Phenotypic Mutation 'thistle2' (pdf version)
Mutation Type missense
Coordinate71,685,545 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Jak3
Gene Name Janus kinase 3
Synonym(s) fae; wil
Chromosomal Location 71,676,296-71,690,575 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Janus kinase (JAK) family of tyrosine kinases involved in cytokine receptor-mediated intracellular signal transduction. It is predominantly expressed in immune cells and transduces a signal in response to its activation via tyrosine phosphorylation by interleukin receptors. Mutations in this gene are associated with autosomal SCID (severe combined immunodeficiency disease). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired B cell development, small thymi and T cell proliferate. Point mutation homozygotes develop autoimmune inflammatory bowel disease, decreased susceptibility to malaria infection and/or increased susceptibility to bacterial infection. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_010589; NM_001190830; MGI:99928

Mapped Yes 
Limits of the Critical Region 71676296 - 71690575 bp
Amino Acid Change Valine changed to Aspartic acid
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000060073] [ENSMUSP00000105639] [ENSMUSP00000105640]
SMART Domains Protein: ENSMUSP00000060073
Gene: ENSMUSG00000031805
AA Change: V880D

B41 20 254 2.2e-42 SMART
SH2 370 460 5.57e-8 SMART
low complexity region 488 503 N/A INTRINSIC
STYKc 517 773 3.58e-12 SMART
TyrKc 818 1091 4.59e-105 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000051995)
SMART Domains Protein: ENSMUSP00000105639
Gene: ENSMUSG00000031805
AA Change: V880D

B41 20 254 2.2e-42 SMART
SH2 370 460 5.57e-8 SMART
low complexity region 488 503 N/A INTRINSIC
STYKc 517 773 3.58e-12 SMART
TyrKc 818 1091 4.59e-105 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000110012)
SMART Domains Protein: ENSMUSP00000105640
Gene: ENSMUSG00000031805
AA Change: V880D

B41 20 254 2.2e-42 SMART
SH2 370 460 5.57e-8 SMART
low complexity region 488 503 N/A INTRINSIC
STYKc 517 773 3.58e-12 SMART
TyrKc 818 1091 4.59e-105 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000110013)
Meta Mutation Damage Score 0.442 question?
Is this an essential gene? Possibly essential (E-score: 0.693) question?
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B cells - decreased
FACS B1 cells - decreased
FACS B1b cells - increased
FACS B2 cells - decreased
FACS CD11b+ DCs (gated in CD11c+ cells) - decreased
FACS CD4+ T cells - decreased
FACS CD44+ CD4 MFI - increased
FACS CD44+ CD8 MFI - increased
FACS CD44+ T MFI - increased
FACS CD8+ T cells - decreased
FACS CD8+ T cells in CD3+ T cells - decreased
FACS effector memory CD4 T cells in CD4 T cells - increased
FACS IgD+ B cell percentage - decreased
FACS IgM+ B cells - decreased
FACS naive CD4 T cells in CD4 T cells - decreased
FACS naive CD8 T cells in CD8 T cells - decreased
FACS T cells - decreased
ratio of OVA-specific IgE over the total IgE - increased
T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization
T-dependent humoral response defect- decreased antibody response to rSFV
T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization
Candidate Explorer Status CE: failed initial filter
Single pedigree
Linkage Analysis Data
Alleles Listed at MGI

