Phenotypic Mutation 'pia' (pdf version)
Allelepia
Mutation Type missense
Chromosome16
Coordinate17,281,044 bp (GRCm38)
Base Change C ⇒ T (forward strand)
Gene Pi4ka
Gene Name phosphatidylinositol 4-kinase alpha
Synonym(s) Pik4ca
Chromosomal Location 17,280,351-17,406,314 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylinositol (PI) 4-kinase which catalyzes the first committed step in the biosynthesis of phosphatidylinositol 4,5-bisphosphate. The mammalian PI 4-kinases have been classified into two types, II and III, based on their molecular mass, and modulation by detergent and adenosine. The protein encoded by this gene is a type III enzyme that is not inhibited by adenosine. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a targeted knock-out or knock-in conditionally activated exhibit premature death associated with degeneration of mucosal cells in the stomach and intestines. Mice homozygous for a knock-out allele exhibit early embryonic lethality. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001001983; MGI:2448506

Mapped Yes 
Amino Acid Change Arginine changed to Histidine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000036162] [ENSMUSP00000068902] [ENSMUSP00000122550] [ENSMUSP00000123791] [ENSMUSP00000124757] [ENSMUSP00000125715] [ENSMUSP00000123710] [ENSMUSP00000123917] [ENSMUSP00000124217] [ENSMUSP00000131127] [ENSMUSP00000156049] [ENSMUSP00000156052]
SMART Domains Protein: ENSMUSP00000036162
Gene: ENSMUSG00000041720
AA Change: R1992H

DomainStartEndE-ValueType
low complexity region 198 221 N/A INTRINSIC
low complexity region 243 253 N/A INTRINSIC
SCOP:d1gw5a_ 268 675 2e-3 SMART
low complexity region 895 907 N/A INTRINSIC
PI3Ka 1483 1671 2.11e-54 SMART
Blast:PI3Kc 1688 1762 2e-39 BLAST
PI3Kc 1788 2041 4.04e-106 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
(Using ENSMUST00000036161)
SMART Domains Protein: ENSMUSP00000122550
Gene: ENSMUSG00000041720
AA Change: R1992H

DomainStartEndE-ValueType
low complexity region 198 221 N/A INTRINSIC
low complexity region 243 253 N/A INTRINSIC
SCOP:d1gw5a_ 268 675 2e-3 SMART
low complexity region 895 907 N/A INTRINSIC
PI3Ka 1483 1671 2.11e-54 SMART
Blast:PI3Kc 1688 1762 2e-39 BLAST
PI3Kc 1788 2041 4.04e-106 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
(Using ENSMUST00000154364)
SMART Domains Protein: ENSMUSP00000123156
Gene: ENSMUSG00000041720
AA Change: R157H

DomainStartEndE-ValueType
PI3Kc 57 207 1.3e-1 SMART
Predicted Effect
Predicted Effect probably damaging

