Phenotypic Mutation 'lomax'

• Allele: lomax
• Mutation Type: missense
• Chromosome: 17
• Coordinate: 57,709,811 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Adgre1
• Gene Name: adhesion G protein-coupled receptor E1
• Synonym(s): DD7A5-7, EGF-TM7, Emr1, Ly71, F4/80, TM7LN3
• Chromosomal Location: 57,665,691-57,790,527 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has a domain resembling seven transmembrane G protein-coupled hormone receptors (7TM receptors) at its C-terminus. The N-terminus of the encoded protein has six EGF-like modules, separated from the transmembrane segments by a serine/threonine-rich domain, a feature reminiscent of mucin-like, single-span, integral membrane glycoproteins with adhesive properties. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012] ; PHENOTYPE: Homozygous null mice fail to develop peripheral tolerance after inoculation with antigen because of a lack of efferent regulatory T cell development. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Tyrosine changed to Cysteine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000004850] [ENSMUSP00000083971]
• AlphaFold: Q61549
• SMART Domains: Protein: ENSMUSP00000004850; Gene: ENSMUSG00000004730; AA Change: Y156C

Domain	Start	End	E-Value	Type
low complexity region	19	32	N/A	INTRINSIC
EGF	35	80	1.43e-1	SMART
EGF_CA	81	122	3.59e-7	SMART
EGF_CA	133	172	4.56e-9	SMART
EGF_CA	173	221	1.29e-8	SMART
EGF_CA	222	271	2.31e-10	SMART
EGF_CA	272	318	1.06e-9	SMART
EGF_CA	319	367	1.18e-7	SMART
GPS	591	641	2.57e-19	SMART
Pfam:7tm_2	644	885	2.1e-63	PFAM

• Predicted Effect: unknown
• SMART Domains: Protein: ENSMUSP00000083971; Gene: ENSMUSG00000004730; AA Change: Y156C

Domain	Start	End	E-Value	Type
low complexity region	19	32	N/A	INTRINSIC
EGF	35	80	1.43e-1	SMART
EGF_CA	81	122	3.59e-7	SMART
EGF_CA	133	172	4.56e-9	SMART
EGF_CA	173	221	1.29e-8	SMART
EGF_CA	222	271	2.31e-10	SMART
EGF_CA	272	318	1.06e-9	SMART
EGF_CA	319	367	1.18e-7	SMART
GPS	591	641	2.57e-19	SMART
Pfam:7tm_2	644	885	2.1e-63	PFAM

• Predicted Effect: unknown
• Meta Mutation Damage Score: 0.4177
• Is this an essential gene?: Probably nonessential (E-score: 0.188)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2021-11-01 7:45 AM by Diantha La Vine
• Record Created: 2016-02-28 10:07 AM by Bruce Beutler
• Record Posted: 2016-04-28
• Science Writers: Anne Murray
• Illustrators: Peter Jurek
• Authors: Xue Zhong, Ming Zeng, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_010130; MGI:106912

Alleles Listed at MGI

All Mutations and Alleles(5) : Chemically induced (ENU)(2) Targeted(3)

Phenotypic Description

Figure 1. Lomax mice exhibited decreased frequencies of peripheral macrophages. Flow cytometric analysis of peripheral blood was utilized to determine macrophage frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The lomax phenotype was initially identified among G3 mice of the pedigree R4190, some of which showed a reduction in the frequency of F4/80+ macrophages in the peripheral blood (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced frequency of peripheral macrophages using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 47 mutations (X-axis) identified in the G1 male of pedigree R4190. Normalized phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 47 mutations. The reduction in frequency of F4/80+ macrophages was linked by continuous variable mapping to a mutation in Emr1 (alternatively, Adgre1):  an A to G transition at base pair 57,402,811 (v38) on chromosome 17, or base pair 44,161 in the GenBank genomic region NC_000083 encoding Emr1. Linkage was found with a recessive model of inheritance (P = 1.284 x 10^-6), wherein 4 variant homozygous departed phenotypically from 16 homozygous reference mice and 20 heterozygous mice (Figure 2).

The mutation corresponds to residue 507 in the mRNA sequence NM_010130 within exon 5 of 22 total exons.

491 AACTCTGTGGGAAGCTACAGCTGTACCTGTCAA 151 -N--S--V--G--S--Y--S--C--T--C--Q-

The mutated nucleotide is indicated in red.  The mutation results in a tyrosine (Y) to cysteine (C) substitution at position 156 (Y156C) in the F4/80 protein.

