvador homologue 1 (SAV1; alternatively, WW45) phosphorylate and activate LATS1/2. The kinases MAP4K1 through MAP4K7 act in parallel with MST1 and MST2 to also phosphorylate LATS1/2. NF2/Merlin interacts with LATS1/2 and facilitates LATS1/2 phosphorylation by the MST1/2–SAV1 complex (28). Activated LATS1/2 in complex with the regulatory protein MOB kinase activator 1 (MOB1) subsequently phosphorylates and inactivates the Yorkie homologues YAP1 and the transcriptional coactivator with PDZ-binding motif (TAZ). YAP1 and TAZ phosphorylation promotes binding with 14-3-3 in the cytoplasm, preventing translocation of YAP1 and TAZ to the nucleus. LATS-induced YAP1 and TAZ phosphorylation induces YAP1/TAZ phosphorylation by casein kinase 1δ/ε, recruitment of the SCF E3 ubiquitin ligase, and subsequent YAP1/TAZ ubiquitination and degradation. When active, YAP1 and TAZ translocate to the nucleus to bind the TEAD transcription factor family (homologs of Drosophila Scalloped) and induce the expression of its target genes involved in cell proliferation, cell death, and cell migration (e.g., CTGFMYC, AREG, JAGGED-1, and BIRC5 [also known as survivin]). YAP and TAZ can also bind to other transcription factors, including SMADs, p63, RUNX2, PPARγ, and PAX3 (see the record for Widget) (29). YAP1 and TAZ interact with the SWI/SNF chromatin-remodeling complex and subsequently recruit a methyl transferase complex into proximity with the transcription factor (30;31). The methyl transferase complex promotes increased histone (H3K4) methylation and target gene transcription (32;32).

 

YAP1 promotes cross-talk between the Hippo and other signaling pathways, including the Wnt, Sonic hedgehog (Shh), Notch, and EGF signaling pathways. YES triggers the formation of a YAP1-β-catenin-TBX5 complex (11). Also, YAP1 interacts with dishevelled and restricts its nuclear localization to compromise Wnt signaling during regeneration in the intestine (33). The Hippo pathway blocks nuclear localization of β-catenin through the cytoplasmic translocation of YAP1 (34). YAP1 and TAZ interact with Axin1, and recruit β-catenin to the β-TrCP degradation complex. YAP1 and TAZ dissociate from Axin1 when the Wnt pathway is activated, stabilizing β-catenin and promoting its translocation to the nucleus (35). Shh up-regulates YAP1 expression at the mRNA and protein level and increases nuclear localization via IRS1 (36). YAP1 up-regulates Jagged-1 and stimulates Notch signaling in a non-cell autonomous manner in hepatocellular carcinomas (37). An EGF receptor (EGFR; see the record for Velvet) ligand, amphiregulin, is a target of YAP1 and TAZ. Aberrant Hippo pathway function upregulates EGF-associated signals in a non-cell autonomous manner (38;39).

 

YAP impairs global miRNA biogenesis by binding and sequestering DEAD box helicase 17 (DDX17), repressing its association with the microprocessor complex (40). YAP/TAZ conversely stimulates the biogenesis of certain miRNAs, such as miR-16, -21, -23a, -29, -107, and -152 by increasing Dicer via the Let-7 family of miRNAs (41;42).

 

YAP1 has putative dual roles as an oncogene and a tumor suppressor. YAP1 promotes apoptosis in response to DNA damage in some cancer cell lines (13;18). However, YAP1 is often deleted in human breast cancers (43). Also, low expression of YAP1 in multiple myeloma cells allows the cells to evade cell death (44). Activated YAP1 in multiple myeloma cells causes reduced cell proliferation and cell death induction. YAP1 is within a chromosomal region that is a recurrent amplicon in esophageal squamous cell carcinoma, liver cancer, and a subset of cervical and lung cancers (45-48).

