Phenotypic Mutation 'fruko'

• Allele: fruko
• Mutation Type: missense
• Chromosome: 13
• Coordinate: 63,023,075 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Fbp1
• Gene Name: fructose bisphosphatase 1
• Synonym(s): Fbp3, FBPase brain isoform, Fbp-2, FBPase liver
• Chromosomal Location: 63,012,567-63,036,096 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Fructose-1,6-bisphosphatase 1, a gluconeogenesis regulatory enzyme, catalyzes the hydrolysis of fructose 1,6-bisphosphate to fructose 6-phosphate and inorganic phosphate. Fructose-1,6-diphosphatase deficiency is associated with hypoglycemia and metabolic acidosis. [provided by RefSeq, Jul 2008]
• Mapped: Yes
• Amino Acid Change: Leucine changed to Proline
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000090564] [ENSMUSP00000115703] [ENSMUSP00000117146]
• AlphaFold: Q9QXD6
• SMART Domains: Protein: ENSMUSP00000090564; Gene: ENSMUSG00000069805; AA Change: L74P

Domain	Start	End	E-Value	Type
Pfam:FBPase	12	334	7.3e-145	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000092888)
• SMART Domains: Protein: ENSMUSP00000115703; Gene: ENSMUSG00000069805

Domain	Start	End	E-Value	Type
Pfam:FBPase	12	57	3.6e-10	PFAM

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000117146; Gene: ENSMUSG00000069805

Domain	Start	End	E-Value	Type
Pfam:FBPase	1	71	5.3e-35	PFAM
Pfam:FBPase	70	130	2.7e-26	PFAM

• Predicted Effect: probably benign
• Meta Mutation Damage Score: 0.9750
• Is this an essential gene?: Possibly nonessential (E-score: 0.269)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-09-04 9:43 PM by Anne Murray
• Record Created: 2016-03-22 4:24 PM by Cristhiaan D. Ochoa
• Record Posted: 2018-12-18
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Cristhiaan Ochoa, Duanwu Zhang, Jianhui Wang, Reagan Costello-White, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_019395; MGI:95492

Alleles Listed at MGI

All Mutations and Alleles(4) : Chemically induced (other)(1) Targeted(3)

Phenotypic Description

Figure 1. Fruko mice exhibited fasting hypoglycemia. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The fruko phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4474, some of which showed low fasting glucose levels (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the fasting hypoglycemia phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 34 mutations (X-axis) identified in the G1 male of pedigree R4474. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 34 mutations. The fasting hypoglycemia phenotype was linked by continuous variable mapping to a mutation in Fbp1: a T to C transition at base pair 62,875,261 (v38) on chromosome 13, or base pair 13,038 in the GenBank genomic region NC_000079 encoding Fbp1. Linkage was found with a recessive model of inheritance, wherein six variant homozygotes departed phenotypically from nine homozygous reference mice and 27 heterozygous mice with a P value of 5.335 x 10^-11 (Figure 2).  

The mutation corresponds to residue 460 in the NM_019395 mRNA sequence in exon 2 of 7 total exons. 

444 GATCAAGTAAAGAAGCTGGACATACTTTCCAAT 69  -D--Q--V--K--K--L--D--I--L--S--N-

The mutated nucleotide is indicated in red. The mutation results in a leucine (L) to proline (P) substitution at residue 74 (L74P) in the FBP1 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction

Figure 3. The FBP1 protein. FBP1 has no defined domains. Secondary structures are noted in pink and blue; see Figure 4 for the corresponding structure. The fruko mutation results in a leucine to proline substitution at residue 74 in the FBP1 protein.

Figure 4. Crystal structure of FBP1. The fruko mutation is noted in red. UCSF Chimera model is based on PDB 1FPI, Villeret et al. Proc. Natl. Acad. Sci USA 92, 8916-8920 (1995). Click on the 3D structure to view it rotate.

Fbp1 encodes hepatic fructose-1,6-bisphosphatase (FBP1 or FBPase; alternatively, fructose-1,6-diphosphatase). FBP1 is one of two FBP proteins. FBP2 is the muscle-specific FBP that participates in glycogen synthesis from carbohydrate precursors.

