Phenotypic Mutation 'anubis' (pdf version)
List |< first << previous [record 17 of 511] next >> last >|
Alleleanubis
Mutation Type nonsense
Chromosome13
Coordinate101,702,776 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Pik3r1
Gene Name phosphatidylinositol 3-kinase, regulatory subunit, polypeptide 1 (p85 alpha)
Synonym(s) p55alpha, p85alpha, PI3K, p50alpha
Chromosomal Location 101,680,563-101,768,217 bp (-)
MGI Phenotype Homozygotes for a targeted null mutation exhibit perinatal lethality associated with hepatic necrosis, chylous ascites, enlarged muscle fibers, calcification of cardiac tissue, and hypoglycemia. Mutants lacking only the major isoform are immunodeficient.
Accession Number

NCBI RefSeq: NM_001024955 (variant 1), NM_001077495 (variant 2); MGI:97583

Mapped Yes 
Amino Acid Change Tyrosine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000056774]
SMART Domains Protein: ENSMUSP00000056774
Gene: ENSMUSG00000041417
AA Change: Y189*

DomainStartEndE-ValueType
SH3 6 78 2.81e-11 SMART
low complexity region 79 99 N/A INTRINSIC
RhoGAP 126 298 1.94e-37 SMART
low complexity region 303 314 N/A INTRINSIC
SH2 331 414 9.96e-28 SMART
Pfam:PI3K_P85_iSH2 431 599 7.8e-67 PFAM
SH2 622 704 7.33e-26 SMART
Predicted Effect probably null
Phenotypic Category decrease in B cells, decrease in B:T cells, decrease in B1a cells in B1 cells, decrease in IgD+ B cells, decrease in IgM+ B cells, increase in CD4+ T cells, increase in CD8+ T cells, increase in IgE response to a Cysteine Protease (Papain), increase in OVA-specific IgE, increase in T cells
Penetrance 1/1 
Alleles Listed at MGI

All Mutations and Alleles(28) : Gene trapped(20) Targeted(8)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Pik3r1 APN 13 101690536 missense probably benign 0.00
IGL00484:Pik3r1 APN 13 101701747 missense probably benign 0.37
IGL00911:Pik3r1 APN 13 101757661 splice site noncoding transcript
IGL01620:Pik3r1 APN 13 101686220 missense probably damaging 1.00
IGL01872:Pik3r1 APN 13 101689117 missense probably benign 0.02
IGL02544:Pik3r1 APN 13 101687276 missense probably damaging 1.00
IGL02959:Pik3r1 APN 13 101757529 missense probably benign 0.00
Rocket UTSW 13 101689444 missense
R0635:Pik3r1 UTSW 13 101757418 missense probably benign 0.00
R0751:Pik3r1 UTSW 13 101686358 missense probably damaging 1.00
R0787:Pik3r1 UTSW 13 101690523 missense probably benign 0.30
R0845:Pik3r1 UTSW 13 101686264 missense probably benign 0.45
R0891:Pik3r1 UTSW 13 101701466 missense probably benign 0.00
R1066:Pik3r1 UTSW 13 101688663 missense probably damaging 1.00
R1184:Pik3r1 UTSW 13 101686358 missense probably damaging 1.00
R1735:Pik3r1 UTSW 13 101686374 missense probably damaging 1.00
R2474:Pik3r1 UTSW 13 101702776 nonsense probably null
R3015:Pik3r1 UTSW 13 101687263 missense probably damaging 1.00
R3419:Pik3r1 UTSW 13 101692215 missense probably benign 0.17
R3876:Pik3r1 UTSW 13 101684957 missense probably benign 0.01
R3964:Pik3r1 UTSW 13 101688685 missense possibly damaging 0.75
R4175:Pik3r1 UTSW 13 101701732 missense probably damaging 1.00
R4175:Pik3r1 UTSW 13 101701733 missense probably benign 0.25
R4422:Pik3r1 UTSW 13 101694384 missense probably benign
R4623:Pik3r1 UTSW 13 101692262 missense noncoding transcript
R4890:Pik3r1 UTSW 13 101757610 missense probably damaging 1.00
R5038:Pik3r1 UTSW 13 101689444 missense probably damaging 1.00
R5117:Pik3r1 UTSW 13 101692236 missense probably benign
R5972:Pik3r1 UTSW 13 101757282 missense noncoding transcript
Mode of Inheritance Autosomal Recessive
Local Stock Sperm, gDNA
Repository
Last Updated 12/08/2016 10:05 AM by Katherine Timer
Record Created 02/28/2016 5:35 PM
Record Posted 11/11/2016
Phenotypic Description

