Phenotypic Mutation 'jello' (pdf version)
Allelejello
Mutation Type missense
Chromosome11
Coordinate75,441,812 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Wdr81
Gene Name WD repeat domain 81
Synonym(s) MGC32441
Chromosomal Location 75,440,944-75,454,717 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain transmembrane protein, which is predominantly expressed in the brain. Mutations in this gene are associated with autosomal recessive cerebellar ataxia, mental retardation, and dysequilibrium syndrome-2. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit weight loss, tremors, ataxia and an abnormal gait, as well as abnormal mitochondria in Purkinje cell dendrites, Purkinje cell degeneration, photoreceptor cell loss, and decreased total retina thickness. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_138950; MGI:2681828

Mapped Yes 
Amino Acid Change Leucine changed to Proline
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000048704] [ENSMUSP00000104076] [ENSMUSP00000114450] [ENSMUSP00000120812] [ENSMUSP00000134266]
SMART Domains Protein: ENSMUSP00000113939
Gene: ENSMUSG00000045374
AA Change: L1920P

DomainStartEndE-ValueType
Beach 347 589 2.52e-98 SMART
low complexity region 673 704 N/A INTRINSIC
low complexity region 848 874 N/A INTRINSIC
low complexity region 1141 1165 N/A INTRINSIC
low complexity region 1196 1210 N/A INTRINSIC
low complexity region 1566 1587 N/A INTRINSIC
WD40 1630 1669 3.19e-7 SMART
WD40 1679 1716 1.18e2 SMART
WD40 1719 1761 7.36e1 SMART
WD40 1764 1807 3.3e1 SMART
WD40 1810 1848 3.58e-1 SMART
WD40 1893 1934 4.26e1 SMART
Predicted Effect unknown
SMART Domains Protein: ENSMUSP00000120605
Gene: ENSMUSG00000045374
AA Change: L742P

DomainStartEndE-ValueType
low complexity region 1 7 N/A INTRINSIC
low complexity region 23 47 N/A INTRINSIC
low complexity region 78 92 N/A INTRINSIC
low complexity region 448 469 N/A INTRINSIC
WD40 512 551 3.19e-7 SMART
WD40 561 598 1.18e2 SMART
WD40 601 670 3.55e1 SMART
Blast:WD40 673 710 3e-14 BLAST
WD40 715 756 4.26e1 SMART
Predicted Effect unknown
SMART Domains Protein: ENSMUSP00000134266
Gene: ENSMUSG00000045374
AA Change: L1921P