FBP1 has no defined domains. The fold of fructose-1,6-bisphosphatase was noted to be identical to that of inositol-1-phosphatase (IMPase) [Figure 3 & 4; PDB:1FPI; (1;2)]. The monomers of each have five layers of secondary structural elements of alternating ababa (1). The first layer has three nearly parallel a-helices. The helix at the N-terminus and the loop connecting to helix-2 form the binding site for the phosphate group of the allosteric inhibitor AMP. The next layer is mainly antiparallel b-sheets of eight strands.  The second layer also has a small helix of approximately one and one-half turns. The middle layer of two parallel helices is almost perpendicular to the b-sheets of the second layer. The fourth layer has five strands of antiparallel b-sheets adjacent to the two large helices of the fifth layer.

FBP1 requires metal ions for catalysis (Mg²⁺ and Mn²⁺ being preferred) (2). FBP1, inositol polyphosphate 1-phosphatase (IPPase), and IMPase share a sequence motif (Asp-Pro-Ile/Leu-Asp-Gly/Ser-Thr/Ser) that has been shown to bind metal ions and participate in catalysis. Asp74, Glu97, Glu98, Asp118, Asp121, and Glu280 are involved in metal binding in FBP1 (1).

Expression/Localization

FBP1 is primarily expressed in the liver, but is also expressed in human and rat pancreas (3). FBP1 is also expressed in several cancer cell types (see “Background” for more information).

Background

Figure 5. Overview of glycolysis and gluconeogenesis. The enzymes involved in glycolysis are indicated in green, while the enzymes in gluconeogenesis are indicated in purple. Gluconeogenesis will be discussed further. In step one, pyruvate is converted into phosphoenolpyruvate. The first step adds a carbon dioxide into the pyruvate-forming oxaloacetate. By then removing the carbon dioxide, the energy is created to add the phosphate into the pyruvate and rearrange the double bond to form phosphoenolpyruvate.After the phosphoenolpyruvate is formed, the steps are similar to glycolysis, but in the reverse. In step two, phosphoenolpyruvate rearranges into 2-phosphoglycerate. In step three, 2-phosphoglycerate rearranges into 3-phosphoglycerate. In step four, another phosphate is added to 3-phosphoglycerate to form 1,3-bisphosphoglycerate. In step five, 1,3-bisphosphoglycerate rearranges into glyceraldehyde. In step six, glyceraldehyde combines with another 1,3-bisphosphoglycerate to form fructose 1,6-bisphosphate. In step seven, fructose 1,6-bisphosphate is converted to fructose 6-phosphate by FBP1 (highlighted in red). In step eight, fructose 6-phosphate rearranges to form glucose 6-phosphate.

Gluconeogenesis is essential for replenishing glucose levels upon sensing energy deficiency (Figure 5). Gluconeogenesis generates glucose from non-carbohydrate carbon substrates (e.g., glucogenic amino acids, triglycerides, glycerol, odd-chain fatty acids, pyruvate, and lactate); the main gluconeogenic precursors in humans are lactate, glycerol, alanine, and glutamine. Gluconeogenesis mainly occurs in the liver, but can also occur in the kidney, intestine, and muscle. Lactate is transported to the liver where it is converted to pyruvate by the enzyme lactate dehydrogenase. Pyruvate is subsequently used to generate glucose. Transamination or deamination of amino acids promotes entering of their carbon skeleton into the cycle directly (as pyruvate or oxaloacetate), or indirectly through the citric acid cycle. Gluconeogenesis has 11 reactions. The first step is within the mitochondria where pyruvate is carboxylated by pyruvate carboxylase to form oxaloacetate. Oxaoloacetate is reduced to malate, which promotes its transportation out of the mitochondria. Malate is oxidized to oxaloacetate in the cytosol. Oxaloacetate is decarboxylated and phosphorylated by phosphoenolpyruvic acid carboxykinase to form phosphoenolpyruvate. The next several steps are the same as glycolysis, except the process is in reverse. Gluconeogenesis differs from glycolysis in the conversion of fructose-1,6 bisphosphate (FBP) to fructose-6-phosphate (F-6-P) and inorganic phosphate by FBP1. Glucose-6-phosphate is formed from fructose-6-phosphate by phosphoglucoisomerase. The glucose-6-phosphate can be used in metabolic pathways or be dephosphorylated to free glucose. In the lumen of endoplasmic reticulum, glucose-6-phosphate is hydrolyzed by glucose-6-phosphatase to produce glucose.