Figure 1. Anubis mice exhibit reduced B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Anubis mice exhibit reduced frequencies of peripheral blood B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Anubis mice exhibit reduced frequencies of peripheral blood B1a cells in B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1a cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Anubis mice exhibit a reduced percentage of peripheral blood IgD+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Anubis mice exhibit reduced frequencies of peripheral blood IgM+ cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Anubis mice exhibit increased frequencies of peripheral blood T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Anubis mice exhibit increased frequencies of peripheral blood CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 8. Anubis mice exhibit increased frequencies of peripheral blood CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The anubis phenotype was identified among G3 mice of the pedigree R2474, some of which showed a decrease in the B to T cell ratio (Figure 1) due to a decrease in the frequency of total B cells (Figure 2), B1a cells in B1 cells (Figure 3), IgD+ B cells (Figure 4), and IgM+ B cells (Figure 5) with a concomitant increase in the frequency of total T cells (Figure 6), including CD4+ T cells (Figure 7) and CD8+ T cells (Figure 8), all in the peripheral blood.

Nature of Mutation

Figure 9. Linkage mapping of the increased frequency of peripheral blood T cells using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 31 mutations (X-axis) identified in the G1 male of pedigree R2474. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 31 mutations. All of the above anomalies were linked by continuous variable mapping to two mutations on chromosome 13 in genes Pik3r1 and Parp8. The mutation in Pik3r1 is presumed to be causative as mutations in Pik3r1 cause immunodeficiency in the mouse [see MGI for a list of Pik3r1 alleles; (1;2)]. The Pik3r1 mutation is a T to A transversion at base pair 101,702,776 (v38) on chromosome 13, or base pair 65,442 in the GenBank genomic region NC_000079 encoding Pik3r1. The strongest association was found with a recessive model of linkage to the normalized frequency of total T cells in the peripheral blood, wherein one variant homozygote departed phenotypically from four homozygous reference mice and seven heterozygous mice with a P value of 2.379 x 10-7 (Figure 9). 

 

The mutation corresponds to residue 1,188 in the mRNA sequence NM_001077495 within exon 5 of 16 total exons.

 

1171 GATGCTTTCAAACGCTATCTCGCCGACTTACCA (variant 2; NM_001077495)

184  -D--A--F--K--R--Y--L--A--D--L--P- (isoform 2; NP_001070963)

 

The mutated nucleotide is indicated in red.  The mutation results in a substitution of tyrosine 189 to a premature stop codon (Y189*) in the p85α protein; p55α and p50α are not affected.

Protein Prediction
Figure 10. Domain structures of p85 isoforms. Pik3r1 encodes p85α, p55α and p50α. Common to all isoforms are the presence of two C-terminal SH2 domains flanking a p110-binding domain (iSH2). The smaller isoforms differ at their N-terminus and contain a unique 35-amino-acid (p55α) or five-amino-acid (p50α) sequence. Unique to the larger isoforms are the N-terminal SH3 domain, RhoGAP domain and two proline-rich regions. The anubis mutation results in a substitution of tyrosine 189 to a premature stop codon (Y189*) in the p85α protein.

