Phenotypic Mutation 'Modest'

• Allele: Modest
• Mutation Type: missense
• Chromosome: 13
• Coordinate: 55,314,064 bp (GRCm39)
• Base Change: G ⇒ A (forward strand)
• Gene: Fgfr4
• Gene Name: fibroblast growth factor receptor 4
• Synonym(s): Fgfr-4
• Chromosomal Location: 55,300,631-55,316,572 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor receptor family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. The genomic organization of this gene, compared to members 1-3, encompasses 18 exons rather than 19 or 20. Although alternative splicing has been observed, there is no evidence that the C-terminal half of the IgIII domain of this protein varies between three alternate forms, as indicated for members 1-3. This particular family member preferentially binds acidic fibroblast growth factor and, although its specific function is unknown, it is overexpressed in gynecological tumor samples, suggesting a role in breast and ovarian tumorigenesis. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Homozygotes for a targeted mutation are viable, healthy and overtly normal, except for a 10% weight reduction at weaning. Mice doubly homozygous for disruptions of Fgfr3 and Fgfr4 show novel phenotypes not seen in either single mutant, including dwarfismand defective respiratory alveogenesis. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Valine changed to Methionine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000005452]
• AlphaFold: no structure available at present
• SMART Domains: Protein: ENSMUSP00000005452; Gene: ENSMUSG00000005320; AA Change: V593M

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
IGc2	45	105	1.39e-11	SMART
IGc2	160	228	3.1e-18	SMART
IGc2	259	337	1.59e-6	SMART
low complexity region	369	387	N/A	INTRINSIC
low complexity region	416	446	N/A	INTRINSIC
TyrKc	464	740	1.67e-148	SMART
low complexity region	764	795	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000005452)
• Meta Mutation Damage Score: 0.9088
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Semidominant
• Mode of Inheritance: Autosomal Semidominant
• Last Updated: 2019-09-04 9:43 PM by Diantha La Vine
• Record Created: 2016-04-05 9:23 PM
• Record Posted: 2018-04-11
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine, Katherine Timer
• Authors: Emre Turer, Xue Zhong, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_008011; MGI:95525

Alleles Listed at MGI

All Mutations and Alleles(8) : Chemically induced (other)(1) Targeted(7)

Phenotypic Description

Figure 1. Modest mice exhibit reduced body weights compared to wild-type littermates. Scaled weight are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Modest mice exhibit decreased frequencies of peripheral B1a cells in B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1a cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Modest phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4255, some of which showed reduced body weights compared to wild-type littermates (Figure 1) and reduced frequencies of B1a cells in B1 cells (Figure 2).

Nature of Mutation

Figure 3. Linkage mapping of the reduced body weight phenotype using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 49 mutations (X-axis) identified in the G1 male of pedigree R4255. Weight data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 49 mutations. Both of the above anomalies were linked to a mutation in Fgfr4: a G to A transversion at base pair 55,166,251 (v38) on chromosome 13, or base pair 13,434 in the GenBank genomic region NC_000079 encoding Fgfr4. The strongest association was found with an additive model of inheritance to the body weight phenotype, wherein five variant homozygotes and 15 heterozygous mice departed phenotypically from 14 homozygous reference mice with a P value of 6.228 x 10^-6 (Figure 3).  

The mutation corresponds to residue 1,939 in the mRNA sequence NM_008011 within exon 13 of 18 total exons.

1924 TCCTGTGCCTACCAGGTGGCCCGAGGCATGCAG 588  -S--C--A--Y--Q--V--A--R--G--M--Q-

The mutated nucleotide is indicated in red.  The mutation results in a valine (V) to methionine (M) substitution at position 593 (V593M) in the FGFR4 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction

Figure 4. Domain organization of FGFR4. FGFR4 is a single-pass transmembrane protein with three extracellular immunoglobulin-like domains and a cytoplasmic tyrosine kinase domain. The location of the Modest mutation is indicated. Domain information is from SMART and UniProt.