FBP1 regulates appetite and adiposity (4). FBP1 transgenic mice overexpressing human FBP1 showed 50% less adiposity, reduced food intake, increased circulating levels of satiety hormones leptin and cholecystokinin, increased fatty acid oxidation and 3-β-hydroxybutyrate ketone levels, and reduced appetite-stimulating neuropeptides, neuropeptide Y and ggouti-related peptide compared to wild-type littermates; energy expenditure in the transgenic mice was not changed.

FBP1 also regulates glucose sensing and insulin secretion from pancreatic β-cells (5). Small interfering RNA-mediated knockdown of FBP1 resulted in increased glucose-stimulated insulin secretion (GSIS), while FBP1 overexpression reduced GSIS.

Tumor cells show increased glucose uptake and glycolytic capacity (i.e., the Warburg effect) (6). To exert the Warburg effect on proliferation and tumorigenicity of cancer cells, the glycolysis pathway is upregulated and gluconeogenesis is inhibited. FBP1 is a tumor suppressor in gastric (7), lung (8;9), breast (10), liver (11), and kidney (12-14) cancers. In gastric cancer, FBP1 downregulation promoted metastasis by facilitating epithelial-mesenchymal transition (7). In breast cancer, loss of FBP1 expression increased Wnt/β-Catenin pathway activity and altered glucose metabolism (10). Loss of FBP1 expression in hepatocellular carcinoma promotes tumor progression by altering glucose metabolism (11). In renal cell carcinoma, FBP1 inhibits cancer progression by antagonizing glycolytic flux in renal tubular epithelial cells subsequently inhibiting the Warburg effect (13). FBP1 also putatively interacts with and inhibits nuclear HIF function, subsequently blocking cell proliferation, glycolysis, and the pentose phosphate pathway (13).

Mutations in FBP1 are associated with FBP1 deficiency [alternatively, Baker-Winegrad syndrome; OMIM: #229700; (15-22)]. Patients with FBP1 deficiency exhibit impaired gluconeogenesis as well as hypoglycemia and lactic acidosis on fasting. The patients also may have episodes of hyperventilation, apnea, hypoglycemia, and ketosis (23). FBP1 deficiency is often fatal in infancy and early childhood (18).

Homozygous transgenic mice overexpressing FBP1 specifically in the liver showed increased glucose production (24). Hemizygous transgenics were glucose intolerant after high-fat feeding compared with negative littermates. Transgenic mice overexpressing human FBP1 specifically in pancreatic islet beta-cells showed reduced insulin secretion in response to an intravenous glucose bolus (25). Fbp1-deficient mice have not been generated/phenotypically characterized (MGI; accessed October 3, 2017).

Putative Mechanism

The phenotype of the fruko mice mimics indicates loss of FBP1-associated function in gluconeogenesis.

Primers

PCR Primer
fruko_pcr_F: TCTTCCATGAAGCTGAGAAGG
fruko_pcr_R: TGAGCTTTCCAAACAGTGTCTC

Sequencing Primer
fruko_seq_F: CTTCCATGAAGCTGAGAAGGAAAATG
fruko_seq_R: GCAAGTCCACCCTCCGTTG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 412 nucleotides is amplified (chromosome 13, - strand):

1   tgagctttcc aaacagtgtc tctgctcccc tctgccagcc tcgccaggca agtccaccct
61  ccgttgccct tcctgaaccg ggcatgcctg gcatgtctgc cttccgtcca gatccattca
121 tggttgctct catcgaggct ctggtgccct tggcttattt tctgtggttt tccttccctc
181 tagctatggt atcgctggct caaccaatgt gactggggat caagtaaaga agctggacat
241 actttccaat gacctggtga tcaatatgct gaagtcgtcc tacgctacct gtgttcttgt
301 gtctgaagaa aacacaaatg ccatcataat cgaacctgag aagagggtgg gtctgtgttt
361 acgcctctga aggcttgctt gcagccattt tccttctcag cttcatggaa ga

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Zhang, Y., Liang, J. Y., and Lipscomb, W. N. (1993) Structural Similarities between Fructose-1,6-Bisphosphatase and Inositol Monophosphatase. Biochem Biophys Res Commun. 190, 1080-1083.

