Phenotypic Mutation 'candle'

• Allele: candle
• Mutation Type: missense
• Chromosome: 6
• Coordinate: 124,728,419 bp (GRCm38)
• Base Change: T ⇒ C (forward strand)
• Gene: Ptpn6
• Gene Name: protein tyrosine phosphatase, non-receptor type 6
• Synonym(s): Hcph, hcp, SHP-1, Ptp1C
• Chromosomal Location: 124,720,707-124,738,714 bp (-)
• MGI Phenotype: Homozygous mutants are immunodeficient and autoimmune and exhibit neutrophilic skin lesions that disrupt hair follicles and give the motheaten appearance. Alleles vary in severity, with death occurring at 6-9 weeks postnatally due to severe pneumonitis.
• Mapped: Yes
• Amino Acid Change: Aspartic acid changed to Glycine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000108103]
• SMART Domains: Protein: ENSMUSP00000108103; Gene: ENSMUSG00000004266; AA Change: D222G

Domain	Start	End	E-Value	Type
SH2	2	85	4.05e-28	SMART
SH2	108	200	1.45e-29	SMART
PTPc	243	517	7.51e-131	SMART
low complexity region	569	579	N/A	INTRINSIC

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
  (Using ENSMUST00000112484)
• Phenotypic Category: decrease in B cells, decrease in B2 cells, decrease in IgD+ B cells, decrease in IgM+ B cells, increase in B1 cells, increase in B1a cells, increase in B1a cells in B1 cells, increase in B1b cells, increase in CD11c+ DCs, increase in CD44 MFI in CD8, increase in macrophages
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 06/02/2016 3:10 PM by Anne Murray
• Record Created: 03/04/2016 6:05 AM by Bruce Beutler
• Record Posted: 06/02/2016
• Science Writers: Anne Murray
• Illustrators: Peter Jurek
• Authors: Xue Zhong, Ming Zeng, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_013545 (variant 1), NM_001077705 (variant 2); MGI:96055

Alleles Listed at MGI

All Mutations and Alleles(16) : Chemically induced (ENU)(4) Gene trapped(3) Spontaneous (4) Targeted(5)

Phenotypic Description

Figure 1. Candle mice exhibit decreased frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Candle mice exhibit decreased frequencies of peripheral B2 cells. Flow cytometric analysis of peripheral blood was utilized to determine B2 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Candle mice exhibit a decreased percentage of peripheral IgD+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgD+ B cell percentage. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Candle mice exhibit decreased frequencies of peripheral IgM+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgM+ B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Candle mice exhibit increased frequencies of peripheral B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Candle mice exhibit increased frequencies of peripheral B1a cells. Flow cytometric analysis of peripheral blood was utilized to determine B1a cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 7. Candle mice exhibit increased frequencies of peripheral B1a cells in B cells. Flow cytometric analysis of peripheral blood was utilized to determine B1a cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 8. Candle mice exhibit increased frequencies of peripheral B1b cells. Flow cytometric analysis of peripheral blood was utilized to determine B1b cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 9. Candle mice exhibit increased frequencies of peripheral CD11c+ dendritic cells. Flow cytometric analysis of peripheral blood was utilized to determine CD11c+ dendritic cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 10. Candle mice exhibit increased frequencies of peripheral macrophages. Flow cytometric analysis of peripheral blood was utilized to determine macrophage frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 11. Candle mice exhibit increased CD44 mean fluorescence intensity on peripheral CD8 + T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD8 + T MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The candle phenotype was identified among G3 mice of the pedigree R4082, some of which showed a decrease in the frequency of B cells (Figure 1), B2 cells (Figure 2), the percentage of IgD+ B cells (Figure 3), and the frequency of IgM+ B cells (Figure 4) with a concomitant increase in the frequency of B1 cells (Figure 5), B1a cells (Figure 6), B1a cells in B cells (Figure 7), B1b cells (Figure 8), CD11c+ dendritic cells (Figure 9), and macrophages (Figure 10) as well as an increase in the CD44 mean fluorescence intensity on CD8⁺ T cells (Figure 11), all in the peripheral blood.

Nature of Mutation

Figure 12. Linkage mapping of the increased frequency of peripheral blood IgM+ B cells using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 68 mutations (X-axis) identified in the G1 male of pedigree R4082. Normalized phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 68 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Ptpn6:  an A to G transition at base pair 124,728,419 (v38) on chromosome 6, or base pair 10,291 in the GenBank genomic region NC_000072 encoding Ptpn6.  The strongest association was found with a recessive model of linkage to the normalized frequency of peripheral blood IgM+ B cells, wherein seven variant homozygotes departed phenotypically from 11 homozygous reference mice and 17 heterozygous mice with a P value of 1.603 x 10^-8 (Figure 12).  A substantial semidominant effect was observed in most of the assays but the mutation is preponderantly recessive, and in no assay was a purely dominant effect observed. 