Fibroblast growth factor receptor-4 (FGFR4; alternatively JTK2 or CD334) is a member of the FGFR family. There are four members of the FGFR family: FGFR1, FGFR2, FGFR3, and FGFR4. The FGFRs are receptor tyrosine kinases. FGFR4 is a single-pass transmembrane protein with three extracellular immunoglobulin-like domains and a cytoplasmic tyrosine kinase domain (Figure 4) (1).

FGFR4 undergoes posttranslational modifications. FGFR4 is N-glycosylated on several sites, including Asn109, Asn255, Asn287, Asn308, and Asn319 (locations in mouse FGFR4) (2;3). FGFR4 glycosylation mediates high affinity interactions with ligands. FGFR4 is also ubiquitinated, and is subject to proteasomal degradation when not fully glycosylated. FGFR4 is trans-autophosphorylated at Tyr639, Tyr640, and Tyr751 (locations in mouse FGFR4) in the intracellular domain upon ligand binding.

There are additional splice forms of Fgfr4. One isoform lacks exon 16 [designated FGFR4(-16)], which causes a deletion within the kinase domain (2). Two additional splice forms occur after alternative splicing of intron 17 (4). The FGFR4-17a isoform includes 31 3’-nucleotides of intron 17, while the FGFR4-17b isoform includes all of the nucleotides of intron 17. Both the FGFR4-17a and FGFR4-17b proteins have truncated C-terminal tails due to coding of a premature stop codon.

The Modest mutation results in a valine (V) to methionine (M) substitution at position 593 (V593M) in the FGFR4 protein; amino acid 593 is within the kinase domain.

Expression/Localization

FGFR4 is expressed in the lung, kidney, brain, liver, pancreas, intestine, striated muscle, adrenal glands, and spleen as well as various types of tumors (5-8).

Expression of FGFR4(-16) is similar to that of full-length FGFR4 (2). FGFR4-17a and FGFR4-17b cDNAs are highly expressed in the kidney, muscle, liver, and cochlear material, with lower expression in the heart, brain, and vestibular epithelium (4).

Background

Figure 5. FGFR-associated signaling. The FGF–FGFR complex consists of a receptor homodimer, the FGF ligand, and a heparan sulfate proteoglycan (HSPG). The HSPG stabilizes and sequesters FGFs. After ligand binding and FGFR dimerization, the kinase domains transphosphorylate each other, leading to the docking of adapter proteins and the activation of downstream pathways. Figure and legend adapted from Kelleher et al. (2013) .

FGFR-associated signaling controls several cellular events, including cell proliferation, differentiation and survival [Figure 5; reviewed in (9)]. Binding of FGFs (e.g., FGF3 [see the record for porkchop] and FGF5 [see the record for porcupine]) to FGFRs induces receptor dimerization and subsequent trans-autophosphorylation. FGFR4 has highest binding affinity for FGF1 (alternatively, acidic FGF [aFGF]), followed by FGF4 (alternatively, kFGF/HST1) and FGF2 (alternatively, bFGF); FGFR4 can also bind FGF6, FGF8, FGF19, FGF21, and FGF15 (10-16). The phosphorylated tyrosines on the FGFR serve as recruitment and binding sites for docking and signaling molecules, including PLCγ (phospholipase Cγ; see the record for queen) (17), Shc, FGFR substrate 2α (FRS2α) and FRS2β (18;19). The FRS2 proteins activate the growth factor receptor bound 2 (GRB2)/son of sevenless (SOS) 1 complex, which subsequently activates RAS and the downstream MAPK pathway when phosphorylated. GRB2 can also activate GRB2-associated binding protein-1 (GAB1), which recruits PI3K to activate the AKT pathway. The FGFRs can also activate the PLCγ pathway inducing hydrolysis of phosphatidylinositol-4,5-bisphosphate (PIP2) to phosphatidylinositol (3,4,5)-triphosphate (PIP3) and diacylglycerol (DAG). FGFR4 also interacts with IKKβ, a component of the NF-κB pathway, and is proposed to facilitate IKKβ phosphorylation and negative regulation of NF-κB signaling (20).