  2. Villeret, V., Huang, S., Fromm, H. J., and Lipscomb, W. N. (1995) Crystallographic Evidence for the Action of Potassium, Thallium, and Lithium Ions on Fructose-1,6-Bisphosphatase. Proc Natl Acad Sci U S A. 92, 8916-8920.

  3. Yanez, A. J., Bertinat, R., Spichiger, C., Carcamo, J. G., de Los Angeles Garcia, M., Concha, I. I., Nualart, F., and Slebe, J. C. (2005) Novel Expression of Liver FBPase in Langerhans Islets of Human and Rat Pancreas. J Cell Physiol. 205, 19-24.

  4. Visinoni, S., Khalid, N. F., Joannides, C. N., Shulkes, A., Yim, M., Whitehead, J., Tiganis, T., Lamont, B. J., Favaloro, J. M., Proietto, J., Andrikopoulos, S., and Fam, B. C. (2012) The Role of Liver Fructose-1,6-Bisphosphatase in Regulating Appetite and Adiposity. Diabetes. 61, 1122-1132.

  5. Zhang, Y., Xie, Z., Zhou, G., Zhang, H., Lu, J., and Zhang, W. J. (2010) Fructose-1,6-Bisphosphatase Regulates Glucose-Stimulated Insulin Secretion of Mouse Pancreatic Beta-Cells. Endocrinology. 151, 4688-4695.

  6. WARBURG, O. (1956) On the Origin of Cancer Cells. Science. 123, 309-314.

  7. Li, J., Wang, Y., Li, Q. G., Xue, J. J., Wang, Z., Yuan, X., Tong, J. D., and Xu, L. C. (2016) Downregulation of FBP1 Promotes Tumor Metastasis and Indicates Poor Prognosis in Gastric Cancer Via Regulating Epithelial-Mesenchymal Transition. PLoS One. 11, e0167857.

  8. Sheng, H., Ying, L., Zheng, L., Zhang, D., Zhu, C., Wu, J., Feng, J., and Su, D. (2015) Down Expression of FBP1 is a Negative Prognostic Factor for Non-Small-Cell Lung Cancer. Cancer Invest. 33, 197-204.

  9. Zhang, J., Wang, J., Xing, H., Li, Q., Zhao, Q., and Li, J. (2016) Down-Regulation of FBP1 by ZEB1-Mediated Repression Confers to Growth and Invasion in Lung Cancer Cells. Mol Cell Biochem. 411, 331-340.

  10. Li, K., Ying, M., Feng, D., Du, J., Chen, S., Dan, B., Wang, C., and Wang, Y. (2016) Fructose-1,6-Bisphosphatase is a Novel Regulator of Wnt/beta-Catenin Pathway in Breast Cancer. Biomed Pharmacother. 84, 1144-1149.

  11. Hirata, H., Sugimachi, K., Komatsu, H., Ueda, M., Masuda, T., Uchi, R., Sakimura, S., Nambara, S., Saito, T., Shinden, Y., Iguchi, T., Eguchi, H., Ito, S., Terashima, K., Sakamoto, K., Hirakawa, M., Honda, H., and Mimori, K. (2016) Decreased Expression of Fructose-1,6-Bisphosphatase Associates with Glucose Metabolism and Tumor Progression in Hepatocellular Carcinoma. Cancer Res. 76, 3265-3276.

  12. Alderton, G. K. (2014) Tumorigenesis: FBP1 is Suppressed in Kidney Tumours. Nat Rev Cancer. 14, 575.

  13. Li, B., Qiu, B., Lee, D. S., Walton, Z. E., Ochocki, J. D., Mathew, L. K., Mancuso, A., Gade, T. P., Keith, B., Nissim, I., and Simon, M. C. (2014) Fructose-1,6-Bisphosphatase Opposes Renal Carcinoma Progression. Nature. 513, 251-255.

  14. Ning, X. H., Li, T., Gong, Y. Q., He, Q., Shen, Q. I., Peng, S. H., Wang, J. Y., Chen, J. C., Guo, Y. L., and Gong, K. (2016) Association between FBP1 and Hypoxia-Related Gene Expression in Clear Cell Renal Cell Carcinoma. Oncol Lett. 11, 4095-4098.