 

The mutation corresponds to residue 866 in the mRNA sequence NM_013545 within exon 6 of 16 total exons and residue 868 in the mRNA sequence NM_001077705 within exon 6 of 16 total exons.

10275 CGGGTAAACGCAGCTGACATTGAGAATCGGGTC 211   -R--V--N--A--A--D--I--E--N--R--V- (variant 1) 219   -R--V--N--A--A--D--I--E--N--R--V- (variant 2)

 

Genomic numbering corresponds to NC_000072. The mutated nucleotide is indicated in red.  The mutation results in an aspartic acid (D) to glycine (G) substitution at position 219 (D219G) in variant 1 and D224G in variant 2 of the SHP1 protein.

Protein Prediction

Figure 13. Domain structure of SHP1. The position of the candle mutation is indicated. Click on the image to view other mutations found in SHP1 (red). Click on the mutations for more specific information.

Ptpn6 encodes SHP1, a Src-homology 2 (SH2) domain-containing cytoplasmic protein tyrosine phosphatase. SHP1 has 4 isoforms. Three isoforms of SHP1 contain variations in their N-termini; the fourth isoform is a longer form with an extended C-terminus. SHP1 contains two tandem N-terminal SH2 domains (residues 1-108 and 116-208), a central catalytic domain (residues 270-532), and a C-terminal tail (Figure 13) [(1), discussed in (2)]. The C-terminal tail contains multiple sites for tyrosine and serine phosphorylation. The candle mutation results in an aspartic acid to glycine amino acid change at amino acid 219 within the region between the C-terminal SH2 domain and the phosphatase domain. The candle mutation is predicted to affect all of the SHP1 isoforms.

  

For more information on Ptpn6, please see the record for spin.

Putative Mechanism

The phenotype of the candle mice suggests decreased SHP1 function, and optimal signaling through SHP1 requires an intact connecting region between the SH2 domain and the catalytic domain. The phenotype of candle animals is less severe than the spin (3) and spin2 phenotypes as foot lesions were not observed in the candle mice. The foot lesions observed in the spin mice were associated with the development of splenomegaly and an increased number of erythroid and myeloid cells in the spleen, as well as a reduction in mature B cell numbers in the peripheral blood, spleen and bone marrow. Spontaneously occurring motheaten (me) and viable motheaten (me-v) mutants are immunodeficient and exhibit multiple defects stemming from increased inflammation, including alopecia, glomerulonephritis, dermatitis, inflammation of the paws, and interstitial pneumonitis which ultimately causes death by 3 and 9 weeks of age in Ptpn6^me/me and Ptpn6^me-v/me-v mice, respectively. The phenotype of the candle animals is significantly less severe than the Ptpn6^me-v allele, which encodes a SHP1 protein with approximately 20% catalytic activity (4).  It is likely that the SHP1 protein encoded by the candle allele retains catalytic activity that is greater than 20% of normal, and greater than the SHP1 protein encoded by the spin and spin2 alleles.

Primers

PCR Primer
candle(F):5'- CTCCTGCTTTTGTAGACTCTGAAATG -3'
candle(R):5'- ACCTGGTGGAGCACTTCAAG -3'

Sequencing Primer
candle_seq(F):5'- TCAGAGAACTGAGTCCCCCG -3'
candle_seq(R):5'- CTGGTGGAGCACTTCAAGAAGAC -3'

References

  1. Yang, J., Liu, L., He, D., Song, X., Liang, X., Zhao, Z. J., and Zhou, G. W. (2003) Crystal Structure of Human Protein-Tyrosine Phosphatase SHP-1. J Biol Chem. 278, 6516-6520.

  2. Poole, A. W., and Jones, M. L. (2005) A SHPing Tale: Perspectives on the Regulation of SHP-1 and SHP-2 Tyrosine Phosphatases by the C-Terminal Tail. Cell Signal. 17, 1323-1332.

  3. Croker, B. A., Lawson, B. R., Berger, M., Eidenschenk, C., Blasius, A. L., Moresco, E. M., Sovath, S., Cengia, L., Shultz, L. D., Theofilopoulos, A. N., Pettersson, S., and Beutler, B. A. (2008) Inflammation and Autoimmunity Caused by a SHP1 Mutation Depend on IL-1, MyD88, and a Microbial Trigger. Proc Natl Acad Sci U S A. 105, 15028-15033.

  4. Kozlowski, M., Mlinaric-Rascan, I., Feng, G. S., Shen, R., Pawson, T., and Siminovitch, K. A. (1993) Expression and Catalytic Activity of the Tyrosine Phosphatase PTP1C is Severely Impaired in Motheaten and Viable Motheaten Mice. J Exp Med. 178, 2157-2163.