Phenotypic Mutation 'ernie3' (pdf version)
List |< first << previous [record 26 of 30] next >> last >|
Alleleernie3
Mutation Type critical splice acceptor site (1 bp from exon)
Chromosome7
Coordinate122,173,819 bp (GRCm38)
Base Change C ⇒ A (forward strand)
Gene Ern2
Gene Name endoplasmic reticulum (ER) to nucleus signalling 2
Synonym(s) Ire1b
Chromosomal Location 122,169,893-122,186,207 bp (-)
MGI Phenotype PHENOTYPE: Mice homozygous for disruption of this gene are generally normal but display an increased susceptibility to intestinal inflammation. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_012016, NM_001316689; MGI:1349436

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000033153] [ENSMUSP00000033154] [ENSMUSP00000145716]
SMART Domains Protein: ENSMUSP00000033153
Gene: ENSMUSG00000030866

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
PQQ 33 64 5.5e-8 SMART
PQQ 115 147 4.7e-4 SMART
PQQ 148 180 6.1e-2 SMART
PQQ 192 223 6.2e-3 SMART
low complexity region 449 461 N/A INTRINSIC
S_TKc 508 768 2.5e-11 SMART
PUG 831 888 9e-24 SMART
Predicted Effect probably null
Predicted Effect probably benign
Phenotypic Category
Phenotypequestion? Literature verified References
DSS: sensitive day 10 11238559
DSS: sensitive day 7 11238559
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(2) : Chemically induced (ENU)(1) Targeted(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Ern2 APN 7 122170092 missense probably damaging 0.99
IGL01324:Ern2 APN 7 122183190 missense possibly damaging 0.88
IGL02185:Ern2 APN 7 122173375 splice site probably benign
IGL02738:Ern2 APN 7 122182899 missense probably damaging 0.99
IGL02750:Ern2 APN 7 122181406 splice site probably benign
IGL03247:Ern2 APN 7 122171671 missense probably benign 0.02
ernie UTSW 7 122171661 critical splice donor site probably null
Ernie2 UTSW 7 122180862 splice donor site probably benign
R0165:Ern2 UTSW 7 122179779 missense probably benign 0.02
R0785:Ern2 UTSW 7 122171661 critical splice donor site probably null
R0801:Ern2 UTSW 7 122180862 splice site probably benign
R1345:Ern2 UTSW 7 122177770 missense probably damaging 1.00
R1649:Ern2 UTSW 7 122177400 missense probably damaging 1.00
R1747:Ern2 UTSW 7 122173819 critical splice acceptor site probably null
R1747:Ern2 UTSW 7 122173820 critical splice acceptor site probably null
R1846:Ern2 UTSW 7 122176536 missense probably benign 0.32
R1899:Ern2 UTSW 7 122183842 splice site probably benign
R1986:Ern2 UTSW 7 122171529 missense probably benign 0.06
R2055:Ern2 UTSW 7 122183945 missense possibly damaging 0.84
R2329:Ern2 UTSW 7 122173487 missense possibly damaging 0.82
R2351:Ern2 UTSW 7 122171508 missense probably damaging 0.97
R2894:Ern2 UTSW 7 122181587 missense possibly damaging 0.94
R3176:Ern2 UTSW 7 122180964 missense possibly damaging 0.89
R3276:Ern2 UTSW 7 122180964 missense possibly damaging 0.89
R3945:Ern2 UTSW 7 122176530 missense probably benign 0.10
R4303:Ern2 UTSW 7 122177846 critical splice acceptor site probably null
R4874:Ern2 UTSW 7 122176587 missense probably benign 0.28
R4943:Ern2 UTSW 7 122173258 missense possibly damaging 0.95
R5184:Ern2 UTSW 7 122179959 missense probably benign 0.03
R5629:Ern2 UTSW 7 122170166 missense probably damaging 1.00
R5770:Ern2 UTSW 7 122179907 missense possibly damaging 0.92
R6255:Ern2 UTSW 7 122173272 missense probably damaging 1.00
R6272:Ern2 UTSW 7 122176646 missense probably benign 0.05
R6277:Ern2 UTSW 7 122186107 missense probably benign
R6624:Ern2 UTSW 7 122177783 missense probably benign 0.00
R6940:Ern2 UTSW 7 122186146 missense probably benign 0.01
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2016-11-10 11:50 AM by Anne Murray
Record Created 2016-02-17 3:22 PM
Record Posted 2016-09-13
Phenotypic Description
Figure 1. Ernie3 mice exhibited weight loss on day 7 after DSS treatment. Normalized gene-based superpedigree data are shown for pedigrees R1747 (blue), R0785 (yellow), and R4303 (red). Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 2. Ernie3 mice exhibited weight loss on day 10 after DSS treatment. Normalized gene-based superpedigree data are shown for pedigrees R1747 (blue), R0785 (yellow), and R4303 (red). Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The ernie3 phenotype was identified among G3 mice of the pedigree R1747, some of which exhibited susceptibility to dextran sulfate sodium (DSS)-induced colitis at days 7 (Figure 1) and day 10 (Figure 2) of DSS exposure in the drinking water.