All Mutations and Alleles(29) : Chemically induced (ENU)(6) Chemically induced (other)(1) Gene trapped(14) Spontaneous (1) Targeted(5) Transgenic (2)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Jak3 APN 8 71681697 splice site probably benign
IGL00720:Jak3 APN 8 71684037 missense probably damaging 1.00
IGL00966:Jak3 APN 8 71679012 missense probably benign 0.24
IGL01147:Jak3 APN 8 71683403 missense probably benign
IGL01308:Jak3 APN 8 71685166 missense probably damaging 1.00
IGL01328:Jak3 APN 8 71679620 missense probably damaging 1.00
IGL01386:Jak3 APN 8 71684289 missense probably damaging 1.00
IGL01515:Jak3 APN 8 71680562 splice site probably null
IGL01870:Jak3 APN 8 71680790 missense probably damaging 1.00
IGL02132:Jak3 APN 8 71678480 missense probably damaging 0.99
IGL02413:Jak3 APN 8 71686119 unclassified probably null
IGL02752:Jak3 APN 8 71682951 missense possibly damaging 0.50
IGL03089:Jak3 APN 8 71686083 missense probably benign 0.15
IGL03177:Jak3 APN 8 71682370 missense probably damaging 1.00
citron UTSW 8 71686976 splice site probably benign
daniels UTSW 8 71681655 missense possibly damaging 0.48
Deposuit UTSW 8 71685404 missense probably damaging 1.00
distortion UTSW 8 71683978 missense probably damaging 1.00
Implevit UTSW 8 71678773 missense probably benign
mount_tai UTSW 8 71683377 missense probably damaging 1.00
potentes UTSW 8 71686058 missense probably damaging 0.99
thistle UTSW 8 71685383 critical splice acceptor site probably null
PIT4403001:Jak3 UTSW 8 71684349 missense probably benign 0.00
PIT4515001:Jak3 UTSW 8 71679642 missense probably benign 0.21
R0013:Jak3 UTSW 8 71684327 missense probably damaging 0.98
R0496:Jak3 UTSW 8 71682397 missense probably damaging 1.00
R0522:Jak3 UTSW 8 71682274 splice site probably benign
R0531:Jak3 UTSW 8 71686976 splice site probably benign
R0538:Jak3 UTSW 8 71685482 missense probably benign
R0612:Jak3 UTSW 8 71683377 missense probably damaging 1.00
R0744:Jak3 UTSW 8 71683978 missense probably damaging 1.00
R0833:Jak3 UTSW 8 71683978 missense probably damaging 1.00
R0836:Jak3 UTSW 8 71683978 missense probably damaging 1.00
R1183:Jak3 UTSW 8 71684550 missense probably damaging 1.00
R1420:Jak3 UTSW 8 71681538 missense possibly damaging 0.75
R1793:Jak3 UTSW 8 71685946 splice site probably benign
R1967:Jak3 UTSW 8 71681535 missense probably damaging 1.00
R1983:Jak3 UTSW 8 71678375 missense possibly damaging 0.95
R1983:Jak3 UTSW 8 71688136 missense probably benign
R2058:Jak3 UTSW 8 71685383 critical splice acceptor site probably null
R2060:Jak3 UTSW 8 71680714 nonsense probably null
R2060:Jak3 UTSW 8 71683415 nonsense probably null
R3705:Jak3 UTSW 8 71681522 missense probably damaging 1.00
R3734:Jak3 UTSW 8 71676581 unclassified probably benign
R4231:Jak3 UTSW 8 71685545 missense probably damaging 1.00
R4596:Jak3 UTSW 8 71684631 missense probably damaging 0.99
R4844:Jak3 UTSW 8 71681655 missense possibly damaging 0.48
R4897:Jak3 UTSW 8 71685404 missense probably damaging 1.00
R5038:Jak3 UTSW 8 71686058 missense probably damaging 0.99
R5469:Jak3 UTSW 8 71678773 missense probably benign
R5538:Jak3 UTSW 8 71678773 missense probably benign
R5718:Jak3 UTSW 8 71684354 missense probably damaging 1.00
R5799:Jak3 UTSW 8 71678700 missense probably damaging 1.00
R5909:Jak3 UTSW 8 71684231 missense possibly damaging 0.68
R5959:Jak3 UTSW 8 71682071 missense probably damaging 1.00
R6260:Jak3 UTSW 8 71679310 missense probably benign 0.00
R6798:Jak3 UTSW 8 71680971 missense probably damaging 0.99
R7013:Jak3 UTSW 8 71678781 missense possibly damaging 0.88
R7070:Jak3 UTSW 8 71684611 missense probably damaging 1.00
R7122:Jak3 UTSW 8 71685957 missense probably damaging 1.00
R7166:Jak3 UTSW 8 71682316 missense probably damaging 1.00
R7225:Jak3 UTSW 8 71685511 missense probably benign 0.07
Mode of Inheritance Autosomal Recessive
Local Stock
Last Updated 2019-09-04 9:43 PM by Diantha La Vine
Record Created 2016-02-18 11:59 PM by Jin Huk Choi
Record Posted 2016-04-28
Phenotypic Description

Figure 1. Homozygous thistle2 mice exhibit diminished T-dependent IgG responses to ovalbumin administered with aluminum hydroxide. IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The thistle2 phenotype among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4231, some of which showed a diminished T-dependent antibody response to ovalbumin (OVA) administered with aluminum hydroxide (OVA/Alum; Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the diminished reduced T-dependent antibody response to OVA/Alum using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 72 mutations (X-axis) identified in the G1 male of pedigree R4231. Normalized phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 72 mutations. The diminished T-dependent antibody response to OVA/Alum was linked to a mutation in Jak3: a T to A transversion at base pair 71,685,545 (v38) on chromosome 8, or base pair 9,163 in the GenBank genomic region NC_000074 encoding Jak3. Linkage was found with a recessive model of inheritance (P = 4.754 x 10-9), wherein five variant homozygotes departed phenotypically from one homozygous reference mouse and five heterozygous mice (Figure 2).


