Mutagenetix > Phenotypic Mutation

Phenotypic Mutation 'ernie3' (pdf version)

Allele

ernie3

Mutation Type

critical splice acceptor site (1 bp from exon)

Chromosome

Coordinate

121,773,042 bp (GRCm39)

Base Change

C ⇒ A (forward strand)

Gene

Ern2

Gene Name

endoplasmic reticulum to nucleus signalling 2

Synonym(s)

Ire1b

Chromosomal Location

121,769,116-121,785,430 bp (-) (GRCm39)

MGI Phenotype

PHENOTYPE: Mice homozygous for disruption of this gene are generally normal but display an increased susceptibility to intestinal inflammation. [provided by MGI curators]

Accession Number

NCBI RefSeq: NM_012016, NM_001316689; MGI:1349436

Mapped

Yes

Amino Acid Change

Institutional Source

Beutler Lab

Gene Model

predicted gene model for protein(s): [ENSMUSP00000033153 ^†] [ENSMUSP00000145716 ^†] † probably from a misspliced transcript

AlphaFold

Q9Z2E3

SMART Domains

Protein: ENSMUSP00000033153
Gene: ENSMUSG00000030866

Domain	Start	End	E-Value	Type
low complexity region	14	28	N/A	INTRINSIC
PQQ	33	64	5.5e-8	SMART
PQQ	115	147	4.7e-4	SMART
PQQ	148	180	6.1e-2	SMART
PQQ	192	223	6.2e-3	SMART
low complexity region	449	461	N/A	INTRINSIC
S_TKc	508	768	2.5e-11	SMART
PUG	831	888	9e-24	SMART

Predicted Effect

probably null

Predicted Effect

probably benign

Meta Mutation Damage Score

0.9490

Is this an essential gene?

Probably nonessential (E-score: 0.101) question?

Phenotypic Category

Autosomal Recessive

Candidate Explorer Status

loading ...

Single pedigree
Linkage Analysis Data

Penetrance

Alleles Listed at MGI

All Mutations and Alleles(2) : Chemically induced (ENU)(1) Targeted(1)

Lab Alleles

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01060:Ern2	APN	7	121769315	missense	probably damaging	0.99
IGL01324:Ern2	APN	7	121782413	missense	possibly damaging	0.88
IGL02185:Ern2	APN	7	121772598	splice site	probably benign
IGL02738:Ern2	APN	7	121782122	missense	probably damaging	0.99
IGL02750:Ern2	APN	7	121780629	splice site	probably benign
IGL03247:Ern2	APN	7	121770894	missense	probably benign	0.02
ernie	UTSW	7	121770884	critical splice donor site	probably null
Ernie2	UTSW	7	121780085	splice site	probably benign
R0165:Ern2	UTSW	7	121779002	missense	probably benign	0.02
R0785:Ern2	UTSW	7	121770884	critical splice donor site	probably null
R0801:Ern2	UTSW	7	121780085	splice site	probably benign
R1345:Ern2	UTSW	7	121776993	missense	probably damaging	1.00
R1649:Ern2	UTSW	7	121776623	missense	probably damaging	1.00
R1747:Ern2	UTSW	7	121773043	critical splice acceptor site	probably null
R1747:Ern2	UTSW	7	121773042	critical splice acceptor site	probably null
R1846:Ern2	UTSW	7	121775759	missense	probably benign	0.32
R1899:Ern2	UTSW	7	121783065	splice site	probably benign
R1986:Ern2	UTSW	7	121770752	missense	probably benign	0.06
R2055:Ern2	UTSW	7	121783168	missense	possibly damaging	0.84
R2329:Ern2	UTSW	7	121772710	missense	possibly damaging	0.82
R2351:Ern2	UTSW	7	121770731	missense	probably damaging	0.97
R2894:Ern2	UTSW	7	121780810	missense	possibly damaging	0.94
R3176:Ern2	UTSW	7	121780187	missense	possibly damaging	0.89
R3276:Ern2	UTSW	7	121780187	missense	possibly damaging	0.89
R3945:Ern2	UTSW	7	121775753	missense	probably benign	0.10
R4303:Ern2	UTSW	7	121777069	critical splice acceptor site	probably null
R4874:Ern2	UTSW	7	121775810	missense	probably benign	0.28
R4943:Ern2	UTSW	7	121772481	missense	possibly damaging	0.95
R5184:Ern2	UTSW	7	121779182	missense	probably benign	0.03
R5629:Ern2	UTSW	7	121769389	missense	probably damaging	1.00
R5770:Ern2	UTSW	7	121779130	missense	possibly damaging	0.92
R6255:Ern2	UTSW	7	121772495	missense	probably damaging	1.00
R6272:Ern2	UTSW	7	121775869	missense	probably benign	0.05
R6277:Ern2	UTSW	7	121785330	missense	probably benign
R6624:Ern2	UTSW	7	121777006	missense	probably benign	0.00
R6940:Ern2	UTSW	7	121785369	missense	probably benign	0.01
R7491:Ern2	UTSW	7	121769756	missense	probably damaging	1.00
R7544:Ern2	UTSW	7	121772422	missense	probably benign	0.06
R7555:Ern2	UTSW	7	121769464	missense	probably damaging	1.00
R7843:Ern2	UTSW	7	121772931	missense	probably damaging	1.00
R8281:Ern2	UTSW	7	121769483	missense	probably damaging	1.00
R8321:Ern2	UTSW	7	121772431	missense	probably damaging	1.00
R8377:Ern2	UTSW	7	121780515	nonsense	probably null
R8548:Ern2	UTSW	7	121777062	missense	probably damaging	1.00
R8853:Ern2	UTSW	7	121772967	missense	probably damaging	1.00
R8929:Ern2	UTSW	7	121769363	missense	probably benign	0.03
R8931:Ern2	UTSW	7	121769363	missense	probably benign	0.03
R9088:Ern2	UTSW	7	121772890	missense	probably damaging	1.00
R9511:Ern2	UTSW	7	121776823	missense	probably benign	0.03
R9789:Ern2	UTSW	7	121769485	missense	probably damaging	1.00

