Phenotypic Mutation 'sneezy'

• Allele: sneezy
• Mutation Type: missense
• Chromosome: 9
• Coordinate: 62,639,391 bp (GRCm39)
• Base Change: T ⇒ A (forward strand)
• Gene: Itga11
• Gene Name: integrin alpha 11
• Synonym(s): 4732459H24Rik
• Chromosomal Location: 62,585,108-62,691,264 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha integrin. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein contains an I domain, is expressed in muscle tissue, dimerizes with beta 1 integrin in vitro, and appears to bind collagen in this form. Therefore, the protein may be involved in attaching muscle tissue to the extracellular matrix. Alternative transcriptional splice variants have been found for this gene, but their biological validity is not determined. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Mice homozygous for a disruption of this gene display dwarfism, increased mortality with age, and defective incisors. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Cysteine changed to Serine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000034774]
• AlphaFold: no structure available at present
• SMART Domains: Protein: ENSMUSP00000034774; Gene: ENSMUSG00000032243; AA Change: C129S

Domain	Start	End	E-Value	Type
Int_alpha	37	90	3.9e-7	SMART
VWA	162	350	2.74e-38	SMART
Int_alpha	421	472	2.19e-1	SMART
Int_alpha	476	532	3.75e-9	SMART
Int_alpha	538	593	1.39e-12	SMART
Int_alpha	600	654	1.08e0	SMART
transmembrane domain	1142	1164	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000034774)
• Meta Mutation Damage Score: 0.9014
• Is this an essential gene?: Probably nonessential (E-score: 0.172)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-09-04 9:43 PM by Anne Murray
• Record Created: 2016-03-22 1:37 PM
• Record Posted: 2017-01-11
• Science Writers: Anne Murray
• Illustrators: Katherine Timer
• Authors: Emre Turer and Bruce Beutler

Accession Number

NCBI RefSeq: NM_176922; MGI:2442114

Alleles Listed at MGI

All Mutations and Alleles(8) : Chemically induced (other)(1) Targeted(7)

Phenotypic Description

Figure 1. Sneezy mice exhibited reduced body weights. Scaled body weight data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The sneezy phenotype was identified among G3 mice of the pedigree R4190, some of which showed reduced body weights compared to their littermates (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced body weight phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 47 mutations (X-axis) identified in the G1 male of pedigree R4190. Scaled body weight data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 47 mutations. The body weight phenotype was linked to two genes on chromosome 9: Itga11 and Plscr5. The mutation in Itga11 is presumed causative because the body weight phenotype mimics that of other Itga11 mutants (see MGI for a list of Itga11 mouse mutants). The mutation in Itga11 is a T to A transversion at base pair 62,732,109 (v38) on chromosome 9, or base pair 54,255 in the GenBank genomic region NC_000075 encoding Itga11. Linkage was found with a recessive model of inheritance, wherein eight variant homozygotes departed phenotypically from 18 homozygous reference mice and 14 heterozygous mice (P = 3.746 x 10^-8; Figure 2). A substantial semidominant effect was also observed (P = 2.644 x 10^-5).

The mutation corresponds to residue 475 in the NM_176922 mRNA sequence in exon 5 of 30 total exons. 

460 CTCTGGTCGCACGAGTGTGGAAGCTCCTACTAC 124 -L--W--S--H--E--C--G--S--S--Y--Y-

The mutated nucleotide is indicated in red.  The mutation results in a cysteine (C) to serine (S) substitution at position 129 (C129S) in the ITGA11 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction

Figure 3. Domain organization of integrin α11. Integrin α11 a long extracellular domain, a transmembrane domain (TM), and a short cytoplasmic domain. The extracellular domain of integrin α11 has seven β-propeller repeats (designated as FG-GAP repeats). A von Willebrand factor A (VWFA) domain (alternatively, integrin I-domain) is the major integrin α11 collagen-binding site. he sneezy mutation results in a cysteine (C) to serine (S) substitution at position 129 (C129S). Abbreviations: SP, signal peptide.