Pik3r1 encodes p85α, a regulatory subunit of class IA phosphatidylinositol 3-kinases (PI3Ks). To form a functional class I PI3K, a p110 catalytic subunit forms a heterodimer with a p85 regulatory subunit (3;4). There are three class IA p110 subunits (p110α, p110β, and p110δ [see the record for stinger]) encoded by Pik3ca, Pik3cb, and Pik3cd, respectively, and one class IB p110 subunit, p110γ (encoded by Pik3cg). Five class IA regulatory subunits are encoded by three distinct genes (Pik3r1 (p85α, p55α, p50α), Pik3r2 (p85β) and Pik3r3 (p55γ); p85α, p55α, and p50α are splice variants of Pik3r1 (Figure 10) (5-7). In activated cells, the p85 subunit recruits the p110 subunit to the plasma membrane and activates it (7-9). Conversely, the p85 subunit also inhibits the enzymatic activity of the p110 subunit in quiescent cells (10). The p85 subunits also mediate the interactions of the PI3Ks with the cytoplasmic domains of receptors as well as with adaptor proteins (11). p85α has several binding partners that mediate several functions, including PI3K activation, cell signaling, and cell adhesion. For a comprehensive list of p85α binding partners see Table 1 in (12).

 

The p55α and p50α isoforms have two SH2 (Src homology 2) domains [nSH2 (N-terminal SH2 domain) and cSH2 (C-terminal SH2 domain)] and a p110-binding domain [iSH2 (inter SH2 domain)]. The splicing of the two variants is the same, but the p55α isoform is two amino acids longer than p50α (13). The nSH2 and cSH2 domains bind to pYxxM motifs (where pY is phosphorylated tyrosine) on several proteins namely activated receptor tyrosine kinases (e.g., PDGFR and EGFR) and adaptor proteins (e.g., (e.g. IRS-1 (14), Grb2, Gab1/2 (GRB2-associated binding protein 2) (15), Shc (16), Crk-L (17) and β-catenin (18)). The interactions between p85α and these proteins derepresses p110 activity and promtes the localization of p85—p110 to the plasma membrane. In addition to binding the p110 subunit, the iSH2 domain binds α/β- and γ-tubulins, which function in vesicle trafficking (α/β-tubulin) and in the microtubule-organizing center in centrosomes (γ-tubulin) (19). The interaction between p85α and the tubulins is proposed to regulate budding or vesicle fusion.

 

The p85α isoform has the nSH2, cSH2, and iSH2 domains, but also has a SH3 domain at the N-terminus (amino acids 6-78) and a RhoGAP domain (amino acids 126-298). Between the SH3 and RhoGAP domain and between the RhoGAP and nSH2 domain are proline-rich regions. The SH3 domain binds proline-rich target sequences (e.g., PxxP motifs). p85α can interact with other p85α proteins through the SH3 domains to form homodimers (20). The formation of p85α homodimers is proposed to mask the SH3, proline-rich, and RhoGAP domains until the dimer is disrupted. The interaction between the p85α SH3 domain and its target proteins regulates PI3K activity (21;22), and can also couple CD28 receptor endocytosis with actin polymerization (23). The p85α proline-rich regions bind to the SH3 domains of several target proteins, including Grb2 (24), Crk (25), α-actinin (26), Abl, and the Src family kinases (27-29). The RhoGAP domain shares homology with GAP domains in the Rac/Rho/Cdc42 family of GTPases, which regulate actin dynamics in cell migration, cytokinesis, and vesicle trafficking (30). GAP proteins stimulate GTP hydrolysis of G proteins to switch them from an active GTP-bound conformation to an inactive GDP-bound state. p85α binds to the GTP forms of Rac1 and Cdc42, leading to PI3K activation, but p85α does not exert GAP activity at physiological levels in the cell (31;32). p85α has GAP activity towards Rab4 and Rab5 (33;34); Rab4 and Rab5 are GTPases that regulate receptor tyrosine kinase trafficking (35). The RhoGAP domain of p85α binds and positively regulates PTEN, a phosphatase that negatively regulates PI3K activity (36). PTEN dephosphorylates PtdIns(3,4,5)P3 lipids at the 3-position to prevent further activation of downstream Akt signaling.