DomainStartEndE-ValueType
Beach 347 589 2.52e-98 SMART
low complexity region 673 704 N/A INTRINSIC
low complexity region 848 874 N/A INTRINSIC
low complexity region 1141 1165 N/A INTRINSIC
low complexity region 1196 1210 N/A INTRINSIC
low complexity region 1566 1587 N/A INTRINSIC
WD40 1630 1669 3.19e-7 SMART
WD40 1679 1716 1.18e2 SMART
WD40 1719 1761 7.36e1 SMART
WD40 1764 1807 3.3e1 SMART
WD40 1810 1848 3.58e-1 SMART
WD40 1893 1934 4.26e1 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000173320)
Phenotypic Category
Phenotypequestion? Literature verified References
behavior/neurological 23595742
Body Weight - decreased
Body Weight (DSS) - decreased 23595742
Body Weight (Male) - decreased
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(8) : Chemically induced(ENU)(1) Chemically induced(other)(1) Endonuclease-mediated(1) Gene trapped(4) Targeted(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01341:Wdr81 APN 11 75445601 missense probably damaging 1.00
IGL02047:Wdr81 APN 11 75445506 missense probably damaging 1.00
IGL02103:Wdr81 APN 11 75444720 missense probably damaging 1.00
IGL02506:Wdr81 APN 11 75444406 missense probably benign 0.44
R1184:Wdr81 UTSW 11 75452983 missense probably damaging 1.00
R1560:Wdr81 UTSW 11 75451623 nonsense probably null
R1680:Wdr81 UTSW 11 75454423 missense probably benign
R1689:Wdr81 UTSW 11 75445596 missense probably damaging 0.99
R2021:Wdr81 UTSW 11 75445962 nonsense probably null
R2104:Wdr81 UTSW 11 75452983 missense probably damaging 1.00
R2113:Wdr81 UTSW 11 75453635 missense probably benign 0.07
R2198:Wdr81 UTSW 11 75446081 missense probably benign 0.00
R2393:Wdr81 UTSW 11 75449405 missense probably damaging 1.00
R2400:Wdr81 UTSW 11 75449035 missense probably benign
R2850:Wdr81 UTSW 11 75451172 missense probably damaging 1.00
R3410:Wdr81 UTSW 11 75452932 missense probably damaging 0.97
R3764:Wdr81 UTSW 11 75452803 missense probably damaging 1.00
R4223:Wdr81 UTSW 11 75448002 missense probably benign 0.00
R4351:Wdr81 UTSW 11 75441812 missense probably damaging 1.00
R4594:Wdr81 UTSW 11 75445794 missense probably benign 0.00
R4601:Wdr81 UTSW 11 75445658 missense probably damaging 1.00
R4647:Wdr81 UTSW 11 75445988 missense probably damaging 0.98
R4651:Wdr81 UTSW 11 75451240 missense probably damaging 0.99
R4652:Wdr81 UTSW 11 75451240 missense probably damaging 0.99
R4930:Wdr81 UTSW 11 75451924 missense probably benign
R4966:Wdr81 UTSW 11 75445949 missense probably benign 0.34
R5075:Wdr81 UTSW 11 75452481 missense probably benign 0.00
R5412:Wdr81 UTSW 11 75450794 missense probably null 1.00
R5426:Wdr81 UTSW 11 75450896 missense possibly damaging 0.87
R5540:Wdr81 UTSW 11 75449070 missense probably damaging 1.00
R5544:Wdr81 UTSW 11 75441797 missense probably damaging 1.00
R5632:Wdr81 UTSW 11 75445906 missense probably damaging 0.99
R5650:Wdr81 UTSW 11 75444748 missense probably damaging 1.00
R5679:Wdr81 UTSW 11 75452923 missense probably damaging 1.00
R5978:Wdr81 UTSW 11 75444398 missense probably damaging 1.00
R6031:Wdr81 UTSW 11 75447869 missense probably damaging 1.00
R6031:Wdr81 UTSW 11 75447869 missense probably damaging 1.00
R6412:Wdr81 UTSW 11 75451163 missense probably benign 0.16
R6479:Wdr81 UTSW 11 75452105 missense possibly damaging 0.92
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice
Repository
Last Updated 2018-12-18 3:14 PM by Anne Murray
Record Created 2016-02-19 1:39 PM by Jamie Russell
Record Posted 2018-12-18
Phenotypic Description
Figure 1. Jello mice exhibit reduced body weights compared to wild-type littermates. Scaled weight data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Jello mice exhibit ataxia.

The jello phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4351, some of which showed reduced body weights compared to wild-type littermates (Figure 1) and ataxia (Figure 2).

Nature of Mutation
Figure 3. Linkage mapping of the reduced body weight phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 40 mutations (X-axis) identified in the G1 male of pedigree R4351. Weight data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 40 mutations. Both of the above anomalies were linked to a mutation in Wdr81: a T to C transition at base pair 75,441,812 (v38) on chromosome 11, or base pair 12,906 in the GenBank genomic region NC_000077 encoding Wdr81. The strongest association was found with a recessive model of inheritance to the body weight phenotype, wherein three variant homozygotes departed phenotypically from six homozygous reference mice and 14 heterozygous mice with a P value of 6.295 x 10-6 (Figure 3).  

 

The mutation corresponds to residue 6,040 in the mRNA sequence NM_138950 within exon 10 of 10 total exons.