Itga11 encodes integrin α11, which forms a dimer with β1 integrin to form a functional integrin receptor, α11β1. Integrins α11 and β1 are both type I transmembrane proteins. Similar to other α chains (CD11a, CD11b [see the record for invisible], and CD11c [see the record for Adendritic]), α11 has a long extracellular domain, a transmembrane domain, and a short cytoplasmic domain (Figure 3). The integrins bind ligands with their extracellular domains, and their intracellular tails associate with linker proteins and the actin cytoskeleton (1). The extracellular domain of integrin α11 has several subdomains, including seven β-propeller repeats (designated as FG-GAP repeats) that form a β-propeller fold. In FG-GAP repeats 5, 6, and 7 there is a consensus sequence DXD/NXDXXXD that is a putative divalent cation binding motif. A 200-amino acid von Willebrand factor A (VWFA) domain (alternatively, integrin I-domain) is the major integrin α11 collagen-binding site and separates the second and third FG-GAP repeats (2-4). The VWFA has six major α-helices and a β-sheet composed of five parallel and one anti-parallel β-strand; the VWFA domain has a conserved metal ion-dependent adhesion site (MIDAS) motif. Ligand binding depends on the integrity of the metal ion-dependent adhesion site (MIDAS), a part of VWFA and VWFA-like domains, which binds to divalent cations and coordinates to a glutamine or aspartate residue in the ligand. A DXSXS sequence is a key metal-binding motif of the MIDAS. Integrin α11 also has two Calf-1 domains at the C-terminus. A 22 amino acid insert within the C-terminal Calf-1 domain distinguishes α11 from other integrin α chains. Integrin α11 also has a thigh domain that together with the Calf-1 domains supports the ligand binding head formed by the β-propeller domain. Twenty cysteines within the extracellular domain may contribute to intramolecular disulfide bonds.

The sneezy mutation results in a cysteine (C) to serine (S) substitution at position 129 (C129S). Residue 129 is within the second FG-GAP domain. Cysteine 129 is putatively involved in a disulfide bond with cysteine 159.

Expression/Localization

Integrin α11 is expressed in many embryonic tissues, but integrin α11 expression decreases in adult tissues (5). In the human eye, integrin α11 is predominantly expressed in the anterior corneal stroma at 10 to 20 weeks of gestation. In the developing skeleton, integrin α11 is expressed in mesenchymal cells around the cartilage anlage, mesenchumal cells in intervertebral discs, and keratocytes of the cornea (6). Integrin α11 is expressed in fibroblasts of the skin (7). Integrin α11β1 is expressed in the incisor periodontal ligament fibroblasts in both mouse and humans, in villus cluster fibroblasts, and in human gingival fibroblasts  (5;8;9). Intregrin α11 was expressed in the dental follicular mesenchyme that forms the periodontal ligament fibroblasts as well as in the preodontoblasts of the developing molars and incisors (5).

Low expression of integrin α11 was detected in fibroblasts of the heart of the rat; integrin α11 expression was upregulated in cardiac fibroblasts in rats with diabetes (10). Increased integrin α11 expression in the fibroblasts of the diabetic rats is proposed to be due to activation of the autocrine TGF-β2 signaling pathway that stimulates α11 integrin expression through Smad2/3 binding elements in the α11 integrin promoter (11). In diabetic cardiomyopathy, the interaction between α11 integrin and TGF-β2 signaling may promote the formation of pro-fibrotic myofibroblasts and the development of fibrotic interstitium (10).

Integrin α11 expression is upregulated in several malignancies, including non-small-cell lung carcinoma, head and neck squamous cell carcinomas, and oral squamous cell carcinomas (12). Integrin α11 is expressed by cancer-associated fibroblasts. In the head and neck squamous cell carcinomas, α11 colocalized with α-smooth muscle actin. Itga11 expression is inhibited by miR-126a-3p, which is proposed to impair cell migratory and invasive capacity during embryo implantation (13). Type I interferons induce Itga11 expression in T98G cells and in the spleen and lungs of interferon-treated BALB/c mice (14).

Background

Figure 4. Integrins α11β1 interact with collagen I and IV at focal adhesions to initiate a cascade of integrin-, membrane-, actin- and signalling-associated molecules. Focal adhesions (and α11β1) have central roles in cell motility, cytoskeletal dynamics, cell proliferation, differentiation, gene expression and survival.