FGFR4 functions in cell migration, lipid metabolism (21), vitamin D metabolism, bile acid biosynthesis (15), glucose uptake (22), and phosphate homeostasis. FGFR4 putatively functions in muscle regeneration, but the precise function of FGFR4 during myogenesis is unknown (23;24). FGF19-induced activation of FGFR4 increases hepatocyte proliferation and can induce hepatocellular carcinoma formation (12;25). FGFR4 is also a ligand-dependent modulator of erythropoiesis (26).

Inappropriate activation of FGFR-associated signaling, either by amplification of FGF expression or activating mutations in FGFRs, may cause cell transformation and tumors (27;28).Patients expressing a Gly388Arg mutant FGFR4 exhibited enhanced metastasis and poor prognosis in breast, prostate, lung, pituitary, and colon cancers as well as in head and neck squamous cell carcinoma (29-33). The Gly388Arg substitution resulted in alteration of the transmembrane domain and subsequent exposure of a membrane-proximal cytoplasmic STAT3-binding site (390YPXXQ393), subsequently enhancing STAT3 membrane recruitment and its phosphorylation (30). Mouse embryonic fibroblasts from homozygous knock-in mice expressing a glycine to arginine substitution at amino acid 385 (i.e., mimicking the Gly388Arg human mutation) exhibited faster transformation and formed more foci after infection with an oncogene (34). Mutations in FGFR4 have also been associated with instances of rhabdomyosarcoma (35). Rhabdomyosarcoma-causing FGFR4 mutant proteins with mutations at K535 or E550 caused increased autophosphorylation, STAT3 signaling, tumor proliferation, and metastatic potential (35).

Putative Mechanism

Fgfr4-deficient (Fgfr4^-/-) mice are viable and fertile, but exhibited reduced body weights and reduced bone mineral content [(36) and MGI (accessed October 13, 2017)]. A second study found that Fgfr4^-/- mice had comparable body weights to wild-type controls as well as comparable body masses to wild-type mice, but the mice showed an increase in white adipose tissue mass (21). The Fgfr4^-/- mice exhibited elevated fasting plasma glucose levels, reduced glucose tolerance, hyperlipidemia, and increased insulin resistance (21). On a high-fat diet, the Fgfr4^-/- mice exhibited fatty livers (21). A third study found that Fgfr4^-/- mice had improved glucose metabolism, insulin sensitivity, and reduced body weights (13). The changes in glucose metabolism, insulin sensitivity, and body weights under high fat conditions observed in the Fgfr4^-/- mice were proposed to be due to increased plasma levels of adiponectin as well as the endocrine FGF factors FGF21 and FGF15 (the mouse ortholog of human FGF19) (13). In addition, the Fgfr4^-/- mice have depleted gallbladders, elevated excretion of bile acids, eleveated levels of cholesterol- and bile acid-controlled liver cholesterol 7α-hydroxylase (the limiting enzyme for bile synthesis, and an elevated bile acid pool (37). The Fgfr4^-/- mice exhibited cholate-dependent, cholesterol-induced hepatomegaly (37).

The phenotype of the Modest mice is similar to that observed in the Fgfr4^-/- mice, indicating loss of FGFR4^Modest function.

Primers

PCR Primer
Modest_pcr_F: GAATCAGATGCGCAGTTGGG
Modest_pcr_R: CAGGGTTAGCTGCAAATGTATGG

Sequencing Primer
Modest_seq_F: GGATGCAAAGGACCACTCTTGC
Modest_seq_R: TTAGCTGCAAATGTATGGGAATG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 407 nucleotides is amplified (chromosome 13, + strand):

1   gaatcagatg cgcagttggg atgcaaagga ccactcttgc cagacttccc atcccctggt
61  ccatggcttc cctctgtagg gcccctgtac gtgattgtgg aatgtgccgc caagggaaac
121 cttcgggaat tcctccgtgc ccggcgcccc ccaggccctg atctcagccc tgatggacct
181 cggagcagcg aaggaccact ctccttcccg gccctagtct cctgtgccta ccaggtggcc
241 cgaggcatgc agtatctgga gtctcggaag gtgtggacaa aggacagttg tgctggggtc
301 tccacacctt cttgctgggg gcactgaatg tcctcagcag cccccttgtt tccagctcac
361 aggtctatcc tttaaccatc attcccatac atttgcagct aaccctg

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Partanen, J., Makela, T. P., Eerola, E., Korhonen, J., Hirvonen, H., Claesson-Welsh, L., and Alitalo, K. (1991) FGFR-4, a Novel Acidic Fibroblast Growth Factor Receptor with a Distinct Expression Pattern. EMBO J. 10, 1347-1354.

