Phenotypic Mutation 'cruz' (pdf version)
List |< first << previous [record 94 of 511] next >> last >|
Allelecruz
Mutation Type missense
Chromosome2
Coordinate79,454,595 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Neurod1
Gene Name neurogenic differentiation 1
Synonym(s) bHLHa3, BETA2, Neurod
Chromosomal Location 79,452,521-79,456,751 bp (-)
MGI Phenotype Homozygotes for targeted null mutations exhibit neonatal diabetes, pancreatic enteroendocrine cell deficits, impaired hearing and balance, retinal degeneration, and seizures. Survival past birth is dependent on genetic background.
Accession Number

NCBI RefSeq: NM_010894; MGI:1339708

Mapped Yes 
Amino Acid Change Asparagine changed to Isoleucine
Institutional SourceBeutler Lab
Gene Model predicted sequence gene model
PDB Structure
Crystal Structure of the basic-helix-loop-helix domains of the heterodimer E47/NeuroD1 bound to DNA [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000040364
Gene: ENSMUSG00000034701
AA Change: N148I

DomainStartEndE-ValueType
coiled coil region 27 84 N/A INTRINSIC
HLH 107 159 9.63e-17 SMART
Pfam:Neuro_bHLH 160 284 1.1e-47 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000041099)
Phenotypic Category behavior/neurological, hearing/vestibular/ear
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(11) : Chemically induced (other)(1) Targeted(9) Transgenic (1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01558:Neurod1 APN 2 79454019 missense probably damaging 0.96
IGL01814:Neurod1 APN 2 79454659 missense probably damaging 1.00
R0427:Neurod1 UTSW 2 79454182 missense probably damaging 1.00
R1775:Neurod1 UTSW 2 79454437 missense probably benign 0.10
R1795:Neurod1 UTSW 2 79454329 missense probably benign 0.13
R3783:Neurod1 UTSW 2 79454595 missense probably damaging 1.00
R3785:Neurod1 UTSW 2 79454595 missense probably damaging 1.00
R3786:Neurod1 UTSW 2 79454595 missense probably damaging 1.00
R3787:Neurod1 UTSW 2 79454595 missense probably damaging 1.00
R4031:Neurod1 UTSW 2 79454026 missense probably benign 0.20
R4978:Neurod1 UTSW 2 79454227 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice
Repository
Last Updated 03/01/2017 12:00 PM by Anne Murray
Record Created 03/10/2016 2:33 PM by Jamie Russell
Record Posted 03/01/2017
Phenotypic Description
Figure 1. Cruz mice exhibit hyperactivity and head tossing.

The cruz phenotype was identified among G3 mice of the pedigree R3795, some of which showed hyperactivity and head tossing (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the behavioral phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 37 mutations (X-axis) identified in the G1 male of pedigree R3795.  Binary phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 37 mutations. The behavioral phenotypes were linked to a mutation in Neurod1: an A to T transversion at base pair 79,454,595 (v38) on chromosome 2, or base pair 2,042 in the GenBank genomic region NC_000068 encoding Neurod1. Linkage was found with a recessive model of inheritance (P = 0.001777), wherein three affected mice were homozygous for the variant allele, and 19 unaffected mice were either heterozygous (N = 17) or homozygous for the reference allele (N = 11); the genotyping of one unaffected mouse failed at all reads (Figure 2).

 

The mutation corresponds to residue 540 in the NM_010894 mRNA sequence in exon 2 of 2 total exons. 


 

524 CTGCGCTTGGCCAAGAACTACATCTGGGCTCTG

143 -L--R--L--A--K--N--Y--I--W--A--L-

 

The mutated nucleotide is indicated in red.  The mutation results in an asparagine (N) to isoleucine (I) substitution at position 148 (N148I) in the NeuroD protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction
Figure 3. Domain organization of NeuroD. NeuroD has a nuclear localization sequence (NLS), and helix-loop-helix (HLH) domain, and a DNA-binding domain (DBD). The cruz mutation results in an asparagine (N) to isoleucine (I) substitution at position 148 (N148I).
Figure 4. Crystal structure of the mouse NeuroD HLH domain-E47-DNA complex. The DNA seqeuence is the insulin promoter E-box sequence. Figure was generated by UCSF Chimera and is modeled after PDB:2QL2 and Longo et al. 2008.

Neurod1 encodes NeuroD (alternatively, BETA2), a basic helix-loop-helix (bHLH) transcription factor. bHLH proteins have a DNA binding domain and a helix-loop-helix (HLH) domain (Figure 3). The bHLH transcription factors bind a specific E-box DNA sequence, CANNTG, in target genes through their DNA binding domain (1). bHLH transcription factors typically heterodimerize with other bHLH transcription factors (e.g., E12/E47) through interactions with their respective HLH domains (Figure 4(2). In addition to the DNA binding domain and the HLH domain, NeuroD has a nuclear localization sequence at amino acids 87 to 93.