Integrins are adhesion molecules that mediate cell-cell, cell-extracellular matrix, and cell-pathogen interactions. They regulate cell migration and morphogenesis by coordinating regulatory signals from inside and outside the cell, with the physical machinery for cell movement. Most integrins link to and regulate the actin cytoskeleton. Their ligands are diverse, but most possess a short peptide motif containing an acidic residue (aspartate or glutamate) positioned in a flexible loop. There are 24 distinct integrins formed by a combination of α and β subunits. Integrins α11β1, α10β1, α1β1, and α2β1 are collagen receptors; α11β1 mediates cell adhesion to collagens I and IV (Figure 4) (4;6). Intergrin α11β1 recognizes the GFOGER sequence in fibrillar collagens to mediate collagen-associated cell migration, collagen deposition, and collagen reorganization (4;5). Integrin α11β1 is the predominant integrin receptor for collagen I on mouse embryonic fibroblasts. In periodontal ligament fibroblasts, integrin α11β1 is required for the cell migration and collagen reorganization needed for axial tooth movement (5). Integrin α11β1 is proposed to function in ordered collagen matrix organization in the cornea during development (6) and to regulate myofibroblast differentiation (15). Increased expression of integrin α11 is observed in scarred keratoconus corneas, indicating that integrin α11 functions in corneal pathologies (16).

ITGA11 is a common gene upregulated in non-small-cell lung carcinoma stromoa compared to normal lung stroma (17;18). In non-small-cell lung carcinoma, head and neck squamous cell carcinomas, and oral squamous cell carcinomas, integrin α11 is proposed to regulate cancer cell growth (17;19). Integrin α11 is a stromal factor in non-small-cell lung carcinoma that promotes the growth of carcinoma cells during tumor formation. Integrin α11 facilitates the ability of fibroblasts to promote growth of non-small-cell lung carcinoma through its regulation of IGF2 expression in stromal fibroblasts (17). In non-small-cell lung carcinoma, stromal integrin α11 promotes collagen crosslinking and stiffness (19).

Itga11-deficient (Itga11^-/-) mice are viable and fertile, but exhibit dwarfism (and a 20 to 30% reduction in weight) by three weeks of age with increased mortality by one year of age due to severe malnutrition (5). The internal organs in the Itga11^-/- mice were correspondingly smaller (1). The malnutrition was proposed to predominantly be caused by severely defective incisors (5). The incisal portions of the upper incisors were frequently missing, but the intraalveolar portion was still intact. Furthermore, tooth eruption was reduced to three to six weeks and stopped at six to seven months. The incisors from the Itga11^-/- mice display disorganized periodontal ligaments; molar ligaments are normal (5). The defect in the periodontal ligaments of the incisors leads to halted tooth eruption. Examination of the periodontal ligaments determined that there was increased thickness due to increased accumulation of collagens. Itga11^-/- mice also exhibited impaired repair of skin wounds due to reduced wound contraction, reduced formation of granulation tissue, and altered scar stability (20). Both myofibroblast differentiation and collagen remodeling were impaired in the Itga11^-/- mice. The impaired myofibroblast differentiation resulted in reduced myofibroblast number and subsequent impaired tissue restoration and compromised wound contraction. Itga11^-/- embryonic fibroblasts exhibited defects in cell adhesion and spreading on collagen I, reduced retraction of collagen lattices, and reduced cell proliferation; attachment to collagen IV was only slightly affected (5). In the Itga11^-/- embryonic fibroblasts, expression of MMP13 and MMP14 was disrupted.

Putative Mechanism

The dwarfism phenotype observed in Itga11^-/- mice was originally proposed to be due to malnutrition caused by tooth defects (5). However, the phenotype in the mice was observed before weaning, suggesting that malnutrition may not be the major contributing factor for the dwarfism. Collagen-binding integrin receptors (i.e., α2β1 and α11β1) are proposed to function in the control of the growth hormone/insulin-like growth factor (IGF-1) functions. The dwarfism phenotype observed in the Itga11^-/- mice is now attributed to a loss of circulating IGF-1 levels (1). The reduced levels of IGF-1 were due to a diminished expression of growth hormone in the pituitary gland. The reduced body weight phenotype observed in the sneezy mice indicates loss of integrin α11^sneezy function.

