Phenotypic Mutation 'thistle2'

• Allele: thistle2
• Mutation Type: missense
• Chromosome: 8
• Coordinate: 72,138,189 bp (GRCm39)
• Base Change: T ⇒ A (forward strand)
• Gene: Jak3
• Gene Name: Janus kinase 3
• Chromosomal Location: 72,129,027-72,143,221 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Janus kinase (JAK) family of tyrosine kinases involved in cytokine receptor-mediated intracellular signal transduction. It is predominantly expressed in immune cells and transduces a signal in response to its activation via tyrosine phosphorylation by interleukin receptors. Mutations in this gene are associated with autosomal SCID (severe combined immunodeficiency disease). [provided by RefSeq, Jul 2008] ; PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired B cell development, small thymi and T cell proliferate. Point mutation homozygotes develop autoimmune inflammatory bowel disease, decreased susceptibility to malaria infection and/or increased susceptibility to bacterial infection. [provided by MGI curators]
• Mapped: Yes
• Limits of the Critical Region: 71676296 - 71690575 bp
• Amino Acid Change: Valine changed to Aspartic acid
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000060073] [ENSMUSP00000105639] [ENSMUSP00000105640]
• AlphaFold: no structure available at present
• SMART Domains: Protein: ENSMUSP00000060073; Gene: ENSMUSG00000031805; AA Change: V880D

Domain	Start	End	E-Value	Type
B41	20	254	2.2e-42	SMART
SH2	370	460	5.57e-8	SMART
low complexity region	488	503	N/A	INTRINSIC
STYKc	517	773	3.58e-12	SMART
TyrKc	818	1091	4.59e-105	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000051995)
• SMART Domains: Protein: ENSMUSP00000105639; Gene: ENSMUSG00000031805; AA Change: V880D

Domain	Start	End	E-Value	Type
B41	20	254	2.2e-42	SMART
SH2	370	460	5.57e-8	SMART
low complexity region	488	503	N/A	INTRINSIC
STYKc	517	773	3.58e-12	SMART
TyrKc	818	1091	4.59e-105	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000110012)
• SMART Domains: Protein: ENSMUSP00000105640; Gene: ENSMUSG00000031805; AA Change: V880D

Domain	Start	End	E-Value	Type
B41	20	254	2.2e-42	SMART
SH2	370	460	5.57e-8	SMART
low complexity region	488	503	N/A	INTRINSIC
STYKc	517	773	3.58e-12	SMART
TyrKc	818	1091	4.59e-105	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000110013)
• Meta Mutation Damage Score: 0.9728
• Is this an essential gene?: Possibly essential (E-score: 0.664)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-09-04 9:43 PM by Diantha La Vine
• Record Created: 2016-02-18 11:59 PM by Jin Huk Choi
• Record Posted: 2016-04-28
• Science Writers: Anne Murray
• Illustrators: Peter Jurek
• Authors: Jin Huk Choi, James Butler, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_010589; NM_001190830; MGI:99928

Alleles Listed at MGI

All Mutations and Alleles(29) : Chemically induced (ENU)(6) Chemically induced (other)(1) Gene trapped(14) Spontaneous (1) Targeted(5) Transgenic (2)

Phenotypic Description

Figure 1. Homozygous thistle2 mice exhibit diminished T-dependent IgG responses to ovalbumin administered with aluminum hydroxide. IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The thistle2 phenotype among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4231, some of which showed a diminished T-dependent antibody response to ovalbumin (OVA) administered with aluminum hydroxide (OVA/Alum; Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the diminished reduced T-dependent antibody response to OVA/Alum using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 72 mutations (X-axis) identified in the G1 male of pedigree R4231. Normalized phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 72 mutations. The diminished T-dependent antibody response to OVA/Alum was linked to a mutation in Jak3: a T to A transversion at base pair 71,685,545 (v38) on chromosome 8, or base pair 9,163 in the GenBank genomic region NC_000074 encoding Jak3. Linkage was found with a recessive model of inheritance (P = 4.754 x 10^-9), wherein five variant homozygotes departed phenotypically from one homozygous reference mouse and five heterozygous mice (Figure 2).

