Phenotypic Mutation 'Park7'

• Allele: Park7
• Mutation Type: nonsense
• Chromosome: 11
• Coordinate: 59,438,836 bp (GRCm39)
• Base Change: C ⇒ T (forward strand)
• Gene: Nlrp3
• Gene Name: NLR family, pyrin domain containing 3
• Synonym(s): Mmig1, Cias1, NALP3, cryopyrin, Pypaf1
• Chromosomal Location: 59,432,395-59,457,781 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pyrin-like protein containing a pyrin domain, a nucleotide-binding site (NBS) domain, and a leucine-rich repeat (LRR) motif. This protein interacts with the apoptosis-associated speck-like protein PYCARD/ASC, which contains a caspase recruitment domain, and is a member of the NALP3 inflammasome complex. This complex functions as an upstream activator of NF-kappaB signaling, and it plays a role in the regulation of inflammation, the immune response, and apoptosis. Mutations in this gene are associated with familial cold autoinflammatory syndrome (FCAS), Muckle-Wells syndrome (MWS), chronic infantile neurological cutaneous and articular (CINCA) syndrome, and neonatal-onset multisystem inflammatory disease (NOMID). Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Alternative 5' UTR structures are suggested by available data; however, insufficient evidence is available to determine if all of the represented 5' UTR splice patterns are biologically valid. [provided by RefSeq, Oct 2008] ; PHENOTYPE: Mice homozygous for null mutations exhibit attenuated inflammatory responses related to decrease secretion of IL-1beta and IL-18. Mice heterozygous for activating mutations suffer from autoinflammatory attacks that lead to organ failure and death before weaning. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Arginine changed to Stop codon
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000078440] [ENSMUSP00000098707] [ENSMUSP00000114231]
• AlphaFold: Q8R4B8
• SMART Domains: Protein: ENSMUSP00000078440; Gene: ENSMUSG00000032691; AA Change: R138*

Domain	Start	End	E-Value	Type
PYRIN	4	87	6.39e-33	SMART
FISNA	135	206	1.45e-22	SMART
Pfam:NACHT	216	385	6.7e-52	PFAM
low complexity region	533	539	N/A	INTRINSIC
low complexity region	688	697	N/A	INTRINSIC
LRR_RI	737	764	1.07e-9	SMART
LRR	766	793	5.13e1	SMART
LRR	794	821	3.86e-7	SMART
LRR	823	850	1.62e0	SMART
LRR	851	878	3.39e-3	SMART
LRR	880	907	1.2e2	SMART
LRR	908	935	2.24e-3	SMART
LRR	937	964	2.16e2	SMART
LRR	965	992	8.73e-6	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000098707; Gene: ENSMUSG00000032691; AA Change: R138*

Domain	Start	End	E-Value	Type
PYRIN	4	87	6.39e-33	SMART
FISNA	135	206	1.45e-22	SMART
Pfam:NACHT	216	385	6.7e-52	PFAM
low complexity region	533	539	N/A	INTRINSIC
low complexity region	688	697	N/A	INTRINSIC
LRR_RI	737	764	1.07e-9	SMART
LRR	766	793	5.13e1	SMART
LRR	794	821	3.86e-7	SMART
LRR	823	850	1.62e0	SMART
LRR	851	878	3.39e-3	SMART
LRR	880	907	1.2e2	SMART
LRR	908	935	2.24e-3	SMART
LRR	937	964	2.16e2	SMART
LRR	965	992	8.73e-6	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000114231; Gene: ENSMUSG00000032691; AA Change: R138*

Domain	Start	End	E-Value	Type
PYRIN	4	87	6.39e-33	SMART
Pfam:FISNA	135	173	1.6e-12	PFAM

• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9755
• Is this an essential gene?: Probably nonessential (E-score: 0.079)
• Phenotypic Category: Autosomal Semidominant
• Mode of Inheritance: Autosomal Semidominant
• Local Stock: Sperm
• Last Updated: 2019-09-04 9:43 PM by Diantha La Vine
• Record Created: 2016-03-23 9:19 PM by Hexin Shi
• Record Posted: 2016-05-06
• Science Writers: Anne Murray
• Illustrators: Katherine Timer
• Authors: Hexin Shi and Bruce Beutler

Accession Number

NCBI RefSeq: NM_145827; MGI:2653833

Alleles Listed at MGI

All Mutations and Alleles(21) : Chemically induced (ENU)(9) Chemically induced (other)(1) Targeted(11)

Phenotypic Description

Figure 1. Park7 mice exhibited diminished IL-1β secretion in response to priming with lipopolysaccharide (LPS) followed by nigericin treatment. IL-1β levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Park7 phenotype was identified among N-nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R4305, some of which showed a decreased secretion of the proinflammatory cytokine interleukin (IL)-1β in response to priming with lipopolysaccharide (LPS) followed by nigericin treatment (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced IL-1β secretion after nigericin treatment using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 31 mutations (X-axis) identified in the G1 male of pedigree R4305. Normalized phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 31 mutations. The impaired inflammasome response was linked by continuous variable mapping to a mutation in Nlrp3:  a C to T transition at base pair 59,548,010 (v38) on chromosome 11, or base pair 6,442 in the GenBank genomic region NC_000077.  Linkage was found with an additive model of inheritance (P = 2.239 x 10^-7), wherein 8 variant homozygotes and 15 heterozygotes departed phenotypically from 10 homozygous reference mice (Figure 2).  