  15. Baker, L., and Winegrad, A. I. (1970) Fasting Hypoglycaemia and Metabolic Acidosis Associated with Deficiency of Hepatic Fructose-1,6-Diphosphatase Activity. Lancet. 2, 13-16.

  16. Kikawa, Y., Inuzuka, M., Jin, B. Y., Kaji, S., Koga, J., Yamamoto, Y., Fujisawa, K., Hata, I., Nakai, A., Shigematsu, Y., Mizunuma, H., Taketo, A., Mayumi, M., and Sudo, M. (1997) Identification of Genetic Mutations in Japanese Patients with Fructose-1,6-Bisphosphatase Deficiency. Am J Hum Genet. 61, 852-861.

  17. Matsuura, T., Chinen, Y., Arashiro, R., Katsuren, K., Tamura, T., Hyakuna, N., and Ohta, T. (2002) Two Newly Identified Genomic Mutations in a Japanese Female Patient with Fructose-1,6-Bisphosphatase (FBPase) Deficiency. Mol Genet Metab. 76, 207-210.

  18. Ijaz, S., Zahoor, M. Y., Imran, M., Ramzan, K., Bhinder, M. A., Shakeel, H., Iqbal, M., Aslam, A., Shehzad, W., Cheema, H. A., and Rehman, H. (2017) Genetic Analysis of Fructose-1,6-Bisphosphatase (FBPase) Deficiency in Nine Consanguineous Pakistani Families. J Pediatr Endocrinol Metab. 30, 1203-1210.

  19. Lebigot, E., Brassier, A., Zater, M., Imanci, D., Feillet, F., Therond, P., de Lonlay, P., and Boutron, A. (2015) Fructose 1,6-Bisphosphatase Deficiency: Clinical, Biochemical and Genetic Features in French Patients. J Inherit Metab Dis. 38, 881-887.

  20. Eren, E., Edgunlu, T., Abuhandan, M., and Yetkin, I. (2013) Novel Fructose-1,6-Bisphosphatase Gene Mutation in Two Siblings. DNA Cell Biol. 32, 635-639.

  21. Moon, S., Kim, J. H., Han, J. H., Ko, S. H., Ahn, Y. B., Kim, J. H., Yang, S. H., and Song, K. H. (2011) Novel Compound Heterozygous Mutations in the Fructose-1,6-Bisphosphatase Gene Cause Hypoglycemia and Lactic Acidosis. Metabolism. 60, 107-113.

  22. Faiyaz-Ul-Haque, M., Al-Owain, M., Al-Dayel, F., Al-Hassnan, Z., Al-Zaidan, H., Rahbeeni, Z., Al-Sayed, M., Balobaid, A., Cluntun, A., Toulimat, M., Abalkhail, H., Peltekova, I., and Zaidi, S. H. (2009) Novel FBP1 Gene Mutations in Arab Patients with Fructose-1,6-Bisphosphatase Deficiency. Eur J Pediatr. 168, 1467-1471.

  23. Buhrdel, P., Bohme, H. J., and Didt, L. (1990) Biochemical and Clinical Observations in Four Patients with Fructose-1,6-Diphosphatase Deficiency. Eur J Pediatr. 149, 574-576.

  24. Visinoni, S., Fam, B. C., Blair, A., Rantzau, C., Lamont, B. J., Bouwman, R., Watt, M. J., Proietto, J., Favaloro, J. M., and Andrikopoulos, S. (2008) Increased Glucose Production in Mice Overexpressing Human Fructose-1,6-Bisphosphatase in the Liver. Am J Physiol Endocrinol Metab. 295, E1132-41.

  25. Kebede, M., Favaloro, J., Gunton, J. E., Laybutt, D. R., Shaw, M., Wong, N., Fam, B. C., Aston-Mourney, K., Rantzau, C., Zulli, A., Proietto, J., and Andrikopoulos, S. (2008) Fructose-1,6-Bisphosphatase Overexpression in Pancreatic Beta-Cells Results in Reduced Insulin Secretion: A New Mechanism for Fat-Induced Impairment of Beta-Cell Function. Diabetes. 57, 1887-1895.