  2. Kwiatkowski, B. A., Kirillova, I., Richard, R. E., Israeli, D., and Yablonka-Reuveni, Z. (2008) FGFR4 and its Novel Splice Form in Myogenic Cells: Interplay of Glycosylation and Tyrosine Phosphorylation. J Cell Physiol. 215, 803-817.

  3. Tuominen, H., Heikinheimo, P., Loo, B. M., Kataja, K., Oker-Blom, C., Uutela, M., Jalkanen, M., and Goldman, A. (2001) Expression and Glycosylation Studies of Human FGF Receptor 4. Protein Expr Purif. 21, 275-285.

  4. van Heumen, W. R., Claxton, C., and Pickles, J. O. (1999) Fibroblast Growth Factor Receptor-4 Splice Variants Cause Deletion of a Critical Tyrosine. IUBMB Life. 48, 73-78.

  5. Holtrich, U., Brauninger, A., Strebhardt, K., and Rubsamen-Waigmann, H. (1991) Two Additional Protein-Tyrosine Kinases Expressed in Human Lung: Fourth Member of the Fibroblast Growth Factor Receptor Family and an Intracellular Protein-Tyrosine Kinase. Proc Natl Acad Sci U S A. 88, 10411-10415.

  6. Cool, S. M., Sayer, R. E., van Heumen, W. R., Pickles, J. O., and Nurcombe, V. (2002) Temporal and Spatial Expression of Fibroblast Growth Factor Receptor 4 Isoforms in Murine Tissues. Histochem J. 34, 291-297.

  7. Stark, K. L., McMahon, J. A., and McMahon, A. P. (1991) FGFR-4, a New Member of the Fibroblast Growth Factor Receptor Family, Expressed in the Definitive Endoderm and Skeletal Muscle Lineages of the Mouse. Development. 113, 641-651.

  8. Korhonen, J., Partanen, J., and Alitalo, K. (1992) Expression of FGFR-4 mRNA in Developing Mouse Tissues. Int J Dev Biol. 36, 323-329.

  9. Eswarakumar, V. P., Lax, I., and Schlessinger, J. (2005) Cellular Signaling by Fibroblast Growth Factor Receptors. Cytokine Growth Factor Rev. 16, 139-149.

  10. Ron, D., Reich, R., Chedid, M., Lengel, C., Cohen, O. E., Chan, A. M., Neufeld, G., Miki, T., and Tronick, S. R. (1993) Fibroblast Growth Factor Receptor 4 is a High Affinity Receptor for both Acidic and Basic Fibroblast Growth Factor but Not for Keratinocyte Growth Factor. J Biol Chem. 268, 5388-5394.

  11. Vainikka, S., Partanen, J., Bellosta, P., Coulier, F., Birnbaum, D., Basilico, C., Jaye, M., and Alitalo, K. (1992) Fibroblast Growth Factor Receptor-4 shows Novel Features in Genomic Structure, Ligand Binding and Signal Transduction. EMBO J. 11, 4273-4280.

  12. Wu, X., Ge, H., Lemon, B., Vonderfecht, S., Weiszmann, J., Hecht, R., Gupte, J., Hager, T., Wang, Z., Lindberg, R., and Li, Y. (2010) FGF19-Induced Hepatocyte Proliferation is Mediated through FGFR4 Activation. J Biol Chem. 285, 5165-5170.

  13. Ge, H., Zhang, J., Gong, Y., Gupte, J., Ye, J., Weiszmann, J., Samayoa, K., Coberly, S., Gardner, J., Wang, H., Corbin, T., Chui, D., Baribault, H., and Li, Y. (2014) Fibroblast Growth Factor Receptor 4 (FGFR4) Deficiency Improves Insulin Resistance and Glucose Metabolism Under Diet-Induced Obesity Conditions. J Biol Chem. 289, 30470-30480.