Protein Prediction

Emr1 encodes the F4/80 glycoprotein, which is a cell surface receptor that contains seven transmembrane (TM7) domains (Figure 3). F4/80 is a member of the B2 class of TM7 receptors, which are characterized by a long N-terminal extracellular region. Following a signal peptide, the extracellular N-terminal third of F4/80 (amino acids 32-367) contains seven tandem EGF-like domains (1), approximately 50 amino acids in length and characterized by the presence of six cysteine residues positioned to form three disulfide bonds within each domain. The EGF-like domains mediate protein-protein interactions. Five of the seven EGF-like domains of F4/80 contain consensus Ca²⁺-binding motifs. The C-terminal third of F4/80 (amino acids ~645-931) contains seven transmembrane segments, three extracellular loops, and three intracellular loops, with the C-terminus of the protein located intracellularly. Between the EGF-like domains at the N-terminus and the TM7 structure at the C-terminus, the middle third, or stalk region, of F4/80 has no significant similarity to other known protein domains. This portion of the protein (amino acids ~399-642) contains 4 potential N-glycosylation sites and 47 potential O-glycosylation sites (i.e. approximately 20% serine/threonine content). The lomax mutation results in substitution of tyrosine 156 to a cysteine; amino acid 156 is within the extracellular N-terminal tail of F4/80 (amino acids 32-367), more specifically within the third EGF-like domain (amino acids 133-172).

Please see the record for F4/80 for more information about Emr1.

Putative Mechanism

F4/80 is best known as a macrophage-specific marker. The physiological function of F4/80 has only begun to be investigated, and evidence of its function remains sparse. F4/80^-/- mice are healthy and fertile, and display no gross abnormalities or phenotypes (2;3). Histological analysis showed that immune tissues appear normal, and flow cytometric analysis demonstrated normal populations of B and T cells. Furthermore, F4/80^-/- macrophage development, as determined by examination of expression profiles of several macrophage-restricted cell surface proteins, is comparable to that of wild type mice. F4/80^-/- macrophages phagocytose target cells normally, and produce normal levels of nitric oxide and cytokines stimulated by lipopolysaccharide (LPS) or IFN-γ (2).  F4/80^-/- mice (and the ENU-induced Emr1^F4/80/F4/80 mutants) also display normal resistance to infection by Listeria monocytogenes (3). This finding contrasts with previous work demonstrating that treatment with anti-F4/80 mAb impairs splenic macrophage production of tumor necrosis factor (TNF)-α and interleukin (IL)-12 induced by exposure to heat-killed Listeria (4). However, whether Listeria infection modulates the expression of F4/80 is unknown, as is the molecular effect of anti-F4/80 mAb treatment on cells. F4/80 protein and mRNA expression have not been examined in lomax mice; however, the lomax mutation is proposed to alter the protein-protein interactions between F4/80 and an unidentified protein, subsequently leading to the phenotype observed in the FACS screen.

Primers

PCR Primer
lomax_pcr_F: AGTTTGGATAATTTTCTCTGCGCAG
lomax_pcr_R: GTGATACACAAGTTGGGCCTC

Sequencing Primer
lomax_seq_F: TGCGCAGGTAATATCCTCAG
lomax_seq_R: TCCTCAGAGGAGAAGATGGTG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 435 nucleotides is amplified (chromosome 17, + strand):

1   agtttggata attttctctg cgcaggtaat atcctcaggc tctctgccac aggtctttgg
61  tggtcagcac acagcacata gttcactcac tctcttttac tgccctgcag atgttgatga
121 gtgtctgaca attgggatct gccctaagta ttccaactgc tctaactctg tgggaagcta
181 cagctgtacc tgtcaaccag gctttgtctt gaatggctcc atttgtgaag gtttgcaaca
241 cctggtcctt gcaatttttc tttttttttc ttatttattt atttatttat ttatttattt
301 atttatttat ttatttattc tatttatatc ccaatatcag ttcctctatt ccccccagtc
361 attctcttac acagctcctc cctctattcc accatcttct cctctgagga ggcagaggcc
421 caacttgtgt atcac

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. McKnight, A. J., Macfarlane, A. J., Dri, P., Turley, L., Willis, A. C., and Gordon, S. (1996) Molecular Cloning of F4/80, a Murine Macrophage-Restricted Cell Surface Glycoprotein with Homology to the G-Protein-Linked Transmembrane 7 Hormone Receptor Family. J Biol Chem. 271, 486-489.

  2. Lin, H. H., Faunce, D. E., Stacey, M., Terajewicz, A., Nakamura, T., Zhang-Hoover, J., Kerley, M., Mucenski, M. L., Gordon, S., and Stein-Streilein, J. (2005) The Macrophage F4/80 Receptor is Required for the Induction of Antigen-Specific Efferent Regulatory T Cells in Peripheral Tolerance. J Exp Med. 201, 1615-1625.

  3. Schaller, E., Macfarlane, A. J., Rupec, R. A., Gordon, S., McKnight, A. J., and Pfeffer, K. (2002) Inactivation of the F4/80 Glycoprotein in the Mouse Germ Line. Mol Cell Biol. 22, 8035-8043.

  4. Warschkau, H., and Kiderlen, A. F. (1999) A Monoclonal Antibody Directed Against the Murine Macrophage Surface Molecule F4/80 Modulates Natural Immune Response to Listeria Monocytogenes. J Immunol. 163, 3409-3416.