Primers

PCR Primer
sneezy_pcr_F: AATCCAGGCTCCACTGTTCC
sneezy_pcr_R: ATGCTGCTCTGTAGGTACATGATAG

Sequencing Primer
sneezy_seq_F: TGAAGCCCAGGGTACTGCAG
sneezy_seq_R: CTCTGTAGGTACATGATAGCGGCG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 401 nucleotides is amplified (chromosome 9, + strand):

1   aatccaggct ccactgttcc ccactatacc tgaagcccag ggtactgcag caagagagag
61  ttcagtgaga cgcagacctc acacactagg aatgccagta ctccgataaa gaagtctccc
121 ttgggtcctg gagggtgagg ccccaccctg tctgaagccc tgtgactggg ctctgtgctg
181 tgctgtttca caggcctgca gccctctctg gtcgcacgag tgtggaagct cctactacac
241 cactggcatg tgctcacggg tcaactccaa cttcagattc tctaagacgg tagctccggc
301 acttcagagt gagtacctta aaggcaccgg ctgttctgag ggagcccagg gaggaggctt
361 agggctgtgc tcgccgctat catgtaccta cagagcagca t

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Blumbach, K., Niehoff, A., Belgardt, B. F., Ehlen, H. W., Schmitz, M., Hallinger, R., Schulz, J. N., Bruning, J. C., Krieg, T., Schubert, M., Gullberg, D., and Eckes, B. (2012) Dwarfism in Mice Lacking Collagen-Binding Integrins alpha2beta1 and alpha11beta1 is Caused by Severely Diminished IGF-1 Levels. J Biol Chem. 287, 6431-6440.

  2. Knight, C. G., Morton, L. F., Peachey, A. R., Tuckwell, D. S., Farndale, R. W., and Barnes, M. J. (2000) The Collagen-Binding A-Domains of Integrins Alpha(1)Beta(1) and Alpha(2)Beta(1) Recognize the Same Specific Amino Acid Sequence, GFOGER, in Native (Triple-Helical) Collagens. J Biol Chem. 275, 35-40.

  3. Knight, C. G., Morton, L. F., Onley, D. J., Peachey, A. R., Messent, A. J., Smethurst, P. A., Tuckwell, D. S., Farndale, R. W., and Barnes, M. J. (1998) Identification in Collagen Type I of an Integrin alpha2 beta1-Binding Site Containing an Essential GER Sequence. J Biol Chem. 273, 33287-33294.

  4. Zhang, W. M., Kapyla, J., Puranen, J. S., Knight, C. G., Tiger, C. F., Pentikainen, O. T., Johnson, M. S., Farndale, R. W., Heino, J., and Gullberg, D. (2003) Alpha 11beta 1 Integrin Recognizes the GFOGER Sequence in Interstitial Collagens. J Biol Chem. 278, 7270-7277.

  5. Popova, S. N., Barczyk, M., Tiger, C. F., Beertsen, W., Zigrino, P., Aszodi, A., Miosge, N., Forsberg, E., and Gullberg, D. (2007) Alpha11 beta1 Integrin-Dependent Regulation of Periodontal Ligament Function in the Erupting Mouse Incisor. Mol Cell Biol. 27, 4306-4316.

  6. Tiger, C. F., Fougerousse, F., Grundstrom, G., Velling, T., and Gullberg, D. (2001) Alpha11beta1 Integrin is a Receptor for Interstitial Collagens Involved in Cell Migration and Collagen Reorganization on Mesenchymal Nonmuscle Cells. Dev Biol. 237, 116-129.

  7. Velling, T., Kusche-Gullberg, M., Sejersen, T., and Gullberg, D. (1999) CDNA Cloning and Chromosomal Localization of Human Alpha(11) Integrin. A Collagen-Binding, I Domain-Containing, Beta(1)-Associated Integrin Alpha-Chain Present in Muscle Tissues. J Biol Chem. 274, 25735-25742.

  8. Barczyk, M. M., Olsen, L. H., da Franca, P., Loos, B. G., Mustafa, K., Gullberg, D., and Bolstad, A. I. (2009) A Role for alpha11beta1 Integrin in the Human Periodontal Ligament. J Dent Res. 88, 621-626.

  9. Popova, S. N., Rodriguez-Sanchez, B., Liden, A., Betsholtz, C., Van Den Bos, T., and Gullberg, D. (2004) The Mesenchymal alpha11beta1 Integrin Attenuates PDGF-BB-Stimulated Chemotaxis of Embryonic Fibroblasts on Collagens. Dev Biol. 270, 427-442.

