Phenotypic Mutation 'amontillado' (pdf version)
List |< first << previous [record 16 of 511] next >> last >|
Alleleamontillado
Mutation Type missense
Chromosome1
Coordinate58,844,770 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Casp8
Gene Name caspase 8
Synonym(s) MACH, Mch5, FLICE, Caspase-8
Chromosomal Location 58,795,374-58,847,503 bp (+)
MGI Phenotype Homozygotes for a targeted null mutation exhibit impaired cardiac muscle development, cardiac erythrocyte congestion, low numbers of colony-forming cells, and prenatal lethality. T-cell restricted knockout mice are viable, but immunodeficient.
Accession Number

NCBI RefSeq: NM_009812 (variant 1), NM_001080126 (variant 2), NM_001277926 (variant 3); MGI: 1261423

Mapped Yes 
Amino Acid Change Valine changed to Alanine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000027189] [ENSMUSP00000127375] [ENSMUSP00000140335] [ENSMUSP00000140546]
SMART Domains Protein: ENSMUSP00000027189
Gene: ENSMUSG00000026029
AA Change: V412A

DomainStartEndE-ValueType
DED 1 80 3.21e-23 SMART
DED 99 178 1.01e-15 SMART
CASc 227 480 2.13e-110 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000027189)
SMART Domains Protein: ENSMUSP00000127375
Gene: ENSMUSG00000026029
AA Change: V412A

DomainStartEndE-ValueType
DED 1 80 3.21e-23 SMART
DED 99 178 1.01e-15 SMART
CASc 227 480 2.13e-110 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000165549)
SMART Domains Protein: ENSMUSP00000140335
Gene: ENSMUSG00000026029
AA Change: V432A

DomainStartEndE-ValueType
DED 21 100 1.5e-25 SMART
DED 119 198 5e-18 SMART
CASc 247 500 1.1e-112 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000190213)
SMART Domains Protein: ENSMUSP00000140546
Gene: ENSMUSG00000026029
AA Change: V432A

DomainStartEndE-ValueType
DED 21 100 1.5e-25 SMART
DED 119 198 5e-18 SMART
CASc 247 500 1.1e-112 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000191201)
Phenotypic Category decrease in CD4:CD8, decrease in CD4+ T cells, decrease in CD4+ T cells in CD3+ T cells, decrease in naive CD8 T cells in CD8 T cells, increase in CD11c+ DCs, increase in CD44 MFI in CD4, increase in CD44 MFI in CD8, increase in CD44 MFI in T cells, increase in CD8+ T cells in CD3+ T cells, increase in effector memory CD4 T cells in CD4 T cells, increase in effector memory CD8 T cells in CD8 T cells, increase in neutrophils, increase in NK cells, increase in NK T cells
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(15) : Chemically induced (ENU)(1) Chemically induced (other)(1) Radiation induced(1) Targeted(11) Transgenic(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00684:Casp8 APN 1 58827314 critical splice donor site probably null 0.00
IGL00825:Casp8 APN 1 58829006 missense probably benign 0.11
IGL02025:Casp8 APN 1 58824147 missense possibly damaging 0.93
IGL02549:Casp8 APN 1 58833766 missense probably benign 0.00
IGL02991:Casp8 APN 1 58827279 missense probably benign 0.00
IGL02991:Casp8 UTSW 1 58827279 missense probably benign 0.00
R0609:Casp8 UTSW 1 58844792 missense probably benign 0.00
R0960:Casp8 UTSW 1 58829013 critical splice donor site probably null
R1121:Casp8 UTSW 1 58824260 splice donor site probably benign
R1433:Casp8 UTSW 1 58824124 missense probably damaging 1.00
R1505:Casp8 UTSW 1 58828922 missense probably damaging 0.99
R1506:Casp8 UTSW 1 58824196 missense probably damaging 0.98
R1596:Casp8 UTSW 1 58831674 splice donor site probably benign
R1674:Casp8 UTSW 1 58844416 missense probably damaging 1.00
R1676:Casp8 UTSW 1 58844416 missense probably damaging 1.00
R1981:Casp8 UTSW 1 58828962 synonymous probably null
R3909:Casp8 UTSW 1 58844811 missense probably damaging 1.00
R3911:Casp8 UTSW 1 58833705 missense probably damaging 1.00
R4231:Casp8 UTSW 1 58844770 missense probably damaging 1.00
R4233:Casp8 UTSW 1 58844770 missense probably damaging 1.00
R4234:Casp8 UTSW 1 58844770 missense probably damaging 1.00
R4235:Casp8 UTSW 1 58833698 missense possibly damaging 0.89
R4236:Casp8 UTSW 1 58844770 missense probably damaging 1.00
R4917:Casp8 UTSW 1 58827218 missense probably damaging 1.00
R4918:Casp8 UTSW 1 58827218 missense probably damaging 1.00
R5063:Casp8 UTSW 1 58844374 missense probably damaging 1.00
R5092:Casp8 UTSW 1 58844676 missense possibly damaging 0.53
R5153:Casp8 UTSW 1 58844845 missense probably benign 0.00
R5964:Casp8 UTSW 1 58833736 missense possibly damaging 0.62
R5979:Casp8 UTSW 1 58828912 missense probably benign
Mode of Inheritance Autosomal Recessive
Local Stock Sperm, gDNA
Repository

