Phenotypic Mutation 'butter' (pdf version)
List |< first << previous [record 50 of 511] next >> last >|
Allelebutter
Mutation Type critical splice donor site
Chromosome4
Coordinate80,840,806 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Tyrp1
Gene Name tyrosinase-related protein 1
Synonym(s) Tyrp, isa, Oca3, TRP1, TRP-1
Chromosomal Location 80,834,123-80,851,719 bp (+)
MGI Phenotype The major influence of mutations at this locus is to change eumelanin from a black to a brown pigment in the coat and eyes. Alleles differ in the distribution of brown pigment granules and therefore differ in color intensity.
Accession Number

NCBI RefSeq: NM_031202.2; MGI:98881

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000006151] [ENSMUSP00000099895]
SMART Domains Protein: ENSMUSP00000006151
Gene: ENSMUSG00000005994

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Tyrosinase 182 417 1.7e-37 PFAM
transmembrane domain 479 501 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000099895
Gene: ENSMUSG00000005994

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Tyrosinase 182 417 4.9e-38 PFAM
transmembrane domain 479 501 N/A INTRINSIC
Predicted Effect probably null
Phenotypic Category pigmentation, skin/coat/nails
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(64) : Chemically and radiation induced(1) Chemically induced (ENU)(9)  Chemically induced (other)(16) Radiation induced(29) Spontaneous(8) Targeted(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01508:Tyrp1 APN 4 80840765 missense possibly damaging 0.95
IGL01586:Tyrp1 APN 4 80844898 missense probably benign 0.00
IGL01620:Tyrp1 APN 4 80844802 nonsense probably null
IGL02126:Tyrp1 APN 4 80837608 nonsense probably null
IGL02174:Tyrp1 APN 4 80844826 nonsense probably null
IGL02601:Tyrp1 APN 4 80840775 missense probably null 0.00
IGL02630:Tyrp1 APN 4 80840757 missense possibly damaging 0.95
ca-los UTSW 4 80844868 nonsense probably null
chi UTSW 4 80840778 missense probably damaging 1.00
JAX1:Tyrp1 UTSW 4 80837534 missense probably damaging 1.00
JAX1:Tyrp1 UTSW 4 80840806 critical splice donor site probably null
JAX1:Tyrp1 UTSW 4 80844868 nonsense probably null
R0011:Tyrp1 UTSW 4 80840793 missense probably damaging 1.00
R0011:Tyrp1 UTSW 4 80840793 missense probably damaging 1.00
R0145:Tyrp1 UTSW 4 80840778 missense probably damaging 1.00
R1172:Tyrp1 UTSW 4 80844868 nonsense probably null
R1173:Tyrp1 UTSW 4 80844868 nonsense probably null
R1175:Tyrp1 UTSW 4 80844868 nonsense probably null
R1886:Tyrp1 UTSW 4 80840806 critical splice donor site probably null
R2099:Tyrp1 UTSW 4 80835379 missense probably damaging 0.99
R2273:Tyrp1 UTSW 4 80837534 missense probably damaging 1.00
R2274:Tyrp1 UTSW 4 80837534 missense probably damaging 1.00
R2275:Tyrp1 UTSW 4 80837534 missense probably damaging 1.00
R2312:Tyrp1 UTSW 4 80837564 nonsense probably null
R2427:Tyrp1 UTSW 4 80850871 missense probably benign 0.00
R2440:Tyrp1 UTSW 4 80846606 missense probably benign 0.41
R2915:Tyrp1 UTSW 4 80837455 missense possibly damaging 0.60
R4343:Tyrp1 UTSW 4 80849841 missense possibly damaging 0.92
R4512:Tyrp1 UTSW 4 80837512 missense probably damaging 1.00
R4703:Tyrp1 UTSW 4 80840806 unclassified probably null
R4732:Tyrp1 UTSW 4 80844935 missense possibly damaging 0.67
R4733:Tyrp1 UTSW 4 80844935 missense possibly damaging 0.67
R4788:Tyrp1 UTSW 4 80844943 nonsense probably null
R4834:Tyrp1 UTSW 4 80846596 nonsense probably null
R4911:Tyrp1 UTSW 4 80850907 missense unknown
R4938:Tyrp1 UTSW 4 80840646 missense probably damaging 1.00
R5129:Tyrp1 UTSW 4 80846607 missense probably damaging 1.00
R5154:Tyrp1 UTSW 4 80850717 missense probably benign 0.00
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 09/15/2016 3:46 PM by Katherine Timer
Record Created 04/27/2016 10:04 AM by Carlos Reyna
Record Posted 09/15/2016
Phenotypic Description
Figure 1. The butter mice exhibit hypopigmentation of the fur (right). A wild-type littermate is shown on the left.

The butter phenotype was identified among G3 mice of the pedigree R4703, some of which exhibited a brown coat color and black eyes (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the hypopigmentation using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 94 mutations (X-axis) identified in the G1 male of pedigree R4703. Binary phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 94 mutations. The coat pigmentation phenotype was linked to a mutation in Tyrp1: a T to A transversion at base pair 80,840,806 (v38) on chromosome 4, or base pair 6,599 in the GenBank genomic region NC_000070 encoding Tyrp1. The mutation is within the donor splice site of intron 4, 2 base pairs from the previous exon (exon 4 out of 8 total exons). Linkage was found with a recessive model of inheritance (P = 3.583 x 10-6), wherein 6 affected mice were homozygous for the variant allele, and 39 unaffected mice were either heterozygous (N = 20) or homozygous (N = 19) for the reference allele (Figure 2).