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
(Using ENSMUST00000232232)
Meta Mutation Damage Score 0.722 question?
Is this an essential gene? Essential (E-score: 1.000) question?
Phenotypic Category
Phenotypequestion? Literature verified References
FACS CD44+ CD4 T cells - increased
FACS CD44+ T cells - increased
FACS central memory CD4 T cells in CD4 T cells - increased
FACS effector memory CD4 T cells in CD4 T cells - decreased
FACS effector memory CD8 T cells in CD8 T cells - increased
FACS naive CD4 T cells in CD4 T cells - decreased
LPS-induced Necroptosis - decreased
Macrophage necroptosis: low
MTT Value of PECs - decreased
NALP3 inflammasome signaling defect
NLRP3 inflammasome: high response
TLR signaling defect: hyposensitivity to LPS
TLR signaling defect: hyposensitivity to PAM3CSK4
TLR signaling defect: TNF production by macrophages
Candidate Explorer Status CE: good candidate; human score: -4; ML prob: 0.5592
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(28) : Gene trapped(21) Targeted(7)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Pi4ka APN 16 17308144 missense probably benign
IGL00984:Pi4ka APN 16 17358932 nonsense probably null
IGL01066:Pi4ka APN 16 17348773 splice site probably benign
IGL01460:Pi4ka APN 16 17357651 missense probably damaging 1.00
IGL01505:Pi4ka APN 16 17309358 missense probably benign 0.22
IGL01518:Pi4ka APN 16 17280735 missense probably benign 0.03
IGL01533:Pi4ka APN 16 17308201 missense probably benign 0.30
IGL01565:Pi4ka APN 16 17389442 utr 5 prime probably benign
IGL01679:Pi4ka APN 16 17296888 splice site probably benign
IGL01685:Pi4ka APN 16 17325202 missense probably benign 0.09
IGL01734:Pi4ka APN 16 17297260 missense probably benign 0.23
IGL01799:Pi4ka APN 16 17389371 missense probably damaging 1.00
IGL01969:Pi4ka APN 16 17378483 missense probably benign 0.15
IGL02092:Pi4ka APN 16 17318496 missense probably benign 0.00
IGL02113:Pi4ka APN 16 17373415 missense probably benign 0.00
IGL02177:Pi4ka APN 16 17318282 missense probably benign 0.09
IGL02400:Pi4ka APN 16 17293884 missense probably damaging 0.98
IGL02426:Pi4ka APN 16 17378432 splice site probably benign
IGL02474:Pi4ka APN 16 17325429 missense probably damaging 1.00
IGL02587:Pi4ka APN 16 17317353 missense probably damaging 1.00
IGL02667:Pi4ka APN 16 17295461 missense possibly damaging 0.82
IGL02698:Pi4ka APN 16 17291168 missense probably damaging 1.00
IGL02815:Pi4ka APN 16 17358889 splice site probably benign
IGL02828:Pi4ka APN 16 17280711 intron probably benign
IGL02939:Pi4ka APN 16 17354210 missense probably damaging 0.97
IGL03123:Pi4ka APN 16 17282675 missense possibly damaging 0.95
IGL03148:Pi4ka APN 16 17354189 missense probably damaging 0.99
arachnoid UTSW 16 17285281 unclassified probably benign
mia UTSW 16 17376982 missense possibly damaging 0.89
IGL03098:Pi4ka UTSW 16 17326027 missense probably damaging 1.00
R0024:Pi4ka UTSW 16 17315535 splice site probably benign
R0054:Pi4ka UTSW 16 17325114 missense probably null 1.00
R0054:Pi4ka UTSW 16 17325114 missense probably null 1.00
R0243:Pi4ka UTSW 16 17297635 missense probably benign 0.44
R0374:Pi4ka UTSW 16 17282932 unclassified probably benign
R0478:Pi4ka UTSW 16 17309311 missense possibly damaging 0.92
R0548:Pi4ka UTSW 16 17307718 missense possibly damaging 0.75
R0626:Pi4ka UTSW 16 17293901 missense probably benign 0.00
R0918:Pi4ka UTSW 16 17285260 missense possibly damaging 0.61
R1082:Pi4ka UTSW 16 17389352 missense probably damaging 1.00
R1384:Pi4ka UTSW 16 17297537 splice site probably benign
R1455:Pi4ka UTSW 16 17363954 missense probably benign 0.02
R1479:Pi4ka UTSW 16 17373400 missense probably benign 0.08
R1490:Pi4ka UTSW 16 17386268 missense probably damaging 1.00
R1565:Pi4ka UTSW 16 17281900 missense probably null
R1594:Pi4ka UTSW 16 17373419 splice site probably benign
R1641:Pi4ka UTSW 16 17377030 missense probably benign 0.00
R1694:Pi4ka UTSW 16 17295376 missense probably damaging 0.99
R1828:Pi4ka UTSW 16 17280750 missense probably benign 0.00
R1864:Pi4ka UTSW 16 17367525 nonsense probably null
R2036:Pi4ka UTSW 16 17303112 missense probably damaging 1.00
R2151:Pi4ka UTSW 16 17367507 missense probably benign 0.44
R2844:Pi4ka UTSW 16 17350793 missense probably damaging 0.97
R2876:Pi4ka UTSW 16 17367550 missense possibly damaging 0.77