  14. Xie, M. H., Holcomb, I., Deuel, B., Dowd, P., Huang, A., Vagts, A., Foster, J., Liang, J., Brush, J., Gu, Q., Hillan, K., Goddard, A., and Gurney, A. L. (1999) FGF-19, a Novel Fibroblast Growth Factor with Unique Specificity for FGFR4. Cytokine. 11, 729-735.

  15. Shin, D. J., and Osborne, T. F. (2009) FGF15/FGFR4 Integrates Growth Factor Signaling with Hepatic Bile Acid Metabolism and Insulin Action. J Biol Chem. 284, 11110-11120.

  16. Loo, B. B., Darwish, K. K., Vainikka, S. S., Saarikettu, J. J., Vihko, P. P., Hermonen, J. J., Goldman, A. A., Alitalo, K. K., and Jalkanen, M. M. (2000) Production and Characterization of the Extracellular Domain of Recombinant Human Fibroblast Growth Factor Receptor 4. Int J Biochem Cell Biol. 32, 489-497.

  17. Mohammadi, M., Honegger, A. M., Rotin, D., Fischer, R., Bellot, F., Li, W., Dionne, C. A., Jaye, M., Rubinstein, M., and Schlessinger, J. (1991) A Tyrosine-Phosphorylated Carboxy-Terminal Peptide of the Fibroblast Growth Factor Receptor (Flg) is a Binding Site for the SH2 Domain of Phospholipase C-Gamma 1. Mol Cell Biol. 11, 5068-5078.

  18. Ong, S. H., Guy, G. R., Hadari, Y. R., Laks, S., Gotoh, N., Schlessinger, J., and Lax, I. (2000) FRS2 Proteins Recruit Intracellular Signaling Pathways by Binding to Diverse Targets on Fibroblast Growth Factor and Nerve Growth Factor Receptors. Mol Cell Biol. 20, 979-989.

  19. Dhalluin, C., Yan, K. S., Plotnikova, O., Lee, K. W., Zeng, L., Kuti, M., Mujtaba, S., Goldfarb, M. P., and Zhou, M. M. (2000) Structural Basis of SNT PTB Domain Interactions with Distinct Neurotrophic Receptors. Mol Cell. 6, 921-929.

  20. Drafahl, K. A., McAndrew, C. W., Meyer, A. N., Haas, M., and Donoghue, D. J. (2010) The Receptor Tyrosine Kinase FGFR4 Negatively Regulates NF-kappaB Signaling. PLoS One. 5, e14412.

  21. Huang, X., Yang, C., Luo, Y., Jin, C., Wang, F., and McKeehan, W. L. (2007) FGFR4 Prevents Hyperlipidemia and Insulin Resistance but Underlies High-Fat Diet Induced Fatty Liver. Diabetes. 56, 2501-2510.

  22. Wu, X., and Li, Y. (2009) Role of FGF19 Induced FGFR4 Activation in the Regulation of Glucose Homeostasis. Aging (Albany NY). 1, 1023-1027.

  23. Zhao, P., Caretti, G., Mitchell, S., McKeehan, W. L., Boskey, A. L., Pachman, L. M., Sartorelli, V., and Hoffman, E. P. (2006) Fgfr4 is Required for Effective Muscle Regeneration in Vivo. Delineation of a MyoD-Tead2-Fgfr4 Transcriptional Pathway. J Biol Chem. 281, 429-438.

  24. Marics, I., Padilla, F., Guillemot, J. F., Scaal, M., and Marcelle, C. (2002) FGFR4 Signaling is a Necessary Step in Limb Muscle Differentiation. Development. 129, 4559-4569.

  25. French, D. M., Lin, B. C., Wang, M., Adams, C., Shek, T., Hotzel, K., Bolon, B., Ferrando, R., Blackmore, C., Schroeder, K., Rodriguez, L. A., Hristopoulos, M., Venook, R., Ashkenazi, A., and Desnoyers, L. R. (2012) Targeting FGFR4 Inhibits Hepatocellular Carcinoma in Preclinical Mouse Models. PLoS One. 7, e36713.