NeuroD activity is regulated by several factors. NeuroD is acetylated by p300-associated factor (PCAF) (3). NeuroD acetylation is proposed to regulate NeuroD-associated insulin gene regulation and other functions of NeuroD. NeuroD undergoes O-linked glycosylation upon exposure to glucose, which regulates the subcellular localization of NeuroD in pancreatic beta cells (4). GSK3β is proposed to phosphorylate NeuroD at Ser274, which may inhibit NeuroD activity (5;6). The GSK3β consensus site in NeuroD is flanked by an ERK consensus sequence. ERK2 phosphorylates NeuroD at Ser162, Ser259, Ser266, and Ser274 (7). Phosphorylation at these sites can either stimulate or inhibit NeuroD activity depending on the cell or tissue in which NeuroD is expressed. CaMKII (see the record for frantic) phosphorylates NeuroD at Ser336. Mixed-lineage kinase 2 (MLK2) can also phosphorylate NeuroD, resulting in NeuroD stimulation. In Xenopus, Huntingtin protein and Huntington-associated protein 1 (HAP1) interact with NeuroD, subsequently facilitating MLK2-associated NeuroD activation (8). In Xenopus, Id proteins inhibit NeuroD activity (9). NeuroD association with small heterodimer partner (SHP) represses NeuroD-associated reporter activity and p300-enhanced NeuroD transcriptional activity by interfering with p300 (10). Cyclin D is recruited to NeuroD through binding to p300. Cyclin D association with NeuroD represses NeuroD activity (11).

 

The cruz mutation results in an asparagine (N) to isoleucine (I) substitution at position 148 (N148I). Residue 148 is within the HLH domain.

Expression/Localization

NeuroD is highly expressed in developing neurons of the peripheral and central nervous systems. During embryonic development, NeuroD is expressed in developing amacrine cells and photoreceptor cells of the retina; NeuroD is also expressed in a subset of mature photoreceptors.  NeuroD is expressed in pancreatic endocrine cells as well as endocrine cell lineages in the intestine and brain (12). In the mouse pancreas, Neurod1 is expressed in beta cells throughout development (13).  In the adult mouse pancreas, Neurod1 is expressed in mature beta cells and a small fraction (1 to 2%) of alpha cells, but not in delta or PP cells (13). NeuroD is expressed in neuroendocrine cells of the stomach, gut, and lung (13;14). NeuroD is expressed in limbic, hypothalamic, thalamic, cerebral cortical, olfactory/vomeronasal, and hippocampal pyramidal neurons [reviewed in (15)]. NeuroD is also highly expressed in the developing and adult rat pineal gland (16).

Background
Figure 5. NeuroD induces the neuronal program. In neural progenitors, NeuroD binds to its target sites by recognizing its sequence motif which is followed by replacement of heterochromatin machinery and repressive transcription factors. The loss of inactive (H3K27me3) and gain of active (H3K27ac) histone marks are accompanied by increased chromatin accessibility, leading to recruitment of RNA polymerase II and gene expression. Figure and legend adapted from Pataskar et al. 2015.
Figure 6. High levels of glucose mediate O-GlcNAc modification of NeuroD and its translocation into the nucleus. In the presence of low glucose (1–3 mM), NeuroD1 is mainly localized to the cytosol. In response to high glucose (10–30 mM), it becomes O-GlcNAc-modified, which causes its translocation into the nucleus. Once in the nucleus, NeuroD heterodimerizes with E47 and activates insulin gene expression by recruiting co-activators such as p300. Symbols: OGT, O-linked GlcNAc transferase; Ac, acetyl group; G, GlcNAc; NPC, nuclear pore complex; P, phospho group. Figure and legend adapted from Andrali et al. 2008.

NeuroD is essential for the proper development of the nervous and endocrine systems  as well as for epithelial-to-mesenchymal transition (17). NeuroD is a neurogenesis differentiation factor that is transiently expressed in the neurons of the central and nervous systems during terminal differentiation into mature neurons (Figure 5(18). NeuroD activates neuronal differentiation genes by binding directly to regulatory elements in the promoters of the target genes (17). Binding of NeuroD heterodimers to target promoters results in loss of the Polycomb group-associated repressive mark H3K27me3 and loss of repressor protein (e.g., TBX3 and MBD3) binding (17). Concomitantly, there is gain of the active mark H3K27ac and increased chromatin accessibility followed by induced gene expression. In neural precursor cells, NeuroD promotes premature cell cycle exit and differentiation (18). NeuroD is essential for the survival and differentiation of olfactory bulb neurons (19;20). Mice expressing an inducible stem cell-specific deletion of Neurod1 exhibited diminished neuron differentiation in the hippocampus and olfactory bulb (19).