R3953:Pi4ka UTSW 16 17285281 unclassified probably benign
R3972:Pi4ka UTSW 16 17293875 missense probably damaging 1.00
R4357:Pi4ka UTSW 16 17367439 missense probably benign 0.00
R4385:Pi4ka UTSW 16 17386265 missense probably benign 0.13
R4427:Pi4ka UTSW 16 17281044 missense probably damaging 1.00
R4436:Pi4ka UTSW 16 17282382 missense probably damaging 1.00
R4677:Pi4ka UTSW 16 17282373 missense probably damaging 1.00
R4683:Pi4ka UTSW 16 17297037 missense possibly damaging 0.73
R4736:Pi4ka UTSW 16 17377175 missense probably benign 0.12
R4804:Pi4ka UTSW 16 17308161 missense possibly damaging 0.75
R4886:Pi4ka UTSW 16 17358361 missense probably damaging 0.98
R4893:Pi4ka UTSW 16 17377036 missense probably benign 0.21
R4896:Pi4ka UTSW 16 17377169 missense probably damaging 1.00
R5004:Pi4ka UTSW 16 17377169 missense probably damaging 1.00
R5015:Pi4ka UTSW 16 17303082 missense possibly damaging 0.56
R5062:Pi4ka UTSW 16 17309397 missense probably benign 0.02
R5104:Pi4ka UTSW 16 17281050 missense probably damaging 1.00
R5160:Pi4ka UTSW 16 17323053 missense probably benign 0.01
R5173:Pi4ka UTSW 16 17350906 missense possibly damaging 0.95
R5204:Pi4ka UTSW 16 17359045 missense possibly damaging 0.68
R5307:Pi4ka UTSW 16 17323030 missense probably benign 0.00
R5327:Pi4ka UTSW 16 17325413 missense probably damaging 1.00
R5506:Pi4ka UTSW 16 17293953 missense probably damaging 0.96
R5580:Pi4ka UTSW 16 17281087 missense probably damaging 1.00
R5768:Pi4ka UTSW 16 17354872 missense probably benign 0.29
R5857:Pi4ka UTSW 16 17358984 missense probably benign 0.00
R5951:Pi4ka UTSW 16 17303142 missense probably damaging 1.00
R5953:Pi4ka UTSW 16 17281951 missense probably damaging 1.00
R6041:Pi4ka UTSW 16 17360572 missense probably benign
R6223:Pi4ka UTSW 16 17357571 nonsense probably null
R6416:Pi4ka UTSW 16 17358322 missense probably benign 0.22
R6535:Pi4ka UTSW 16 17301036 missense probably damaging 1.00
R6580:Pi4ka UTSW 16 17350830 missense probably damaging 1.00
R6720:Pi4ka UTSW 16 17326052 splice site probably null
R6723:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6725:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6752:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6753:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6755:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6767:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6768:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6782:Pi4ka UTSW 16 17325988 missense probably damaging 1.00
R6782:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6788:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6849:Pi4ka UTSW 16 17303421 missense possibly damaging 0.54
R6958:Pi4ka UTSW 16 17325227 missense probably damaging 1.00
R7014:Pi4ka UTSW 16 17297067 unclassified probably benign
R7055:Pi4ka UTSW 16 17317015 utr 3 prime probably benign
U24488:Pi4ka UTSW 16 17325176 missense probably damaging 0.96
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2019-02-13 4:23 PM by Diantha La Vine
Record Created 2016-03-24 9:47 AM by Bruce Beutler
Record Posted 2018-09-07
Phenotypic Description
Figure 1. Pia mice exhibited reduced MTT values of peritoneal exudate cells. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The pia phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4427, some of which showed reduced MTT values of peritoneal exudate cells (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced MTT values of peritoneal exudate cellsusing a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 46 mutations (X-axis) identified in the G1 male of pedigree R4427. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Figure 3. CRISPR-Pi4ka mice exhibited reduced MTT values of peritoneal exudate cells. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Whole exome HiSeq sequencing of the G1 grandsire identified 46 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Pi4ka: a G to A transition at base pair 17,281,044 (v38) on chromosome 16, or base pair 125,271 in the GenBank genomic region NC_000082 encoding Pi4ka. Linkage was found with a recessive model of inheritance, wherein seven variant homozygotes departed phenotypically from 25 homozygous reference mice and 23 heterozygous mice with a P value of 4.02x 10-5 (Figure 2).  