The mutation corresponds to residue 2,849 in the mRNA sequence NM_010589 within exon 19 of 25 total exons, and to residue 2,849 in the mRNA sequence NM_001190830 within exon 19 of 24 total exons.

9147 CACAGCGACTTCATCGTCAAGTACCGGGGAGTC 874  -H--S--D--F--I--V--K--Y--R--G--V-

Genomic numbering corresponds to NC_000074. The mutated nucleotide is indicated in red.  The mutation results in a valine (V) to aspartic acid (D) substitution at position 880 (V880D) in the JAK3 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.999).

Protein Prediction

Figure 3. Domain structure of JAK3. The thistle2 mutation results in a valine to aspartic acid substitution at position 880. Abbreviations: B41, 4.1, ezrin, radixin, moesin (FERM) homology domain; SH2, Src Homology 2-like. This image is interactive. Other mutations found in JAK3 are noted in red. Click on each mutation for more information.

Jak3 encodes Janus kinase 3 (JAK3). JAK3 has seven different highly conserved JAK homology (JH) regions (JH1-JH7) [Figure 3; reviewed in (1)]. The JH1 region is the kinase domain (amino acids 818-1091), the JH2 domain corresponds to the pseudokinase domain (amino acids 517-773), the JH3 and JH4 regions comprise an Src Homology 2 (SH2)-like domain (amino acids 370-460), and the JH6 and JH7 regions consist of a 4.1, ezrin, radixin, moesin (FERM) homology domain (alternatively, B41 domain; amino acids 20-254). The thistle2 mutation results in a valine (V) to aspartic acid (D) substitution at position 880 (V880D). V880 is within the kinase domain of JAK3.

Please see the record mount_tai for more information about Jak3.

Putative Mechanism

JAK3 binding is restricted to hematopoietic-specific cytokine receptors that have a γ_c receptor subunit (i.e., the IL-2, IL-4, IL-7, IL-9, IL-15, and IL-21 receptors) [reviewed in (1)]. The γ_c receptor-associated cytokines have known functions. For example, IL-7 is necessary for T and B cell development, IL-2 functions in peripheral T cell homeostasis and antigen-driven T-cell expansion, IL-15 functions in natural killer (NK) cell differentiation, IL-4 functions in B-cell maturation and isotype switching (2). JAK3 mutations result in defective γ_c receptor-associated signaling and subsequent defects in lymphocyte development (2;3). Mutations in JAK3 are linked to autosomal recessive T- and NK-cell negative/B-cell positive type of severe combined immunodeficiency [T⁻B⁺NK^- SCID; OMIM: #600802; (4-6); reviewed in (2)]. Patients with T⁻B⁺NK^- SCID do not have T or NK cells, but have normal to elevated numbers of immature nonfunctional B lymphocytes (5;6). Patients with SCID have persistent, recurring infections due to loss of T cell-associated immunity.  Jak3 knockout (Jak3^-/-) mice have reduced numbers of T, B, γδ T, and NK cells (7-11). B cell maturation in the Jak3^-/- mice is blocked at the pre-B stage, leading to a reduced frequency of IgM⁺ B cells (10). The phenotype observed in the thistle2 mice indicates that JAK3^thistle2 exhibits loss of JAK3 function.

Primers

PCR Primer
thistle2_pcr_F: TTAAGTACATCTCTTTGCTGGGC
thistle2_pcr_R: ACCTTCTACTGGGTGTATTGATTC

Sequencing Primer
thistle2_seq_F: GGTGGACACTGCCCTCTCATC
thistle2_seq_R: TTCGTTCAACCTCCAGCTATAGAAG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 441 nucleotides is amplified (chromosome 8, + strand):