Nature of Mutation

Figure 3. Gene-based superpedigree linkage mapping of the DSS-induced colitis phenotype at day 7 using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of the 144 mutations found in the G1 male mice of pedigrees R0785, R1747, and R4303 (34, 65, and 45 mutations, respectively). Normalized phenotype data are shown for gene-based superpedigree linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 65 mutations. The increased susceptibility to DSS-induced colitis phenotype was linked to a mutation in Ern2 by continuous variable mapping using gene-based superpedigree analysis in which the Ern2 gene has multiple mutant alleles derived from multiple pedigrees. The Ern2 mutation is a G to T transversion at base pair 122,173,819 (v38) on chromosome 7, or base pair 12,408 in the GenBank genomic region NC_000073 within the acceptor splice site of intron 14. Linkage was found with a recessive model of inheritance (P = 7.934 x 10-17), wherein 13 variant homozygotes from three pedigrees (R0785, R1747, and R4303) departed phenotypically from 27 homozygous reference mice and 46 heterozygous mice (Figure 3).  

 

The effect of the mutation at the cDNA and protein level have not examined, but the mutation is predicted to result in a 2-base pair deletion in exon 15 due to the use of a cryptic site in exon 15. The 2-base pair deletion would result in a frame-shifted protein product beginning after amino acid 525 of the protein, and premature termination after the inclusion of two aberrant amino acids.  

 

           <--exon 14          <--intron 14 exon 15-->

12235 ……ACTTTTGTTTTCCG ……ccctggaccacctctcag --GACAGTTTGA……
521   ……-T--F--V--F--R                        --T--V--*
           correct                             aberrant

         

Genomic numbering corresponds to NC_000073. The acceptor splice site of intron 14, which is destroyed by the ernie3 mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. 
Protein Prediction

Figure 4. Domains of IRE1β. IRE1β is a type I transmembrane receptor in the endoplasmic reticulum. See the text for more details. Abbreviations: SP, signal peptide; PQQ, pyrrolo-quinoline quinone beta-propeller repeat; TM, transmembrane domain; KEN, kinase-extension-nuclease domain. The ernie3 mutation within intron 14, is indicated in red.

Ern2 encodes inositol-requiring enzyme 1β (IRE1β), a type I transmembrane receptor paralog of IRE1α. IRE1β and IRE1α have an N-terminal sensory domain that faces the endoplasmic reticulum (ER) lumen (amino acids 35-426), a transmembrane domain (amino acid 427-447), and a cytoplasmic effector domain at the C-terminus (amino acid 448-911) [Figure 4; (1;2)]. Amino acids 1-33 comprise a signal peptide. The luminal domain (LD) of IRE1β has four pyrrolo-quinoline quinone (PQQ) beta-propeller repeats (amino acids 33-64, 115-147, 148-180, and 192-223; SMART) (3). The cytoplasmic domain of IRE1β has both a protein kinase domain (amino acids 508-768) and a kinase-extension-nuclease domain (KEN domain; alternatively, RNAse domain; amino acids 771-899) (3).

 

The ernie3 mutation may cause aberrant splicing and subsequent coding of a premature stop codon in exon 15. Exon 15 encodes residues within the kinase domain.

 

For more information about Ern2, please see the record for ernie.

Putative Mechanism

IRE1β is expressed in the gastrointestinal epithelial cells and mucus cells in bronchial epithelia. During the unfolded protein response (UPR), both IRE1α and IRE1β can catalyze the processing of Xbp1 (4-6), although IRE1β is less efficient than IRE1α (1). IRE1α and IRE1β both activate c-Jun NH2-terminal kinase (JNK) in response to ER stress (7). IRE1β is unique from IRE1α in that IRE1β directly interacts with unfolded proteins rather than with GRP78 during conditions of ER stress (8).

 

IRE1β posttranscriptionally degrades Mtp (9), which is induced during enterocyte differentiation. Mtp encodes an ER chaperone required for lipid mobilization via apolipoprotein B (apoB) lipoproteins (9). MTP and apoB are also required for chylomicron assembly in the ER of enterocytes (10-12). Chylomicrons are vesicles synthesized by the intestine and function to transport large quantities of dietary fat and fat-soluble vitamins (12-14).

 

Ern2 knockout (Ern2-/-) mice are viable and healthy. However, when challenged with DSS, the Ern2-/- mice (in both the 129svev and C57BL/6 genetic backgrounds) developed colitis 3-5 days earlier than wild-type and heterozygous mice. In addition, the Ern2-/- mice exhibited mortality approximately 5 days earlier than wild-type or heterozygous mice.  Further studies determined that loss of IRE1β expression promotes ER stress specifically in immature goblet cells (15). Examination of goblet cells from Ern2-/- mice determined that the ER was distended in the cells. Within the distended ER of the immature goblet cells, aberrant mucin accumulation was observed. Tsuru et al. proposed that the susceptibility to colitis may indicate a qualitative defect in mucins secreted by the goblet cells in the Ern2-/- mice (15). Similar to the Ern2-/- mice, the ernie3 mice exhibit susceptibility to DSS-induced colitis indicating loss of function in IRE1β.