 

Last Updated 09/11/2017 8:17 PM by External Program
Record Created 04/22/2016 8:34 AM by Anne Murray
Record Posted 02/02/2017
Phenotypic Description

Figure 1. Amontillado mice exhibit reduced frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Amontillado mice exhibit reduced frequencies of peripheral CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD4 T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Amontillado mice exhibit reduced frequencies of peripheral CD4 T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD4 T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Amontillado mice exhibit increased frequencies of peripheral CD8 T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD8 T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Amontillado mice exhibit a reduced CD4 to CD8 T cell ratio. Flow cytometric analysis of peripheral blood was utilized to determine CD4 and CD8 T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Amontillado mice exhibit increased frequencies of peripheral effector memory CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD8 T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Amontillado mice exhibit diminished frequencies of peripheral naïve CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD8 T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 8. Amontillado mice exhibit increased expression of CD44 on peripheral blood CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Homozygosity for the amontillado mutation in Casp8 was associated with reduced frequencies of total T cells in the blood (Figure 1); in particular, the frequency of CD4 T cells was reduced (Figure 2).  This was also observed within the T cell population (CD3+) of homozygous mice, where CD4 T cells were reduced (Figure 3) and CD8 T cells were increased in frequency (Figure 4). The ratio of CD4:CD8 T cells was reduced in the blood (Figure 5).  In addition, effector memory cells were elevated and naïve cells were diminished in frequency among the population of CD8 T cells (Figures 6 and 7).  CD8 T cells from the blood of homozygous mice exhibited increased CD44 expression, detected as increased in CD44 MFI after immunostaining (Figure 8).

Nature of Mutation

Figure 9. Linkage mapping of the elevated frequency of effector memory cells among CD8 T cells using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 50 mutations (X-axis) identified in the G1 male of pedigree R4236.  Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire from pedigree R4236 identified 50 mutations.  The phenotypes described above (Phenotypic Description) were linked by continuous variable mapping to a mutation in Casp8: a T to C transition at base pair 58,844,770 (GRCm38) on chromosome 1, or base pair 49,543 in the GenBank genomic region NC_000067 encoding caspase-8.  The strongest linkage (P = 4.14 x 10-14) was to an elevated frequency of effector memory cells among CD8 T cells in the blood, found with a recessive model of inheritance, wherein 8 homozygous variant mice departed phenotypically from 32 heterozygous and 11 wild type mice (Figure 9).

 

The mutation corresponds to residue 1,628 in the mRNA sequence NM_009812, within 8 of 9 exons.

 

1612 ACGGTGAAGAACTGCGTTTCCTACCGAGATCCT

427  -T--V--K--N--C--V--S--Y--R--D--P-

 

The mutated nucleotide is indicated in red.  The mutation results in a valine to alanine substitution at position 432 (V432A) in the caspase-8 protein (isoform 1).

Protein Prediction

Figure 10. Domain organization of mouse caspase-8.  The protease domain consists of two subunits (larged, p20; small, p10).  DED, death effector domain.  The amontillado mutation is indicated in red.