 

YAP1 is a regulator of mouse embryonic stem (ES) and induced pluripotent stem (iPS) cells (10). Loss of YAP1 and TEAD2 reduces the self-renewal ability and induces the differentiation of mouse ES cells. YAP1 regulates tissue-specific stem cells, and is important for tissue (e.g., liver, intestine, heart, skin, pancreas, lung, and brain) homeostasis and regeneration in adult animals. In the liver, YAP1 controls mature hepatocyte proliferation (49). Liver-specific YAP1 knockout mice were viable, fertile, and exhibited no overt abnormalities (50). However, the mice showed enlarged, pale livers and increased liver to body ratios due to macrovesicular steatosis and progressive fibrosis. The mice showed defects in hepatocyte survival and biliary epithelial cell development (50). Heart-specific YAP1 knockout resulted in myocardial hypoplasia and lethality at embryonic day 10.5 due to defective cardiomyocyte proliferation (51). In the heart, YAP1 activated insulin-like growth factor signaling in cardiomyocytes, leading to glycogen synthase kinase 3β inactivation and an abundance of β-catenin, a positive regulator of cardiac growth. Deletion of YAP1 in the basal layer of the embryonic epidermis caused reduced stratification due to reduced keratinocyte proliferation and reduced stem cell self-renewal (52). In the pancreas, increased YAP1 activity resulted in aberrant ductal cell proliferation throughout adulthood (53). In the brain, NF2 inactivation in the dorsal telencephalon caused expansion of neural progenitor cells in the cortical hem, hippocampus, and neocortex. YAP1 overexpression causes a phenotype similar to that observed after NF2 inactivation (54).  YAP1 function in the intestine is discussed in the ‘Putative Mechanism’ section.

 

Mutations in human YAP1 are associated with ocular coloboma (i.e., hole in one of the structures of the eye) with or without hearing impairment, cleft lip/palate, and/or mental retardation (OMIM: #120433) (55).

 

Yap1-deficient mice exhibited embryonic lethality due to yolk sac defects (50;56). The Yap1-deficient embryos showed abnormal dorsal-ventral axis patterning, incomplete turning, short body axis, caudal dysgenesis, reduced sizes, disorganization of the visceral yolk sac mesoderm, and disorganization of the yolk sac vascular plexus (56). Doxycycline-inducible expression of a mutant YAP1 allele (S127A) resulted in increased nuclear localization of YAP1 (52). Mice expressing the inducible S127A allele specifically in the epidermis showed thickening and wrinkling of the skin eight days after doxycycline administration. The epidermis of the mutant mice showed a multilayered epithelium, an increase in the number of proliferating basal cells, an extension of the proliferative domain into the suprabasal layers, and stunted hair growth. Transfer of skin from the transgenic mice to nude mice resulted in the development of tumor-like masses that resembled squamous cell carcinoma. Epidermis-specific YAP1 knockout mice died during embryogenesis or shortly after birth (52). The mice showed thinner and fragile skin and absence of epidermal tissue covering the distal part of the limbs. Mice expressing a 14-3-3 phosphorylation-deficient YAP1 mutant (S112A) were overtly normal (57). The mutant YAP protein showed reduced expression due to increased phosphorylation at a mammalian-specific YAP1 phosphodegron site (Ser381). The YAP1S112A protein showed nuclear localization. Kidney-specific YAP1 knockout mice showed aberrant nephron induction and morphogenesis (58).

Putative Mechanism

The IL-6 co-receptor gp130 triggers YAP and Notch activation to stimulate epithelial cell proliferation, causes aberrant differentiation and confers resistance to mucosal erosion in the intestine (59). Gp130-associated YAP/Notch activation is stimulated upon mucosal injury to promote healing and maintain barrier function. YAP1 restricts Wnt signals during intestinal regeneration, restricting growth (33). YAP-associated Wnt restriction occurs by limiting the nuclear translocation of dishevelled. Loss of YAP expression causes Wnt hypersensitivity during regeneration, causing hyperplasia expansion of intestinal stem cells and niche cells, and formation of ectopic crypts and microadenomas.

 

YAP1 putatively has a positive role in intestinal regeneration after DSS treatment. Mice with small intestine and colon epithelium-specific YAP inactivation did not have obvious intestinal defects, but did show impaired DSS-induced intestinal regeneration (60). The mice showed significant loss of crypts and scattered colonic epithelial cells as well as fewer proliferating cells and more apoptotic cells. YAP1 hyperactivation results in widespread early-onset polyp formation following DSS treatment (60).

 

The phenotype of the Puddel_hunde mice mimic that of mice with small intestine and colon epithelium-specific YAP inactivation, indicating loss of YAP1-associated function in the intestine.

Primers PCR Primer
Puddel_hunde(F):5'- ATACCCTTACCTGTCGCGAGTG -3'
Puddel_hunde(R):5'- CAAAGTTTCTGTCTCAGTTGGGAC -3'

Sequencing Primer
Puddel_hunde_seq(F):5'- CGAGTGGGACTTGGGCTCAG -3'
Puddel_hunde_seq(R):5'- TCTCAGTTGGGACGCCGC -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsWilliam McAlpine, Emre Turer, and Bruce Beutler