 

6025 CCACGAAACGCCACCTCCTGCTGGGCTCGGAC

1916 P--T--K--R--H--L--L--L--G--S--D-

 

The mutated nucleotide is indicated in red.  The mutation results in a leucine (L) to proline (P) substitution at position 1,921 (L1921P) in the WDR81 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction
Figure 4. Domain organization of WDR81. The location of the jello mutation is indicated. Domain information is from SMART and UniProt. Abbreviations: BEACH, Beige and Chediak-Higashi; MFS, major facilitator superfamily

Wdr81 encodes the 1,934-amino acid WD repeat-containing protein 81 (WDR81). WDR81 is a member of the WD repeat protein family. The protein contains an N-terminal BEACH (Beige and Chediak-Higashi) domain (amino acids 335-612), a MFS (major facilitator superfamily) domain, and six C-terminal WD repeats (Figure 4). The function of the BEACH domain is unknown (1). WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by Gly-His and Trp-Asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. WD repeats typically form β-sheets arranged in a seven-bladed β-propeller fold (2). Amino acids 1 to 63 are predicted to form a mitochondrion transit peptide (UniProt). In addition, amino acids 1146 to 1210 are predicted to be a Glu-rich region.

 

The jello mutation results in a leucine to proline substitution at amino acid 1,921, which is located within the sixth WD repeat.

Expression/Localization

WDR81 is highly expressed in Purkinje cells of the cerebellum, retinal photoreceptor cells, brain, and spinal cord (3). WDR81 is also expressed in the liver, spleen, kidney, heart, eye, sciatic nerve, and testis (3;4).

Background
Figure 5. WDR81 is involved in autophagy (left) and endocytosis (right). (left) Schematic showing phagophore and autophagosome formation during autophagy. At the nucleation step, proteins and lipids are recruited to the phagophore. The cargo for selective autophagy is recruited to the inner, concave, surface of the growing phagophore by autophagy receptors that are associated both with the cargo and with lipidated ATG8/LC3 (LC3 II). WDR81 interacts with p62, which interacts with ubiquitin chains attached to cargo as well as to LC3 II attached to inner membrane surface. The phagophore expands and encloses its cargo to form the double-membrane autophagosome. The class III phosphatidylinositol 3-kinase (PI3K) complex with the catalytic subunit Vps34 and the regulatory subunit beclin-1 generates PIP3 at the phagophore. PIP3 is required for the recruitment of WDR81. Fusion of autophagosomes with late endosomes or lysosomes forms autolysosomes where the enclosed cargo is degraded (not shown). (right) WDR81/91 binds Beclin1 to inhibit the VPS34/CORVET/HOPS/PI3K complex, subsequently reducing the levels of PIP3 on the endosomal membrane. PIP3 is required for endosomal maturation.

Members of the WD repeat protein family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. WDR81 functions in endosome maturation and autophagy.

 

Autophagy is a method of degradation that is involved in cellular maintenance and development. In canonical autophagy, a portion of the cytoplasm is sequestered within double-membrane vesicles known as autophagosomes and delivered to the lysosome whereby the contents are degraded. LC3 (microtubule-associated proteins 1A/1B light chain 3) proteins are structural proteins of autophagosomal membranes that function in the formation of the autophagosome. Phosphatidylethanolamine is covalently bound to LC3-I at the forming autophagosomse to generate LC3-II. WDR81 interacts with LC3C (microtubule-associated proteins 1A/1B light chain 3C), subsequently promoting LC3C recruitment to ubiquitinated proteins (5). WDR81 also facilitates the recognition of ubiquitinated proteins by the autophagy cargo receptor p62 (Figure 5, left) (6); loss of WDR81 expression resulted in accumulation of ubiquitinated proteins and p62 (5).

 

WDR81 promotes endosome maturation by interacting with WDR91 and Beclin1 in a complex that inhibits PI3K (see the record for anubis), permitting loss of phosphatidylinositol 3-phosphate and of early to late endosome conversion (Figure 5, right) (6;6;7). WDR81 cooperates with WDR91 to promote the degradation of epidermal growth factor receptor (EGFR; see the record for Velvet) as well as for trafficking and degradation of the viral restriction factor tetherin (BST2/CD317) (7). Tetherin anchors enveloped viruses to host cells and limits viral spread. Loss of WDR81 expression results in tetherin accumulation in enlarged endocytic vesicles, delayed delivery of endocytosed fluid phase cargo to lysosome, and inhibited degradation of EGFR.

 

Mutations in human WDR81 are associated with cerebellar ataxia, mental retardation, and dysequilibrium syndrome-2 (CAMRQ2; OMIM: #610185) (4;8-10). CAMRQ2 patients typically exhibit cerebellar ataxia, intellectual disability, sensorineural hearing loss, and mild cerebellar atrophy (11). A patient with two WDR81 nonsense mutations exhibited microcephaly, respiratory distress, lissencephaly, neonatal seizures, and bilateral ocular proptosis secondary to congenital glaucoma and facial dysmorphisms (12). Fibroblasts from the patients showed increased mitotic index and delayed prometaphase/metaphase transition (13).