Caspase-8 is one of 14 caspase proteins (cysteine-dependent aspartate-specific proteases) found in mice.  These enzymes cleave protein substrates after Asp residues to propagate signaling leading to apoptosis (caspase-2, -3, -6, -7, -8, -9, -10) or inflammation (caspase-1, -4, -5, -8); capsases may also have roles in other processes such as differentiation (caspase-14) (1).  The apoptotic caspases are classified as initiator (caspase-2, -8, -9, -10) or effector caspases (caspase-3, -6, -7), the effector caspases being activated by initiator caspases, whereas initiator caspases are activated by non-caspases through a mechanism involving clustering leading to dimerization. 

 

Caspases are initially produced as zymogens (procaspases).  The structural organization of all procaspases is similar, consisting of an N-terminal prodomain and a C-terminal catalytic domain (Figure 10) (2).  For initiator caspases including caspase-8, the prodomain contains motif(s) that bind homotypically to adapter proteins that have been recruited to an activated death receptor (3).  In caspase-8, two tandem death effector domains (DEDs) contained within the prodomain mediate clustering at death receptor-adapter complexes to facilitate caspase dimerization critical for catalytic activation (4).  DEDs fold into a six-helix bundle characteristic of the death domain fold superfamily (5).

Figure 11. Crystal structure of human caspase-8 catalytic domain (PDB 1QTN).  The asymmetric unit containing one small and one large subunit is shown.  The amontillado mutation is located in the small subunit of the catalytic domain, within loop 4 of the five loops that mediate substrate binding at the surface of caspase-8.

The caspase catalytic domain is composed of two subunits (large, p20; and small, p10) covalently connected by the intersubunit linker.  Autoproteolytic cleavage of the linker in caspase-8 occurs following dimerization, separating the large and small subunits of the catalytic domain; subsequently the prodomain is cleaved from the large subunit (6).  Linker cleavage is insufficient for catalytic activation of caspase-8, and instead stabilizes the catalytic conformation induced by dimerization (7).  Autoproteolytic cleavage of caspase-8 also switches its target specificity from itself to downstream effector caspases (6).  Dimerization in the absence of linker cleavage results in a catalytically active form of caspase-8 capable of signaling T cell proliferation and activation, but not cell death, which requires cleaved caspase-8 (8); this finding supports the idea that the extent of cleavage modulates the function of caspase-8.  In contrast, effector caspases exist as stable but inactive dimers, and proteolytic cleavage of the linker directly activates their catalytic activity (2)

 

An important regulator of caspase-8 is a homologue called FLIPL (FLICE-like inhibitory protein, long form) (9), which can heterodimerize with and activate caspase-8 (10-12).  FLIPL contains tandem DEDs at the N-terminus and a catalytically inactive protease-like domain at the C-terminus which can dimerize with the protease domain of caspase-8 (13).  Heterodimerization enhances the proteolytic activity of caspase-8 by inducing an active conformation at the catalytic active site (13). Because FLIPL has DEDs, it can compete with caspase-8 for binding to the DISC and therefore also functions as a negative regulator of caspase-8 activation when expressed at high levels (14-16).

 

Like other mature caspases, mature caspase-8 is a dimer arranged in a large:small:small:large subunit configuration and contains two active sites on opposite sides of the dimer (17;18).  The crystal structure of the asymmetric unit containing one small and one large subunit is in the shape of a cylinder with a central six-stranded β-sheet surrounded by six α-helices (Figure 11).  Substrate binding is mediated by five loops on the exterior surface of the dimer.  N-terminal to the substrate cleavage site, a four amino acid recognition sequence consisting of (Leu/Val)-Glu-X-Asp (P4-P1) is preferred in vitro by caspases-6, -8, -9, and -10 (19).  There is also a preference for small amino acids such as Ala, Gly, and Ser at the first position immediately C-terminal to the cleavage site (P1’) (20).  However, analysis of natural substrates cleaved in apoptotic cells revealed a lack of specificity at the P4 site, suggesting more complex regulation in vivo (21).