The mutation corresponds to residue 638 in the mRNA sequence NM_145827 within exon 4 of 10 total exons.

623 TGTAAGATGTACAGACGACATGTGAGAAGCAGG 133 -C--K--M--Y--R--R--H--V--R--S--R-

The mutated nucleotide is indicated in red.  The mutation results in substitution of arginine (R) 138 to a premature stop codon (R138*) in the NLRP3 protein.

Protein Prediction

Figure 3. Domain structure of NLRP3. Shown are the pyrin domain (PYD), NACHT domain, NACHT-associated domain (NAD), and leucine-rich repeat (LRR) domain. Together, the NACHT and NAD domains are known as the nucleotide-binding domain (NBD). The Park7 mutation results in substitution of arginine 138 to a premature stop codon. This image is interactive. Other mutations found in NLRP3 are noted in red. Click on each mutation for more specific information.

The Nlrp3 gene encodes a 1,033 amino acid protein that is a member of the nucleotide-binding and oligomerization domain (NOD)-like receptor (NLR) or CATERPILLER [for CARD, transcription enhancer, R(purine)-binding, pyrin, lots of leucine repeats] family [Figure 3; (1)]. NLRP3 has a pyrin domain (PYD) at the N-terminus (amino acids 1-91). NLRP3 has a C-terminal leucine-rich repeat (LRR) domain (amino acids 739-988), a central oligomerization NACHT usually with a C-terminal extension known as the NACHT associated domain (NAD) that together comprise a nucleotide-binding domain (NBD; amino acids 216-532), and an N-terminal effector domain. The N-terminus of NLRP3 contains a pyrin domain (PYD; amino acids 1-91). The Park7 mutation results in substitution of arginine (R) 138 to a premature stop codon (R138*); Arg138 is within an undefined region between the PYD and NACHT domains.

For more information about Nlrp3, please see the record for ND1.

Putative Mechanism

NLRP3 is able to oligomerize through its NBD domain and assemble into large caspase-1-activating multiprotein complexes termed inflammasomes upon the detection of pathogenic or other danger signals in the cytoplasm. A large variety of agents have been shown to activate the NLRP3 inflammasome, and NLRP3 plays an important role in the innate immune response. Mutations within the NBD have been shown to reduce ATP binding, as well as NLRP3 protein function including caspase-1 activation, IL-1β production, cell death, macromolecular complex formation, self-association, and association with apoptosis-associated speck-like protein (ASC). The phenotype of the Park7 mice suggests that the mutated protein, if expressed, is inactive or has reduced activity.  

Primers

PCR Primer
Park7_pcr_F: CAATGACGACAGCTCGCTCTATAC
Park7_pcr_R: GGCTGTCCCGCATTTTAGTC

Sequencing Primer
Park7_seq_F: GCTTCTAGTTGACAGTCAGCAC
Park7_seq_R: CGCATTTTAGTCCGGCCGATG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 403 nucleotides is amplified (chromosome 11, + strand):

1   caatgacgac agctcgctct atacatttga atgtttagtg agctcattgc ttctagttga
61  cagtcagcac cctgcatttt gttgttgttg ttcgtaaatc ctttcaattc ttaatgttcc
121 ccctgtaaca gcagaggtcc gctagcagct tattgttggg gaatggatgt gtgggctttt
181 cctggatccc gcctttctgt ctctgctgca gattactgta agatgtacag acgacatgtg
241 agaagcaggt tctactctat caaggacagg aacgcgcgtc taggtgagag tgtggacctc
301 aacagtcgct acacgcagct ccaactggtc aaggagcatc caagcaagca ggagcgggag
361 catgaactcc tgaccatcgg ccggactaaa atgcgggaca gcc

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

1. Ting, J. P., Lovering, R. C., Alnemri, E. S., Bertin, J., Boss, J. M., Davis, B. K., Flavell, R. A., Girardin, S. E., Godzik, A., Harton, J. A., Hoffman, H. M., Hugot, J. P., Inohara, N., Mackenzie, A., Maltais, L. J., Nunez, G., Ogura, Y., Otten, L. A., Philpott, D., Reed, J. C., Reith, W., Schreiber, S., Steimle, V., and Ward, P. A. (2008) The NLR Gene Family: A Standard Nomenclature. Immunity. 28, 285-287.