 

NeuroD is also required for amacrine cell and photoreceptor cell differentiation and survival in the retina (21;22). Neurod1-/- mice exhibited a reduction in amacrine cell differentiation with a concomitant increase in bipolar interneurons (23). Overexpression of NeuroD in retinal explant cultures led to an increased frequency of rod photoreceptor cells (24). Loss of NeuroD expression in cultured retinal cells led to death of a subset of rod photoreceptors, increased number of bipolar cells, delayed amacrine cell differentiation, and increased gliogenesis (23). Neurod1-/- mice exhibited reduced retinal function when assessed by both rod- and cone-driven electroretinograms (21).

 

NeuroD binds to the E-box binding site in the insulin promoter, which stimulates transcription (Figure 6(12). In addition, NeuroD is required for proper differentiation of pancreatic islet cells (25). Neurod1-/- mice (129sv/J and C57BL6 mixed genetic background) die by postnatal day five due to severe hyperglycemia (13). Endocrine cells in the Neurod1-/- mice fail to form islets and beta cells undergo cell death starting around embryonic day 17.5; remaining beta cells do not produce enough insulin. Backcrossing Neurod1 heterozygous mice to mice of the 129sv/J strain resulted in more than 60% of the Neurod1-/- mice to survive beyond the neonate stage (26;27); the Neurod1-/- mice on the 129/SvJ genetic background are slightly hyperglycemic and by three weeks of age insulin levels are at normal values (26). NeuroD promotes transcription of the sulfonylurea receptor (SUR1), which forms a potassium channel with Kir6.2 (28). In response to glucose, the potassium channel closes, leading to increased levels of intracellular calcium. Increased calcium is essential for the activation of transcription factors in mature beta cells that promote the transcription of factors that elevate insulin secretion upon glucose stimulation.

 

There are several NeuroD target genes, which mediate endocrine-related functions or neuronal differentiation (Table 1).

 

 

Target gene

References

Endocrine-related genes

Insulin

(12)

Proopiomelanocortin (POMC)

(29)

Somatostatin transactivating factor 1 (STF-1)/pancreatic duodenal homoebox gene 1 (PDX-1)

(30)

Secretin

(31)

Sulfonylurea receptor I (SUR1)

(28)

Nkx2.2

(32)

Somatostatin

(32)

IGRP (islet-specific glucose-6-phosphatase (G6Pase) catalytic-subunit-related protein)

(33)

Beta-glucokinase

(28;34;35)

Neuronal differnetiaiton/migration-related genes

Adenylate kinase isozyme 1 (AK1)

(36)

Inositol 1,4,5-triphosphoate receptor 1 (IP3R1)

(37)

Early B-cell factor 3 (Ebf3)

(38;39)

Brn3d

(38;39)

NSCL1

(40)

TrkB and TrkC

(41)

Neuroblastoma-associated gene and neuronal repellent factor

Slit2

(42)

 

Mutations in NEUROD1 are linked to maturity-onset diabetes of the young 6 (OMIM: #606394) (43) and noninsulin-dependent diabetes mellitus (OMIM: #125853) (44-46). In addition, mutations in NEUROD1 have been attributed to cases of nonsyndromic autosomal recessive retinitis pigmentosa (47). One study described a patient with a NEUROD1 mutation that exhibited permanent neonatal diabetes and a consistent pattern of neurological abnormalities including cerebellar hypoplasia, learning difficulties, sensorineural deafness, and visual impairment (44).

Putative Mechanism

NeuroD functions in inner ear development by promoting the survival and differentiation of inner ear sensory neurons (48-50). Neurod1-deficient (Neurod1-/-) mice exhibited loss of sound response, hyperactivity, head tilting, circling, spontaneous seizures, impaired motor coordination (i.e., hindlimb clutching when suspended), and ataxia due to a reduction of sensory neurons in the cochlear-vestibular ganglion as well as cerebellar defects (49;51;52). Conditional deletion of Neurod1 in the inner ear resulted in formation of hair cells within the inner ear sensory ganglia (53). The aberrant formation of hair cells in the inner ear was proposed to be due to loss of the suppressive function of NeuroD on hair cell differentiation in sensory ganglia (53). Loss of NeuroD expression in the inner ear led to loss of spiral and many vestibular neurons as well as defects in the projection of vestibular and cochlear afferents, which resulted in the vestibular and cochlear afferents entering the cochlear nucleus as a single mixed nerve (54).

Primers PCR Primer
cruz(F):5'- GGGCTTTCAAAGAAGGGCTC -3'
cruz(R):5'- AGGACGAGCTTGAAGCCATG -3'

Sequencing Primer
cruz_seq(F):5'- CTTTCAAAGAAGGGCTCCAGAG -3'
cruz_seq(R):5'- CGAGCTTGAAGCCATGAATGC -3'
References
Science Writers Anne Murray
Illustrators Katherine Timer
AuthorsMarleen de Groot, Jamie Russell, and Bruce Beutler
List |< first << previous [record 94 of 511] next >> last >|