 

Mouse and human caspase-8 are 69.3% identical in amino acid sequence.  The amontillado mutation is located in the small subunit of the catalytic domain, within loop 4 of the five loops that mediate substrate binding at the surface of caspase-8.

Expression/Localization

Northern blot analysis showed Casp8 expression in most adult mouse tissues including heart, brain, spleen, thymus, lung, liver, kidney, and testis (22).  Relatively higher expression levels were detected in the spleen, thymus, lung, liver, and kidney than in heart, brain, and testis.  In mouse embryos, Casp8 expression was about two-fold higher at E9.5 compared to E17.5 (22).  Caspase-8 protein was detected in whole E8 mouse embryos, and in the thymus, spleen, kidney, stomach, heart, intestine, lung, skin, muscle, and liver of E17 embryos (23).  No caspase-8 protein was found in the brain of E17 mouse embryos. The function of caspase-8 has been tested in several cell types in which it is expressed, including hematopoietic progenitor cells (24), myeloid cells (24), T cells (25), B cells (26), hepatocytes (24), and endothelial cells (24).  Caspase-8 has been reported to localize in the cytoplasm (27;28), in the nucleus upon sumoylation (29-31), and in mitochondria or at the mitochondrial membrane (31;32); the mitochondrial localization has been disputed (33).

Background

Figure 12. Caspase-8 in death receptor signaling leading to apoptosis.  Left, Formation of the DISC in response to Fas activation.  Right, TNF receptor signaling can induce several cellular outcomes.  See text for details.

Role of caspase-8 in the extrinsic pathway of apoptosis

Caspases are critical components of the signaling pathways leading to apoptosis, or programmed cell death.  This physiological process is triggered by virus infection, toxic stress, environmental insults, hormones, and other stimuli (2).  At least two pathways are well known to activate apoptosis: 1) The intrinsic pathway of apoptosis is activated from within the cell by mitochondrial damage, cytochrome c release, and formation of a complex called the apoptosome (Apaf-1, procaspase-9), which activates the initiator protease caspase -9 (34).  2) The extrinsic pathway is triggered by the engagement of death receptors such as CD95 (Fas) and TNFR1, cell surface transmembrane proteins containing an intracellular death domain (DD) and an extracellular cysteine-rich ligand binding domain (35).  

 

Ligand binding to death receptors results in receptor aggregation at the cell membrane and the subsequent clustering of downstream signaling complexes (36;37).  In response to activation by Fas ligand (FasL), recruitment of the adapter FADD to the receptor occurs via DD-DD interactions; the DED of FADD then recruits caspase-8 or caspase-10 via DED-DED interactions (Figure 12).  The ternary complex containing Fas, FADD, and caspase-8/10 is called the death-inducing signaling complex (DISC) (28;34;37-39), and activates caspase-8 by proximity-induced dimerization.  Caspase-8 cleaves effector caspases (caspase-3 and caspase-7) that go on to degrade cellular organelles during the process of apoptosis.  In some cells, the intrinsic apoptotic pathway is also triggered following Fas activation through a process in which caspase-8 cleaves BID, resulting in mitochondrial damage and cytochrome c release leading to apoptosis (40).

 

Caspase-8 also participates in proapoptotic signaling induced by TRAIL receptors 1 and 2 [reviewed in (41)] and by TNFR1 (Figure 12(42;43).  Following activation of TNFR1 by TNF-α, ‘complex I’ containing the receptor, the adapter TRADD (TNFRSF1A-associated via death domain), RIPK1 (receptor (TNFRSF)-interacting serine-threonine kinase 1), TRAF2, and cellular inhibitor of apoptosis proteins cIAP1 and cIAP2 is formed at the cell membrane (42).  Complex I recruits and activates the IKK complex leading to the activation of NF-κB (44-46).  A second complex is subsequently formed in the cytoplasm (complex II) containing TRADD, RIPK1, FADD, and caspase-8; this complex contains FLIPL (acting as a caspase-8 inhibitor) when NF-κB has been activated by complex I, thereby permitting cell survival (42).  When NF-κB, which positively regulates the expression of FLIPL (47;48), has not been activated by complex I, caspase-8 becomes activated in complex II, initiating the apoptotic cascade.  Caspase-8 also negatively regulates necroptosis mediated by RIPK3 (see below).