 

The effect of the mutation at the cDNA and protein level have not examined, but the mutation is predicted to result in the use of a cryptic site in intron 4, resulting in a transcript that has a 61 base pair insertion in intron 4. The insertion would cause a frame-shifted protein product beginning after amino acid 304 of the protein, and premature termination after the inclusion of 17 aberrant amino acids.

 

Tyrp1+/+:

             <--exon 3         <--exon 4 intron 4-->            exon 5-->          <--exon 8

3482 ……GAGAGAGACATGCAG ……GAACACTTTGTAACA gtaagacccaaatgacagct…… GCACTGAGGGT…… ……TCCATGGTCTGA
232 ……-E--R--D--M--Q- ……G--T--L--C--N--                         S--T--E--G-…… ……-S--M--V--*-

 

Tyrp1butter:

             <--exon 3         <--exon 4 intron 4-->            
3482 ……GAGAGAGACATGCAG ……GAACACTTTGTAACA gtaagacccaaatgacagctactattcacaattctttattctataaatga
232  ……-E--R--D--M--Q- ……G--T--L--C--N-- S--K--T--Q--M--T--A--T--I--H--N--S--L--F--Y--K--*- 

                    correct                                    aberrant

 

The donor splice site of intron 4, which is destroyed by the butter mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. 

Protein Prediction
Figure 3. Domain structure of tyrosinase-related protein 1 (Tyrp1). The butter is within the donor splice site of intron 4, and is predicted to result in the use of a cryptic site in intron 4, resulting in a transcript that has a 61 base pair insertion in intron 4. Abbreviations: SP, signal peptide; EGF-like, epidermal growth factor-like domain; TM, transmembrane; CT, cytoplasmic tail. Glycosylation and copper binding sites are indicated in light pink and purple, respectively. The EGF-like/Cysteine-rich domain (EGF-like) is labeled. A central cysteine-rich (Cys-rich) region is between the copper binding regions (CuA and CuB; the exact amino acid residues that comprise the Cys-rich region are not documented). The CuA, Cys-rich, and CuB regions comprise the catalytic domain of Tyrp1. Image is interactive, click on the image to view other Tyrp1 mutations.

Tyrp1 (alternatively, Trp1 or gp75) is a member of the tyrosinase-related protein (TRP) family that also consists of tyrosinase (Tyr; see the records for ghost, pale rider, and siamese) and Tyrp2 [alternatively, DOPAchrome tautomerase (DCT)]. The TRP proteins share homologous domains including a signal sequence, an EGF-like/cysteine (Cys)-rich domain, a catalytic domain that has two copper binding regions and a Cys-rich region, a transmembrane domain, and six putative glycosylation sites (Figure 3) (1-5). Mature Tyrp1 can exist both as an intracellular form (75-80 kDa) and a secreted form (78-88 kDa) [(6); reviewed in (4;7)]. Intracellular Tyrp1 has the N-terminal signal peptide, a long N-terminal luminal domain with the N-linked glycosylation sites, the transmembrane region, and the C-terminal domain (6). In contrast, soluble Tyrp1 lacks the transmembrane domain, the C-terminal tail, and a small region in the luminal domain (6). The butter mutation is predicted to cause a splicing defect in intron 4; the expression and localization of Tyrp1butter has not been examined.

 

For more information on Tyrp1, please see the record for chi.

Putative Mechanism

Tyr, Tyrp1, and Tyrp2 are Cu++/Zn++ metalloenzymes that function in melanogenesis leading to the formation of two types of pigments, eumelanins (brown or black) and pheomelanins (yellow or red).  The primary function attributed to Tyrp1 is that of a DHICA oxidase (8;9), catalyzing the oxidation of DHICA to indole-5,6-quinone-2-carboxylic acid, a product that is eventually converted to eumelanin. Mutations in TYRP1 are linked to oculocuaneous albinism type III [OCA3; OMIM: #203290; (10)] and variations in skin/hair/eye pigmentation linked to 9p23 in Melanesians [OMIM: #612271; (11)]. Individuals with OCA3 have reduced pigment of the skin, hair, and eyes (10). Homozygous Tyrp1 mutant mice [e.g., brown, MGI:1855960; cordovan, MGI: 1855961; light, MGI:1855962; white-based brown, MGI: 1855963] exhibit a brown coat color on a non-agouti background. Loss of pigmentation in brown and light is attributed to disorganized, round melanosomes (12) or to premature death of follicular melanocytes (13), respectively. Similar to the above-mentioned mouse mutants, the Tyrp1 mutation in butter results in hypopigmentation, indicating loss of Typr1 function. It is unknown whether the butter mutation results in the death of follicular melanocytes or in disorganization of melanosomes.

Primers PCR Primer
butter(F):5'- TGTTAGCAGAAGCAGAGACC -3'
butter(R):5'- TTCCCAAGAGCACCAGTTAGAC -3'

Sequencing Primer
butter_seq(F):5'- CTATGATCTAGGAGATGCTGCAG -3'
butter_seq(R):5'- AGAGCACCAGTTAGACTGCCTTG -3'
References
Science Writers Anne Murray
Illustrators Peter Jurek, Katherine Timer
AuthorsCarlos Reyna, Jamie Russell, and Bruce Beutler
List |< first << previous [record 50 of 511] next >> last >|