  26. Koritschoner, N. P., Bartunek, P., Knespel, S., Blendinger, G., and Zenke, M. (1999) The Fibroblast Growth Factor Receptor FGFR-4 Acts as a Ligand Dependent Modulator of Erythroid Cell Proliferation. Oncogene. 18, 5904-5914.

  27. Nguyen, C., Roux, D., Mattei, M. G., de, L. O., Goldfarb, M., Birnbaum, D., and Jordan, B. R. (1988) The FGF-Related Oncogenes Hst and Int.2, and the Bcl.1 Locus are Contained within One Megabase in Band q13 of Chromosome 11, while the Fgf.5 Oncogene Maps to 4q21. Oncogene. 3, 703-708.

  28. Zhan, X., Bates, B., Hu, X. G., and Goldfarb, M. (1988) The Human FGF-5 Oncogene Encodes a Novel Protein Related to Fibroblast Growth Factors. Mol Cell Biol. 8, 3487-3495.

  29. Bange, J., Prechtl, D., Cheburkin, Y., Specht, K., Harbeck, N., Schmitt, M., Knyazeva, T., Muller, S., Gartner, S., Sures, I., Wang, H., Imyanitov, E., Haring, H. U., Knayzev, P., Iacobelli, S., Hofler, H., and Ullrich, A. (2002) Cancer Progression and Tumor Cell Motility are Associated with the FGFR4 Arg(388) Allele. Cancer Res. 62, 840-847.

  30. Ulaganathan, V. K., Sperl, B., Rapp, U. R., and Ullrich, A. (2015) Germline Variant FGFR4 p.G388R Exposes a Membrane-Proximal STAT3 Binding Site. Nature. 528, 570-574.

  31. Wang, J., Stockton, D. W., and Ittmann, M. (2004) The Fibroblast Growth Factor Receptor-4 Arg388 Allele is Associated with Prostate Cancer Initiation and Progression. Clin Cancer Res. 10, 6169-6178.

  32. Streit, S., Bange, J., Fichtner, A., Ihrler, S., Issing, W., and Ullrich, A. (2004) Involvement of the FGFR4 Arg388 Allele in Head and Neck Squamous Cell Carcinoma. Int J Cancer. 111, 213-217.

  33. Tateno, T., Asa, S. L., Zheng, L., Mayr, T., Ullrich, A., and Ezzat, S. (2011) The FGFR4-G388R Polymorphism Promotes Mitochondrial STAT3 Serine Phosphorylation to Facilitate Pituitary Growth Hormone Cell Tumorigenesis. PLoS Genet. 7, e1002400.

  34. Seitzer, N., Mayr, T., Streit, S., and Ullrich, A. (2010) A Single Nucleotide Change in the Mouse Genome Accelerates Breast Cancer Progression. Cancer Res. 70, 802-812.

  35. Taylor JG, 6., Cheuk, A. T., Tsang, P. S., Chung, J. Y., Song, Y. K., Desai, K., Yu, Y., Chen, Q. R., Shah, K., Youngblood, V., Fang, J., Kim, S. Y., Yeung, C., Helman, L. J., Mendoza, A., Ngo, V., Staudt, L. M., Wei, J. S., Khanna, C., Catchpoole, D., Qualman, S. J., Hewitt, S. M., Merlino, G., Chanock, S. J., and Khan, J. (2009) Identification of FGFR4-Activating Mutations in Human Rhabdomyosarcomas that Promote Metastasis in Xenotransplanted Models. J Clin Invest. 119, 3395-3407.

  36. Weinstein, M., Xu, X., Ohyama, K., and Deng, C. X. (1998) FGFR-3 and FGFR-4 Function Cooperatively to Direct Alveogenesis in the Murine Lung. Development. 125, 3615-3623.

  37. Yu, C., Wang, F., Kan, M., Jin, C., Jones, R. B., Weinstein, M., Deng, C. X., and McKeehan, W. L. (2000) Elevated Cholesterol Metabolism and Bile Acid Synthesis in Mice Lacking Membrane Tyrosine Kinase Receptor FGFR4. J Biol Chem. 275, 15482-15489.