 

The mutation corresponds to residue 6,053 in the mRNA sequence NM_001001983 within exon 53 of 55 total exons.

 

6037 GGCCTGCCCTGTTTTCGTGGCCAGACAATCAAA
1987 -G--L--P--C--F--R--G--Q--T--I--K-
 

The mutated nucleotide is indicated in red. The mutation results in an arginine (R) to histidine (H) substitution at position 1,992 (R1992H) in the PI4KA protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.997).

 

The causative mutation for the MTT phenotype was validated to be in Pi4ka by CRISPR-mediated replacement of the Pi4kaPia allele (Figure 3; P = 0.004752).

Protein Prediction
Figure 4. Domain organization of PI4KIIIα. The pia mutation results in an arginine to histidine substitution at position 1,992. This image is interactive. Other mutations found in PI4KIIIα. Click on each allele for more information. SH3: SRC Homology 3; NLS: Nuclear Localization Signal; LKU: Lipid Kinase Unique; PH: Pleckstrin Homology.

Pi4ka encodes phosphatidylinositol-4-kinase IIIα (PI4KIIIα; alternatively STT4), a member of the PI3/PI4 kinase family.

 

PI4KIIIα has a Src homology 3 (SH3) domain, two nuclear localization signals, a PI-3-kinase (PIK) accessory domain (alternatively, lipid kinase unique (LKU) domain), a pleckstrin homology (PH) domain, and a PI3K/PI4K catalytic domain (Figure 4). SH3 domains mediate protein-protein interactions, namely interactions with signaling proteins. The role of the PIK/LKU domain is unknown, but it is predicted to promote substrate presentation [SMART; (1)]. The PI4KIIIα PH domain binds PI 4-phosphate [PI(4)P] (2) and may contribute to product inhibition (3). The PI4KIIIα catalytic domain shares sequence similarities to other PI3K/PI3K family members.

 

Pik4a putatively produces two isoforms: a 230 kDa isoform (isoform 2) and a shorter splice variant that only contains the portion of the C-terminus containing the catalytic domain (isoform 1) (4-6). The shorter form of PI4KIIIα, if produced, is not predicted to be functional (6).

 

The pia mutation results in an arginine (R) to histidine (H) substitution at position 1,992 (R1992H); Arg1992 is within the catalytic domain.

Expression/Localization

Pi4ka is ubiquitously expressed, but is highly expressed in the brain (7-9). PI4KIIIα primarily localizes to the endoplasmic reticulum and the trans-Golgi network (4;6;7;10;11).

Background
Figure 5. PI4KIIIα involvement in the biosynthesis of PI(4,5)P₂. The headgroup of phosphatidylinositol (PI) can be phosphorylated at the D3, D4 and D5 positions by various kinases to generate eight higher phosphoinositides (PIs); PIs phosphorylated by PI 4-kinases (PI4Ks) are shown. Reverse (dephosphorylation) reactions catalysed by specific PI phosphatases are shown. Abbreviations: OCRL, inositol polyphosphate 5-phosphatase; PTEN, phosphatase and tensin homolog; PI(4)P, phosphatidylinositol 4-phosphate; PI(4,5)P2, phosphatidylinositol 4,5-bisphosphate; PI(3,4,5)P2, phosphatidylinositol 3,4,5-trisphosphate
Figure 6. Crystal structure of human PI4KIIIa lipid complex. A, Complex including Tetratricoprotein repeat protein 7B (TTC7B), PFAM 126A, and PI4KIIIa .B, Isolated PI4KIIIa protein. Domains are colored as in Figure 7. The pia mutation occurs in an unsolved section of the protein. This image in interactive. Click on Panel B to view the structure rotate. UCSF Chimera model is based on PDB 6BQ1.

PI4KIIIα is one of four enzymes that catalyzes the first step in the biosynthesis of phosphatidylinositol 4,5-bisphosphate [PI(4,5)P₂] by phosphorylating PI at the 4-position of the inositol ring to form PI(4)P (Figure 5) (10). PI(4)P regulates membrane trafficking at several steps and the surface delivery of apically and basolaterally destined proteins in polarized cells. In the metabolism of D4 phosphorylated PIs, PI(4)P is subsequently phosphorylated by PI(4)P 5-kinases to form PI(4,5)P₂. PI(4,5)P₂ can subsequently be phosphorylated by PI3Ks to form PI(3,4,5)P3. PI(3,4,5)P3 can then be converted to PI(3,4)P2.