 

Homozygous mice for an ENU-induced Wdr81 allele (Wdr81nur5/nur5) exhibited ataxia, tremors, impaired coordination, abnormal gaits, and reduced body weights compared to wild-type controls (3;14). The Wdr81nur5/nur5 mice showed loss of cerebellar granule cells, Purkinje cells, and retinal photoreceptor cells (3).

Putative Mechanism

The neurological phenotypes observed in both humans and mice with WDR81 mutations are putatively caused by defects in mitosis, neuronal proliferation, and/or neuronal survival (3;13;15).

Primers PCR Primer
jello(F):5'- TCTCCCGAGTTTCATGAAGCC -3'
jello(R):5'- AATCCACACCTTTGACCTGTAC -3'

Sequencing Primer
jello_seq(F):5'- ATTCAGGAGCTGTGCAATCC -3'
jello_seq(R):5'- ACACCTTTGACCTGTACGGCAG -3'
Genotyping

Genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the mutation.

 

PCR Primers

ICSI-R4351-jello_PCR_F: 5’- TCTCCCGAGTTTCATGAAGCC-3’

ICSI-R4351-jello_PCR_R: 5’- AATCCACACCTTTGACCTGTAC-3’

 

Sequencing Primers

ICSI-R4351-jello_SEQ_F: 5’- ATTCAGGAGCTGTGCAATCC-3’
 

ICSI-R4351-jello_SEQ_R: 5’- ACACCTTTGACCTGTACGGCAG-3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               hold

 

The following sequence of 401 nucleotides is amplified (NCBI RefSeq: NC_000077, chromosome 11:75441582-75441982):

 

tctcccgagt ttcatgaagc cacttcaagg ctttggagat tcaggagctg tgcaatccca       

gacagcaggc catgtgggta gccagagcct ggggcttgcc tagaagaatc ggcttcgaga      

tcaagaatga ggagcgggcc ctgagagatg tcatctcgcc ctgccctcag ccaactcctg      

gctggcccta tgccaggagg cggatgatgc cattgtccga gcccagcagg aggtggcgtt      

tcgtgggcag caaagccaga ctagtgagcg tgccacggaa gttctcggaa ctgagctttg      

tggtggcctg agagggtggc tcaagcaggg aacagacacc aatcttgttg gctacagtgc      

cggtgaccac ctcgctgccg tacaggtcaa aggtgtggat t

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (Chr. (+) = A>G).

References
  10. Alazami, A. M., Patel, N., Shamseldin, H. E., Anazi, S., Al-Dosari, M. S., Alzahrani, F., Hijazi, H., Alshammari, M., Aldahmesh, M. A., Salih, M. A., Faqeih, E., Alhashem, A., Bashiri, F. A., Al-Owain, M., Kentab, A. Y., Sogaty, S., Al Tala, S., Temsah, M. H., Tulbah, M., Aljelaify, R. F., Alshahwan, S. A., Seidahmed, M. Z., Alhadid, A. A., Aldhalaan, H., AlQallaf, F., Kurdi, W., Alfadhel, M., Babay, Z., Alsogheer, M., Kaya, N., Al-Hassnan, Z. N., Abdel-Salam, G. M., Al-Sannaa, N., Al Mutairi, F., El Khashab, H. Y., Bohlega, S., Jia, X., Nguyen, H. C., Hammami, R., Adly, N., Mohamed, J. Y., Abdulwahab, F., Ibrahim, N., Naim, E. A., Al-Younes, B., Meyer, B. F., Hashem, M., Shaheen, R., Xiong, Y., Abouelhoda, M., Aldeeri, A. A., Monies, D. M., and Alkuraya, F. S. (2015) Accelerating Novel Candidate Gene Discovery in Neurogenetic Disorders Via Whole-Exome Sequencing of Prescreened Multiplex Consanguineous Families. Cell Rep. 10, 148-161.
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsJames Butler, Sara Ludwig, Lauren Prince, Jamie Russell, Bruce Beutler, Zhao Zhang