Mode of Inheritance

Autosomal Recessive

Local Stock

Repository

Last Updated

2019-09-04 9:43 PM by Anne Murray

Record Created

2016-02-17 3:22 PM

Record Posted

2016-09-13

Phenotypic Description

Figure 1. Ernie3 mice exhibited weight loss on day 7 after DSS treatment. Normalized gene-based superpedigree data are shown for pedigrees R1747 (blue), R0785 (yellow), and R4303 (red). Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Ernie3 mice exhibited weight loss on day 10 after DSS treatment. Normalized gene-based superpedigree data are shown for pedigrees R1747 (blue), R0785 (yellow), and R4303 (red). Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The ernie3 phenotype was identified among G3 mice of the pedigree R1747, some of which exhibited susceptibility to dextran sulfate sodium (DSS)-induced colitis at days 7 (Figure 1) and day 10 (Figure 2) of DSS exposure in the drinking water.

Nature of Mutation

Figure 3. Gene-based superpedigree linkage mapping of the DSS-induced colitis phenotype at day 7 using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of the 144 mutations found in the G1 male mice of pedigrees R0785, R1747, and R4303 (34, 65, and 45 mutations, respectively). Normalized phenotype data are shown for gene-based superpedigree linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 65 mutations. The increased susceptibility to DSS-induced colitis phenotype was linked to a mutation in Ern2 by continuous variable mapping using gene-based superpedigree analysis in which the Ern2 gene has multiple mutant alleles derived from multiple pedigrees. The Ern2 mutation is a G to T transversion at base pair 122,173,819 (v38) on chromosome 7, or base pair 12,408 in the GenBank genomic region NC_000073 within the acceptor splice site of intron 14. Linkage was found with a recessive model of inheritance (P = 7.934 x 10^-17), wherein 13 variant homozygotes from three pedigrees (R0785, R1747, and R4303) departed phenotypically from 27 homozygous reference mice and 46 heterozygous mice (Figure 3).

The effect of the mutation at the cDNA and protein level have not examined, but the mutation is predicted to result in a 2-base pair deletion in exon 15 due to the use of a cryptic site in exon 15. The 2-base pair deletion would result in a frame-shifted protein product beginning after amino acid 525 of the protein, and premature termination after the inclusion of two aberrant amino acids.

<--exon 14 <--intron 14 exon 15-->

12235 ……ACTTTTGTTTTCCG ……ccctggaccacctctcag --GACAGTTTGA……

521   ……-T--F--V--F--R                        --T--V--*

           correct                             aberrant

Genomic numbering corresponds to NC_000073. The acceptor splice site of intron 14, which is destroyed by the ernie3 mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red.