 

Another caspase-8 activation pathway induced by TNF-α is dependent on Diablo, a mitochondrial protein that binds cIAP1 and cIAP2, resulting in their degradation (43).  The degradation of cIAP1/2 leads to the release of RIPK1 from the activated TNFR1 complex, promoting formation of a caspase-8-activating complex containing FADD, RIPK1, and caspase-8.  The in vivo importance of caspase-8 in apoptosis has been confirmed using fibroblasts derived from caspase-8 knockout mouse embryos; these fibroblasts failed to undergo apoptosis when Fas, TNFR1, or TRAIL-R1 were stimulated (49).

Figure 13. Caspase-8 in pro-IL-1β processing and inflammasome signaling.  (A) Left, Activation of dectin-1 during fungal infection induces Syk recruitment and activation.  A complex containing CARD9, BCL10, and MALT1 recruits ASC and caspase-8, resulting in activation of caspase-8, which directly cleaves pro-IL-1β.  Right, TLR4 activation in the presence of either FasL or tunicamycin results in activation of caspase-8 and processing of pro-IL-1β by caspase-8.  (B) Activation of the canonical (by LPS + nigericin) or non-canonical NLRP3 inflammasome (by C. rodentium, E. coli) depends on caspase-8 for cleavage of procaspase-1, yielding active caspase-1 for incorporation into the inflammasome.  Left, TLR4 stimulation by LPS induces NF-kB-dependent expression of pro-IL-1β and NLRP3 transcripts (not shown), while NLRP3 activation by nigericin induces inflammasome assembly and activation.  Right, TLR4 activation by Gram-negative bacteria induces caspase-11 expression.  Cytoplasmic LPS released from pathogen-containing vacuoles activates caspase-11, leading to NLRP3 inflammasome assembly and activation.

 

Regulation of pro-IL-1β processing and inflammasome signaling by caspase-8

Although best known as an initiator caspase necessary for apoptosis triggered by death receptor activation, caspase-8 is also involved in IL-1 receptor-dependent inflammatory signaling by virtue of its role in the proteolytic processing of IL-1β to its mature form (Figure 13) [reviewed in (50)].  Caspase-8 has been implicated in directly cleaving pro-IL-1β.  For example, direct cleavage of IL-1β by caspase-8 occurred in dendritic cells or macrophages upon activation of Toll-like receptor 3 (TLR3) or TLR4, either alone or in combination with another stimulus such as FasL or tunicamycin (an inducer of the ER stress response) (51-54).  Caspase-8 has also been shown to cleave pro-IL-1β during infections with fungi and mycobacteria sensed by the receptor dectin-1, which induces a complex containing CARD9, BCL10, MALT1, ASC, and caspase-8 (55).

 

In addition to directly processing pro-IL-1β, caspase-8 serves as an initiator caspase for the activation of caspase-1, which directly processes pro-IL-1β, in inflammasomes (56-59).  Stimulation of the NLRP3 inflammasome by LPS plus either ATP or nigericin, or by C. rodentium infection, results in recruitment of caspase-8 to the inflammasome complex where caspase-8 cleaves and processes procaspase-1; deficiency of caspase-8 resulted in reduced IL-1β production (57).  In contrast with these studies, others found that caspase-8 may negatively regulate NLRP3 inflammasome activation and IL-1β production (60;61).  It has been proposed that the discrepancy in the reported function of caspase-8 in NLRP3 inflammasome regulation may be due to different stimulation conditions (LPS-induced spontaneous activation of NLRP3 inflammasomes versus LPS+ATP–induced activation of NLRP3 inflammasomes) (50).