 

PI4KIIIα is part of a complex with TTC7, FAM126, and EFR3 [Figure 6; PDB: 6BQ1; (10;12-14)]. EFR3 is a peripheral plasma membrane protein that recruits PI4KIIIα via the TTC7/FAM126 heterodimer. The plasma membrane protein TMEM150A regulates PI(4,5)P₂ production by reducing the association of TTC7 with the EFR3-PI4KIIIα complex (15).

 

PI4KIIIα is required for protein trafficking from the endoplasmic reticulum to the plasma membrane (16). PI4KIIIα also promotes the PI(4)P-mediated recruitment of the guanine nucleotide exchange factor GBF1 (Golgi-specific brefeldin A resistance guanine nucleotide exchange factor 1) to Golgi membranes (17). At the Golgi membrane, GBF1 activates Arf1 (ADP ribosylation factor-1) through the conversion of Arf1 from a GDP-bound to a GTP-bound state (18). ARF1 is required for the formation of trafficking vesicles for sorting and trafficking cargo from the Golgi apparatus to several cellular destinations including the lysosome and plasma membrane (19).

 

PI4KIIIα is a host cell factor for hepatitis C virus replication (20-23). PI4KIIIα regulates viral RNA replication by favoring p56 or repressing p58 synthesis as well as promoting the enrichment of PI(4)P to the hepatitis C virus-containing membranous web in the host cell (24;25). PI4KIIIα also regulates the phosphorylation of hepatitis C virus nonstructural protein 5A (NS5A) (24-26). PI4KIIIα is required for NS5A-mediated mitochondrial fragmentation in host cells, which subsequently makes cells more resistant to mitochondrial-mediated apoptosis (27).

 

PI4KIIIα was identified as a factor in hematopoiesis, namely in erythroid and myeloid maturation, in a forward genetic screen using Sleeping Beauty (SB) transposon mutagenesis (28). Pi4ka mutant spleens had less lymphocytic, more hematopoietic stem cells, and more common myeloid progenitor features when compared with controls. During hematopoiesis, PI4KIIIα putatively functions in maintaining the balance between phosphorylated AKT and phosphorylated ERK downstream of the IL-3 receptor and cKit (see the record for pretty2). Knockdown of PI4KIIIα in the mouse myeloid lineage cell line 32D caused increased phosphorylation of ERK, but reduced IL-3-induced phosphorylation of AKT.

 

Mutations in PIK4A are associated with perisylvian polymicrogyria, cerebellar hypoplasia, and arthrogryposis (PMGYCHA; OMIM: #616531(29). Perisylvian polymicrogyria is a neurological condition that affects the cerebral cortex due to impaired neuronal migration. Patients with perisylvian polymicrogyria exhibit partial paralysis of muscles of the face, tongue, jaws, and throat, which causes speaking, chewing, and swallowing difficulties. Arthrogryposis are congenital joint contractures.

 

Pi4ka-deficient mice exhibited early embryonic lethality (10). Homozygous mice expressing a kinase-defective PI4KIIIα were also lethal, exhibiting mucosal epithelial degeneration in the gastrointestinal tract (30). Mice with Schwann cell-specific deletion of Pi4ka showed myelination defects as well as reduced levels of the lipids phosphatidylserine, phosphatidylethanolamine, and sphingomyelin in the nerves (31).

Putative Mechanism

The phenotypes of the pia mice indicate loss of PI4KIIIαpia function. However, lethality was not observed in homozygous pia mice indicating that some function was retained.

Primers PCR Primer
pia(F):5'- GGCATTTGTGGGAATCTGCC -3'
pia(R):5'- ATAGTGCTATATGTGGTCCTGCTAG -3'

Sequencing Primer
pia_seq(F):5'- CCCAGGGACATTATGCTGTG -3'
pia_seq(R):5'- TCCTGCTAGCAGATTGTATGGAGAAG -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsCristhiaan D. Ochoa, Ying Wang, Zhao Zhang, and Bruce Beutler