Illustration of Mutations in
Gene & Protein

Protein Prediction

Figure 4. Domains of IRE1β. IRE1β is a type I transmembrane receptor in the endoplasmic reticulum. See the text for more details. Abbreviations: SP, signal peptide; PQQ, pyrrolo-quinoline quinone beta-propeller repeat; TM, transmembrane domain; KEN, kinase-extension-nuclease domain. The ernie3 mutation within intron 14, is indicated in red.

Ern2 encodes inositol-requiring enzyme 1β (IRE1β), a type I transmembrane receptor paralog of IRE1α. IRE1β and IRE1α have an N-terminal sensory domain that faces the endoplasmic reticulum (ER) lumen (amino acids 35-426), a transmembrane domain (amino acid 427-447), and a cytoplasmic effector domain at the C-terminus (amino acid 448-911) [Figure 4; (1;2)]. Amino acids 1-33 comprise a signal peptide. The luminal domain (LD) of IRE1β has four pyrrolo-quinoline quinone (PQQ) beta-propeller repeats (amino acids 33-64, 115-147, 148-180, and 192-223; SMART) (3). The cytoplasmic domain of IRE1β has both a protein kinase domain (amino acids 508-768) and a kinase-extension-nuclease domain (KEN domain; alternatively, RNAse domain; amino acids 771-899) (3).

The ernie3 mutation may cause aberrant splicing and subsequent coding of a premature stop codon in exon 15. Exon 15 encodes residues within the kinase domain.

For more information about Ern2, please see the record for ernie.

Putative Mechanism

IRE1β is expressed in the gastrointestinal epithelial cells and mucus cells in bronchial epithelia. During the unfolded protein response (UPR), both IRE1α and IRE1β can catalyze the processing of Xbp1 (4-6), although IRE1β is less efficient than IRE1α (1). IRE1α and IRE1β both activate c-Jun NH₂-terminal kinase (JNK) in response to ER stress (7). IRE1β is unique from IRE1α in that IRE1β directly interacts with unfolded proteins rather than with GRP78 during conditions of ER stress (8).

IRE1β posttranscriptionally degrades Mtp (9), which is induced during enterocyte differentiation. Mtp encodes an ER chaperone required for lipid mobilization via apolipoprotein B (apoB) lipoproteins (9). MTP and apoB are also required for chylomicron assembly in the ER of enterocytes (10-12). Chylomicrons are vesicles synthesized by the intestine and function to transport large quantities of dietary fat and fat-soluble vitamins (12-14).

Ern2 knockout (Ern2^-/-) mice are viable and healthy. However, when challenged with DSS, the Ern2^-/-mice (in both the 129svev and C57BL/6 genetic backgrounds) developed colitis 3-5 days earlier than wild-type and heterozygous mice. In addition, the Ern2^-/-mice exhibited mortality approximately 5 days earlier than wild-type or heterozygous mice. Further studies determined that loss of IRE1β expression promotes ER stress specifically in immature goblet cells (15). Examination of goblet cells from Ern2^-/-mice determined that the ER was distended in the cells. Within the distended ER of the immature goblet cells, aberrant mucin accumulation was observed. Tsuru et al. proposed that the susceptibility to colitis may indicate a qualitative defect in mucins secreted by the goblet cells in the Ern2^-/-mice (15). Similar to the Ern2^-/-mice, the ernie3 mice exhibit susceptibility to DSS-induced colitis indicating loss of function in IRE1β.

Primers

PCR Primer
ernie3_pcr_F: AGCTCCAAGGCAATGTAGTGGAAC
ernie3_pcr_R: CGTGGTGGGGAAGATTTCCTTCAAC

Sequencing Primer
ernie3_seq_F: TGGAACTGGGGACCATGC
ernie3_seq_R: TTCAACCCCAAGGATGTGCTG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 400 nucleotides is amplified (chromosome 7, - strand):

1 cgtggtgggg aagatttcct tcaaccccaa ggatgtgctg ggccgtgggg caggagggac
61 ttttgttttc cggtgagtgg caggtggagc tgcaggctcc atcacttgca gcccttttga
121 caacaaccaa aggacagcca tccttccaga ctcccagatg tgaggatagg tccccactct
181 tttccttatc tgctctctga acccccaccc ccacccctgg accacctctc agaggacagt
241 ttgaggggcg ggcagtagct gtgaagaggc tcctccgaga gtgctttggc ttggttcggc
301 gagaggtgca gctgctgcaa gagtctgacc ggcaccccaa cgtgcttcgc tacttctgca
361 ctgagcatgg tccccagttc cactacattg ccttggagct