  10. Talior-Volodarsky, I., Connelly, K. A., Arora, P. D., Gullberg, D., and McCulloch, C. A. (2012) Alpha11 Integrin Stimulates Myofibroblast Differentiation in Diabetic Cardiomyopathy. Cardiovasc Res. 96, 265-275.

  11. Talior-Volodarsky, I., Arora, P. D., Wang, Y., Zeltz, C., Connelly, K. A., Gullberg, D., and McCulloch, C. A. (2015) Glycated Collagen Induces alpha11 Integrin Expression through TGF-beta2 and Smad3. J Cell Physiol. 230, 327-336.

  12. Parajuli, H., Teh, M. T., Abrahamsen, S., Christoffersen, I., Neppelberg, E., Lybak, S., Osman, T., Johannessen, A. C., Gullberg, D., Skarstein, K., and Costea, D. E. (2016) Integrin alpha11 is Overexpressed by Tumour Stroma of Head and Neck Squamous Cell Carcinoma and Correlates Positively with Alpha Smooth Muscle Actin Expression. J Oral Pathol Med. .

  13. Li, Z., Jia, J., Gou, J., Tong, A., Liu, X., Zhao, X., and Yi, T. (2015) Mmu-miR-126a-3p Plays a Role in Murine Embryo Implantation by Regulating Itga11. Reprod Biomed Online. 31, 384-393.

  14. Leomil Coelho, L. F., Mota, B. E., Sales, P. C., Marques, J. T., de Oliveira, J. G., Bonjardim, C. A., Peregrino Ferreira, P. C., and Kroon, E. G. (2006) Integrin Alpha 11 is a Novel Type I Interferon Stimulated Gene. Cytokine. 33, 352-361.

  15. Carracedo, S., Lu, N., Popova, S. N., Jonsson, R., Eckes, B., and Gullberg, D. (2010) The Fibroblast Integrin alpha11beta1 is Induced in a Mechanosensitive Manner Involving Activin A and Regulates Myofibroblast Differentiation. J Biol Chem. 285, 10434-10445.

  16. Bystrom, B., Carracedo, S., Behndig, A., Gullberg, D., and Pedrosa-Domellof, F. (2009) Alpha11 Integrin in the Human Cornea: Importance in Development and Disease. Invest Ophthalmol Vis Sci. 50, 5044-5053.

  17. Zhu, C. Q., Popova, S. N., Brown, E. R., Barsyte-Lovejoy, D., Navab, R., Shih, W., Li, M., Lu, M., Jurisica, I., Penn, L. Z., Gullberg, D., and Tsao, M. S. (2007) Integrin Alpha 11 Regulates IGF2 Expression in Fibroblasts to Enhance Tumorigenicity of Human Non-Small-Cell Lung Cancer Cells. Proc Natl Acad Sci U S A. 104, 11754-11759.

  18. Navab, R., Strumpf, D., Bandarchi, B., Zhu, C. Q., Pintilie, M., Ramnarine, V. R., Ibrahimov, E., Radulovich, N., Leung, L., Barczyk, M., Panchal, D., To, C., Yun, J. J., Der, S., Shepherd, F. A., Jurisica, I., and Tsao, M. S. (2011) Prognostic Gene-Expression Signature of Carcinoma-Associated Fibroblasts in Non-Small Cell Lung Cancer. Proc Natl Acad Sci U S A. 108, 7160-7165.

  19. Navab, R., Strumpf, D., To, C., Pasko, E., Kim, K. S., Park, C. J., Hai, J., Liu, J., Jonkman, J., Barczyk, M., Bandarchi, B., Wang, Y. H., Venkat, K., Ibrahimov, E., Pham, N. A., Ng, C., Radulovich, N., Zhu, C. Q., Pintilie, M., Wang, D., Lu, A., Jurisica, I., Walker, G. C., Gullberg, D., and Tsao, M. S. (2016) Integrin alpha11beta1 Regulates Cancer Stromal Stiffness and Promotes Tumorigenicity and Metastasis in Non-Small Cell Lung Cancer. Oncogene. 35, 1899-1908.

  20. Schulz, J. N., Zeltz, C., Sorensen, I. W., Barczyk, M., Carracedo, S., Hallinger, R., Niehoff, A., Eckes, B., and Gullberg, D. (2015) Reduced Granulation Tissue and Wound Strength in the Absence of alpha11beta1 Integrin. J Invest Dermatol. 135, 1435-1444.