 

Effects of caspase-8 deficiency in vivo

Caspase-8 deficiency in mice results in embryonic lethality at E10.5 (49).  Importantly, knockout of RIPK3, upon which the necrotic cell death pathway depends, rescued Casp8-/- mice from embryonic death (62;63).  This finding demonstrated that caspase-8 opposes RIPK3-mediated necroptosis during embryonic development (Figure 12).  T cell-specific caspase-8 deficiency in mice (tcasp8-/-) resulted in defective T cell proliferation and homeostasis despite normal thymocyte development, leading to reduced peripheral T cells (25).  The reduction in T cells is thought to stem from increased necroptosis upon activation because RIPK3 knockout restored normal T cell frequencies (62). T cell clonal expansion required caspase-8 catalytic activity, which was induced within 24 hours of TCR ligation but appeared to be distinct from death receptor-induced activity in that proteolytic cleavage of the intersubunit linker was unnecessary for T cell clonal expansion (64).  tcasp8-/- T cells displayed impaired responses to activation stimuli, and showed activation marker upregulation and stimulation-independent proliferation of peripheral T cells (25;65)tcasp8-/- mice failed to mount a T cell-mediated immune response to LCMV infection (25).  Moreover, they developed an age-dependent lethal lymphoproliferative disorder different from autoimmune lymphoproliferative syndrome (ALPS) characterized by lymphoadenopathy, splenomegaly, and accumulation of T cell infiltrates in the lungs, liver, and kidneys (65).  These findings are consistent with a report of caspase-8 deficiency in humans caused by a point mutation (R248W) in the large subunit of the catalytic domain (66). Homozygous individuals exhibited lymphoadenopathy and splenomegaly, along with defective activation of T cells, B cells, and NK cells that resulted in immunodeficiency (66).

Putative Mechanism

The amontillado mutation occurs within one of five loops at the surface of caspase-8 that recognize and bind substrates, and may therefore impair the interaction of caspase-8 with its substrates.  However, unlike mice with a null mutation of Casp8 (49), homozygous amontillado mice are born alive and survive past weaning age, suggesting that the mutant caspase-8 protein produced in amontillado mice retains some function.  The level of function, while sufficient to support embryonic development, was inadequate for normal T cell proliferation and homeostasis.

Primers PCR Primer
amontillado(F):5'- AAAGTGCCCTTCCCTGTCTG -3'
amontillado(R):5'- GCCAATGGCTACTTCTCTGCTTAG -3'

Sequencing Primer
amontillado_seq(F):5'- GCTTGCCAAGGAAGTAAC -3'
amontillado_seq(R):5'- TCTGCTTAGTATATATTATCTCGGCC -3'
Genotyping

Genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the mutation.
 

PCR Primers

amontillado_PCR_F: 5’- AAAGTGCCCTTCCCTGTCTG-3’

amontillado_PCR_R: 5’- GCCAATGGCTACTTCTCTGCTTAG-3’

 

Sequencing Primers

amontillado_SEQ_F: 5’- GCTTGCCAAGGAAGTAAC-3’
 

amontillado_SEQ_R: 5’- TCTGCTTAGTATATATTATCTCGGCC-3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               hold

 

The following sequence of 400 nucleotides is amplified (Chr10: 9239383-61667422; NC_000067):

       

49321 tgacatctta cttcactggt tcaaagtgcc cttccctgtc tgggaaaccc aagatctttt    

49381 tcattcaggc ttgccaagga agtaacttcc agaaaggagt gcctgatgag gcaggcttcg    

49441 agcaacagaa ccacacttta gaagtggatt catcatctca caagaactat attccggatg    

49501 aggcagactt tctgctggga atggctacgg tgaagaactg cgtttcctac cgagatcctg    

49561 tgaatggaac ctggtatatt cagtcacttt gccagagcct gagggaaaga tgtcctcagt    

49621 aagtttggcc tcctgggccc ctctcagggt tatgcttcct tactcatttc tgtggttaga    

49681 gcccattaga aggtgcttta tggccgagat aatatatact aagcagagaa gtagccattg    

49741 gc

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (Chr. (+) = T>C).

References
  46. Wu, C. J., Conze, D. B., Li, T., Srinivasula, S. M., and Ashwell, J. D. (2006) Sensing of Lys 63-Linked Polyubiquitination by NEMO is a Key Event in NF-kappaB Activation [Corrected]. Nat Cell Biol. 8, 398-406.
Science Writers Eva Marie Y. Moresco
Illustrators Katherine Timer
AuthorsMing Zeng, Xue Zhong, Bruce Beutler
List |< first << previous [record 16 of 511] next >> last >|