The mutation corresponds to residue 2,849 in the mRNA sequence NM_010589 within exon 19 of 25 total exons, and to residue 2,849 in the mRNA sequence NM_001190830 within exon 19 of 24 total exons.

874  -H--S--D--F--I--V--K--Y--R--G--V-


Genomic numbering corresponds to NC_000074. The mutated nucleotide is indicated in red.  The mutation results in a valine (V) to aspartic acid (D) substitution at position 880 (V880D) in the JAK3 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.999).

Protein Prediction

Figure 3. Domain structure of JAK3. The thistle2 mutation results in a valine to aspartic acid substitution at position 880. Abbreviations: B41, 4.1, ezrin, radixin, moesin (FERM) homology domain; SH2, Src Homology 2-like. This image is interactive. Other mutations found in JAK3 are noted in red. Click on each mutation for more information.

Jak3 encodes Janus kinase 3 (JAK3). JAK3 has seven different highly conserved JAK homology (JH) regions (JH1-JH7) [Figure 3; reviewed in (1)]. The JH1 region is the kinase domain (amino acids 818-1091), the JH2 domain corresponds to the pseudokinase domain (amino acids 517-773), the JH3 and JH4 regions comprise an Src Homology 2 (SH2)-like domain (amino acids 370-460), and the JH6 and JH7 regions consist of a 4.1, ezrin, radixin, moesin (FERM) homology domain (alternatively, B41 domain; amino acids 20-254). The thistle2 mutation results in a valine (V) to aspartic acid (D) substitution at position 880 (V880D). V880 is within the kinase domain of JAK3.


Please see the record mount_tai for more information about Jak3.

Putative Mechanism

JAK3 binding is restricted to hematopoietic-specific cytokine receptors that have a γc receptor subunit (i.e., the IL-2, IL-4, IL-7, IL-9, IL-15, and IL-21 receptors) [reviewed in (1)]. The γc receptor-associated cytokines have known functions. For example, IL-7 is necessary for T and B cell development, IL-2 functions in peripheral T cell homeostasis and antigen-driven T-cell expansion, IL-15 functions in natural killer (NK) cell differentiation, IL-4 functions in B-cell maturation and isotype switching (2). JAK3 mutations result in defective γc receptor-associated signaling and subsequent defects in lymphocyte development (2;3). Mutations in JAK3 are linked to autosomal recessive T- and NK-cell negative/B-cell positive type of severe combined immunodeficiency [TB+NK- SCID; OMIM: #600802; (4-6); reviewed in (2)]. Patients with TB+NK- SCID do not have T or NK cells, but have normal to elevated numbers of immature nonfunctional B lymphocytes (5;6). Patients with SCID have persistent, recurring infections due to loss of T cell-associated immunity.  Jak3 knockout (Jak3-/-) mice have reduced numbers of T, B, γδ T, and NK cells (7-11). B cell maturation in the Jak3-/- mice is blocked at the pre-B stage, leading to a reduced frequency of IgM+ B cells (10). The phenotype observed in the thistle2 mice indicates that JAK3thistle2 exhibits loss of JAK3 function.

Primers PCR Primer

Sequencing Primer
thistle2_seq(F):5'- GGTGGACACTGCCCTCTCATC -3'

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 441 nucleotides is amplified (chromosome 8, + strand):

1   ttaagtacat ctctttgctg ggcaaggtga gtgggcgggc atgtggggga ggaacgtggg
61  tgggtggatg ggtcaggtgg acactgccct ctcatcctcc cacagggcaa ctttggcagc
121 gtggagctgt gccgctatga ccccctgggg gacaatacgg gacccctggt ggcagtgaaa
181 cagctacagc acagcgggcc agaccagcag agggacttcc agcgggagat tcagatcctt
241 aaggctctgc acagcgactt catcgtcaag taccggggag tcagctatgg gccaggtgag
301 cggcagcagc atctcgggaa cgggttcgag tcccgcttct accctttccc agtagggccc
361 tgttgaacaa ggtcgttaac tcccatgaat cccagcttct atagctggag gttgaacgaa
421 tcaatacacc cagtagaagg t

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

  1. Wu, W., and Sun, X. H. (2012) Janus Kinase 3: The Controller and the Controlled. Acta Biochim Biophys Sin (Shanghai). 44, 187-196.
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsJin Huk Choi, James Butler, and Bruce Beutler