 

p85α undergoes several posttranslational modifications including phosphorylation. The p110 subunit can phosphorylate p85α on Ser608, subsequently reducing p85-p110 activity (37). p85α is also phosphorylated on Ser83 by protein kinase A (PKA), leading to increased PI3K-mediated Ras binding and PI3K activation (38). Tyr688 is phosphorylated by Abl and Src family tyrosine kinases, which putatively alters the SH2 binding properties of p85α and reduces the inhibition of p85α on p110, subsequently resulting in PI3K activation (39;39;40;40). Tyr508 is phosphorylated by the PDGFR (41) and in response to IL-8 and/or GM-CSF. The affect of Tyr508 phosphorylation is unknown. p85α is dephosphorylated by SHP-1 and CD148 (39;42). p85α can be ubiquitinated by Cbl-b. p85α ubiquitination does not induce p85α degradation, but prevents p85α recruitment to the T cell receptor co-receptor, CD28 (43).

The anubis mutation results in a substitution of tyrosine 189 to a premature stop codon (Y189*) within the RhoGAP domain.

Expression/Localization

Pik3r1 is ubiquitously expressed in the mouse (BioGPS). The p85α and p50α mRNAs are most abundant in the liver, and the p85α, p55α, and p50α mRNAs is also highly expressed in the brain and kidney (13). The p85α protein was highly expressed in every rat tissue examined (6;13). The p55α and p50α proteins were highly expressed in the brain, liver, and kidney; p55α, and p50α were expressed at low levels in fat and muscle (13).

Background
Figure 11. PI3K mediates several cell functions. After stimulation, PI3Kδ is recruited to the inner face of the plasmaplasma membrane, where it generates phosphatidylinositol-3,4,5-trisphosphate (PtdIns(3,4,5)P3) by direct phosphorylation of phosphatidylinositol-4,5-bisphosphate (PtdIns(4,5)P2). PI3Kδ binds directly or indirectly to receptors through an interaction of the regulatory subunit (p85) with tyrosine-phosphorylated recognition motifs on the receptor cytoplasmic domains or soluble adaptor proteins such as GAB2 (GRB2-associated binding protein 2). Activation of PI3Kδ leads to the generation of PtdIns(3,4,5)P3, which serves as a docking platform for downstream proteins such as AKT. Subsequently, phosphorylating events and protein–protein interactions of downstream targets controls multiple biological processes. PTK, protein tyrosine kinase.

PI3Ks are highly conserved lipid signaling kinases. The PI3Ks are divided into class I, II, or III based on their molecular structure, regulation, and in vivo substrate specificities [reviewed in (11;44)]. Class I PI3Ks include class IA and class IB PI3K subclasses; class IA PI3Ks are typically activated downstream of tyrosine kinase-linked receptors, while class IB PI3Ks are activated downstream of G protein-coupled receptors [reviewed in (11)].

 

After cell stimulation by growth factors, hormones, cytokines, or antigens, the PI3Ks are recruited to the inner face of the plasma membrane where they phosphorylate phosphatidylinositol (PtdIns), PtdIns 4-phosphate, and/or PtdIns-4,5-bisphosphate (PtdIns(4,5)P2; PIP2) at the D3 position of the inositol ring, generating their respective D3’ phosphorylated derivatives [e.g., PIP2 phosphorylation generates the second messenger phosphatidylinositol-3,4,5-trisphosphate (PtdIns(3,4,5)P3; PIP3); (4;45); reviewed in (11;44); Figure 11].  PIP3 recruits downstream signaling proteins to the plasma membrane including the serine-threonine kinases Akt (alternatively, protein kinase B [PKB]) and phosphoinositide-dependent kinase 1 (PDK1) as well as Tec family tyrosine kinases and exchange factors that regulate heterotrimeric guanosine triphosphate (GTP)-binding proteins such as Vav, PLCγ1, and PLCγ2 (see the record for queen) [(4); reviewed in (11;44)]. Subsequently, activation of downstream targets (e.g., Rac1, p21-activated kinase 1 [PAK1], MEK, ERK1, and ERK2) mediates several cellular processes including growth, proliferation, differentiation, survival, apoptosis, adhesion, and migration [(46); reviewed in (44)]. PI3K-associated signaling can be antagonized by PTEN (phosphatase and tensin homologue deleted on chromosome 10) and SHIP (SH2-containing inositol phosphatase), lipid phosphatases that dephosphorylate PIP3 on the D3 and D5 positions, respectively [reviewed in (47)]. For more information on the PI3K signaling pathway, please see the record for sothe and stinger.