1   ttaagtacat ctctttgctg ggcaaggtga gtgggcgggc atgtggggga ggaacgtggg
61  tgggtggatg ggtcaggtgg acactgccct ctcatcctcc cacagggcaa ctttggcagc
121 gtggagctgt gccgctatga ccccctgggg gacaatacgg gacccctggt ggcagtgaaa
181 cagctacagc acagcgggcc agaccagcag agggacttcc agcgggagat tcagatcctt
241 aaggctctgc acagcgactt catcgtcaag taccggggag tcagctatgg gccaggtgag
301 cggcagcagc atctcgggaa cgggttcgag tcccgcttct accctttccc agtagggccc
361 tgttgaacaa ggtcgttaac tcccatgaat cccagcttct atagctggag gttgaacgaa
421 tcaatacacc cagtagaagg t

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Wu, W., and Sun, X. H. (2012) Janus Kinase 3: The Controller and the Controlled. Acta Biochim Biophys Sin (Shanghai). 44, 187-196.

  2. Notarangelo, L. D., Mella, P., Jones, A., de Saint Basile, G., Savoldi, G., Cranston, T., Vihinen, M., and Schumacher, R. F. (2001) Mutations in Severe Combined Immune Deficiency (SCID) due to JAK3 Deficiency. Hum Mutat. 18, 255-263.

  3. Thomis, D. C., and Berg, L. J. (1997) The Role of Jak3 in Lymphoid Development, Activation, and Signaling. Curr Opin Immunol. 9, 541-547.

  4. Candotti, F., Oakes, S. A., Johnston, J. A., Giliani, S., Schumacher, R. F., Mella, P., Fiorini, M., Ugazio, A. G., Badolato, R., Notarangelo, L. D., Bozzi, F., Macchi, P., Strina, D., Vezzoni, P., Blaese, R. M., O'Shea, J. J., and Villa, A. (1997) Structural and Functional Basis for JAK3-Deficient Severe Combined Immunodeficiency. Blood. 90, 3996-4003.

  5. Macchi, P., Villa, A., Giliani, S., Sacco, M. G., Frattini, A., Porta, F., Ugazio, A. G., Johnston, J. A., Candotti, F., and O'Shea, J. J. (1995) Mutations of Jak-3 Gene in Patients with Autosomal Severe Combined Immune Deficiency (SCID). Nature. 377, 65-68.

  6. Russell, S. M., Tayebi, N., Nakajima, H., Riedy, M. C., Roberts, J. L., Aman, M. J., Migone, T. S., Noguchi, M., Markert, M. L., Buckley, R. H., O'Shea, J. J., and Leonard, W. J. (1995) Mutation of Jak3 in a Patient with SCID: Essential Role of Jak3 in Lymphoid Development. Science. 270, 797-800.

  7. Nosaka, T., van Deursen, J. M., Tripp, R. A., Thierfelder, W. E., Witthuhn, B. A., McMickle, A. P., Doherty, P. C., Grosveld, G. C., and Ihle, J. N. (1995) Defective Lymphoid Development in Mice Lacking Jak3. Science. 270, 800-802.

  8. Park, S. Y., Saijo, K., Takahashi, T., Osawa, M., Arase, H., Hirayama, N., Miyake, K., Nakauchi, H., Shirasawa, T., and Saito, T. (1995) Developmental Defects of Lymphoid Cells in Jak3 Kinase-Deficient Mice. Immunity. 3, 771-782.

  9. Baird, A. M., Thomis, D. C., and Berg, L. J. (1998) T Cell Development and Activation in Jak3-Deficient Mice. J Leukoc Biol. 63, 669-677.

  10. Thomis, D. C., Gurniak, C. B., Tivol, E., Sharpe, A. H., and Berg, L. J. (1995) Defects in B Lymphocyte Maturation and T Lymphocyte Activation in Mice Lacking Jak3. Science. 270, 794-797.

  11. Eynon, E. E., Livak, F., Kuida, K., Schatz, D. G., and Flavell, R. A. (1999) Distinct Effects of Jak3 Signaling on Alphabeta and Gammadelta Thymocyte Development. J Immunol. 162, 1448-1459.