Primers PCR Primer
ernie3(F):5'- AGCTCCAAGGCAATGTAGTGGAAC -3'
ernie3(R):5'- CGTGGTGGGGAAGATTTCCTTCAAC -3'

Sequencing Primer
ernie3_seq(F):5'- TGGAACTGGGGACCATGC -3'
ernie3_seq(R):5'- TTCAACCCCAAGGATGTGCTG -3'
References

1. Imagawa, Y., Hosoda, A., Sasaka, S., Tsuru, A., and Kohno, K. (2008) RNase Domains Determine the Functional Difference between IRE1alpha and IRE1beta. FEBS Lett. 582, 656-660.

  2. Lee, K. P., Dey, M., Neculai, D., Cao, C., Dever, T. E., and Sicheri, F. (2008) Structure of the Dual Enzyme Ire1 Reveals the Basis for Catalysis and Regulation in Nonconventional RNA Splicing. Cell. 132, 89-100.

  3. Wang, X. Z., Harding, H. P., Zhang, Y., Jolicoeur, E. M., Kuroda, M., and Ron, D. (1998) Cloning of Mammalian Ire1 Reveals Diversity in the ER Stress Responses. EMBO J. 17, 5708-5717.

  4. Calfon, M., Zeng, H., Urano, F., Till, J. H., Hubbard, S. R., Harding, H. P., Clark, S. G., and Ron, D. (2002) IRE1 Couples Endoplasmic Reticulum Load to Secretory Capacity by Processing the XBP-1 mRNA. Nature. 415, 92-96.

  5. Lee, K., Tirasophon, W., Shen, X., Michalak, M., Prywes, R., Okada, T., Yoshida, H., Mori, K., and Kaufman, R. J. (2002) IRE1-Mediated Unconventional mRNA Splicing and S2P-Mediated ATF6 Cleavage Merge to Regulate XBP1 in Signaling the Unfolded Protein Response. Genes Dev. 16, 452-466.

  6. Yoshida, H., Matsui, T., Yamamoto, A., Okada, T., and Mori, K. (2001) XBP1 mRNA is Induced by ATF6 and Spliced by IRE1 in Response to ER Stress to Produce a Highly Active Transcription Factor. Cell. 107, 881-891.

  7. Urano, F., Wang, X., Bertolotti, A., Zhang, Y., Chung, P., Harding, H. P., and Ron, D. (2000) Coupling of Stress in the ER to Activation of JNK Protein Kinases by Transmembrane Protein Kinase IRE1. Science. 287, 664-666.

  8. Oikawa, D., Kitamura, A., Kinjo, M., and Iwawaki, T. (2012) Direct Association of Unfolded Proteins with Mammalian ER Stress Sensor, IRE1beta. PLoS One. 7, e51290.

  9. Dai, K., Khatun, I., and Hussain, M. M. (2010) NR2F1 and IRE1beta Suppress Microsomal Triglyceride Transfer Protein Expression and Lipoprotein Assembly in Undifferentiated Intestinal Epithelial Cells. Arterioscler Thromb Vasc Biol. 30, 568-574.

  10. Hussain, M. M., Shi, J., and Dreizen, P. (2003) Microsomal Triglyceride Transfer Protein and its Role in apoB-Lipoprotein Assembly. J Lipid Res. 44, 22-32.

  11. Hussain, M. M., Iqbal, J., Anwar, K., Rava, P., and Dai, K. (2003) Microsomal Triglyceride Transfer Protein: A Multifunctional Protein. Front Biosci. 8, s500-6.

  12. Iqbal, J., Dai, K., Seimon, T., Jungreis, R., Oyadomari, M., Kuriakose, G., Ron, D., Tabas, I., and Hussain, M. M. (2008) IRE1beta Inhibits Chylomicron Production by Selectively Degrading MTP mRNA. Cell Metab. 7, 445-455.

  13. Hussain, M. M., Kancha, R. K., Zhou, Z., Luchoomun, J., Zu, H., and Bakillah, A. (1996) Chylomicron Assembly and Catabolism: Role of Apolipoproteins and Receptors. Biochim Biophys Acta. 1300, 151-170.

  14. Hussain, M. M. (2000) A Proposed Model for the Assembly of Chylomicrons. Atherosclerosis. 148, 1-15.

  15. Tsuru, A., Fujimoto, N., Takahashi, S., Saito, M., Nakamura, D., Iwano, M., Iwawaki, T., Kadokura, H., Ron, D., and Kohno, K. (2013) Negative Feedback by IRE1beta Optimizes Mucin Production in Goblet Cells. Proc Natl Acad Sci U S A. 110, 2864-2869.

Science Writers Anne Murray
Illustrators Peter Jurek, Katherine Timer
AuthorsEmre Turer, William McAlpine, and Bruce Beutler
List |< first << previous [record 26 of 30] next >> last >|