 

PIK3R1 mutations are linked to immunodeficiency-36 (IMD36; OMIM: #616005; (48)), agammalobulinemia-7 (AGM7; OMIM: #615214; (49)), and SHORT (Short stature, Hyperextensible joints, Ocular depression, Rieger anomaly, and Teeth delay) syndrome (OMIM: #269880; (50;51)). Patients with IMD36 exhibited recurrent respiratory infections and bacterial infections (48). None of the patients had symptoms of allergy, autoimmunity, splenomegaly, or lymphadenopathy (48). The patients had decreased numbers of naïve CD4+ and CD8+ T cells; one patient had decreased numbers of memory B cells (48). All IMD36 patients exhibited impaired B cell function with hypogammaglobulinemia (48). A patient with AGM7 exhibited defects in early B cell development and developed juvenile idiopathic arthritis, erythema nodosum, and inflammatory bowel disease (49). Patients with SHORT syndrome exhibit a range of clinical phenotypes (see the description of the acryonym). PIK3R1 mutations are observed at high frequency (20%) in endometrial cancer (52).

 

Pik3r1-deficient (Pik3r1-/-) mice exhibit perinatal lethality by postnatal day 7 (53;54). The Pik3r1-/- mice had hepatocyte necrosis, chylous ascites, enlarged skeletal muscle fibers, brown fat necrosis, and cardiac tissue calcification. Mice with selective deletion of p85α (p85α-/-) are viable (55). The p85α-/- mice have increased expression of the p55α and p50α isoforms. In the p85α-/- mice, the p50α can bind p110 to partially compensate for the loss of p85α (55). The Pik3r1-/- and p85α-/- mice have increased glucose uptake and insulin sensitivity (53;55). Mice with selective deletion of the p55α and p50α isoforms (p55α/p50α-/-) are viable and maintain normal blood glucose levels, but have lower fasting insulin levels (56). The p55α/p50α-/- mice exhibited increased insulin sensitivity and increased insulin-stimulated glucose transport in extensor digitorum longus muscle tissues and adipocytes.

Putative Mechanism

Pik3r1-/- chimeric mice (using a Rag2-deficient blastocyst complementation system) had reduced numbers of peripheral blood mature B cells and reduced serum levels of IgM, IgG1, IgG2a, IgG3, and IgA (54). The remaining B cells exhibited reduced proliferative responses after exposure to anti-IgM, anti-CD40, and lipopolysaccharide; T cell development and proliferative responses were normal. The anubis mice exhibited defects in T cell development similar to patients with IMD36 (48), but in contrast to the Pik3r1-/- chimeric mice (54). The immune phenotypes in the anubis mice indicate that the p85αanubis exhibits loss-of-function. Some PI3K function may be rescued by the expression of intact p55α and p50α in the anubis mice. Intact p55 and p50 should be present precluding the prescence of metabolic effects described previously.

Primers PCR Primer
anubis(F):5'- TTCTCACTTGGGCAGGCTTC -3'
anubis(R):5'- GTCAGTGTGCCATGCTTCTG -3'

Sequencing Primer
anubis_seq(F):5'- CAATAGGGTGTCTTCTATCAGATGC -3'
anubis_seq(R):5'- CAGTGTGCCATGCTTCTGTTCTG -3'
References
Science Writers Anne Murray
Illustrators Peter Jurek, Katherine Timer
AuthorsJeff SoRelle, Tao Yue, Ming Zeng, Xue Zhong, Bruce Beutler
List |< first << previous [record 17 of 511] next >> last >|