Phenotypic Mutation 'nut' (pdf version)
Allelenut
Mutation Type splice donor site (5 bp from exon)
Chromosome9
Coordinate
Base Change
Gene Myo5a
Gene Name myosin VA
Synonym(s) 9630007J19Rik, Dbv, flail, MVa, Myo5, MyoVA
Chromosomal Location 75,071,015-75,223,688 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three myosin V heavy-chain genes, belonging to the myosin gene superfamily. Myosin V is a class of actin-based motor proteins involved in cytoplasmic vesicle transport and anchorage, spindle-pole alignment and mRNA translocation. The protein encoded by this gene is abundant in melanocytes and nerve cells. Mutations in this gene cause Griscelli syndrome type-1 (GS1), Griscelli syndrome type-3 (GS3) and neuroectodermal melanolysosomal disease, or Elejalde disease. Multiple alternatively spliced transcript variants encoding different isoforms have been reported, but the full-length nature of some variants has not been determined. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mutations in this gene result in diluted coat color, behavioral deficits including opisthotonus, and postnatal or premature death. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_010864; MGI: 105976

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Ref Sequences
Ensembl: ENSMUSP00000116028 (fasta)
Gene Model not available
PDB Structure
Structure of apo-calmodulin bound to unconventional myosin V [X-RAY DIFFRACTION]
Crystal Structure of MyoVa-GTD [X-RAY DIFFRACTION]
Crystal Structure of MyoVa-GTD in Complex with Two Cargos [X-RAY DIFFRACTION]
SMART Domains

DomainStartEndE-ValueType
Blast:MYSc 13 45 N/A BLAST
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1314 1364 N/A INTRINSIC
coiled coil region 1406 1443 N/A INTRINSIC
Pfam:DIL 1685 1790 4.4e-39 PFAM
Meta Mutation Damage Score Not available question?
Is this an essential gene? Probably essential (E-score: 0.936) question?
Phenotypic Category
Phenotypequestion? Literature verified References
pigmentation
skin/coat/nails
Candidate Explorer Status CE: no linkage results
Single pedigree
Linkage Analysis Data
Penetrance 100% 
Alleles Listed at MGI

All alleles(71) : Gene trapped(2) Spontaneous(52) Chemically induced(17

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Myo5a APN 9 75161497 nonsense probably null
IGL00547:Myo5a APN 9 75141453 missense probably benign 0.00
IGL00788:Myo5a APN 9 75168959 missense probably benign 0.15
IGL01327:Myo5a APN 9 75187538 splice site probably benign
IGL01687:Myo5a APN 9 75156249 missense probably benign 0.12
IGL01886:Myo5a APN 9 75169090 splice site probably benign
IGL01945:Myo5a APN 9 75140671 missense probably damaging 1.00
IGL02127:Myo5a APN 9 75212981 missense probably benign 0.12
IGL02137:Myo5a APN 9 75161535 splice site probably null
IGL02183:Myo5a APN 9 75167236 splice site probably benign
IGL02427:Myo5a APN 9 75176618 splice site probably benign
IGL02490:Myo5a APN 9 75136455 missense probably damaging 1.00
IGL02574:Myo5a APN 9 75211147 missense probably benign 0.00
IGL02886:Myo5a APN 9 75151887 splice site probably benign
IGL02961:Myo5a APN 9 75215120 missense probably benign 0.04
IGL03090:Myo5a APN 9 75120833 missense probably damaging 1.00
IGL03119:Myo5a APN 9 75174015 missense probably benign 0.01
IGL03237:Myo5a APN 9 75129994 missense probably damaging 1.00
IGL03296:Myo5a APN 9 75116202 missense probably damaging 1.00
naoki UTSW 9 75161492 missense probably damaging 1.00
new_gray UTSW 9 missense
silver_decerebrate UTSW 9 75164195 missense probably damaging 1.00
silver_decerebrate_2 UTSW 9 75211127 missense probably damaging 1.00
IGL02988:Myo5a UTSW 9 75130141 splice site probably benign
IGL03050:Myo5a UTSW 9 75146909 unclassified probably null
PIT4403001:Myo5a UTSW 9 75217523 missense probably damaging 1.00
R0047:Myo5a UTSW 9 75156207 missense probably damaging 1.00
R0047:Myo5a UTSW 9 75156207 missense probably damaging 1.00
R0091:Myo5a UTSW 9 75161492 missense probably damaging 1.00
R0142:Myo5a UTSW 9 75160574 missense probably benign 0.01
R0243:Myo5a UTSW 9 75186123 critical splice donor site probably null
R0395:Myo5a UTSW 9 75193977 missense probably benign 0.39
R0427:Myo5a UTSW 9 75174196 missense probably benign 0.00
R0545:Myo5a UTSW 9 75167037 missense possibly damaging 0.94
R0565:Myo5a UTSW 9 75180112 missense probably benign 0.00
R0601:Myo5a UTSW 9 75174015 missense probably benign 0.01
R1457:Myo5a UTSW 9 75213065 missense probably damaging 0.99
R1510:Myo5a UTSW 9 75171551 missense probably benign
R1548:Myo5a UTSW 9 75171746 missense probably damaging 1.00
R1759:Myo5a UTSW 9 75181993 missense possibly damaging 0.72
R1924:Myo5a UTSW 9 75116207 missense probably damaging 1.00
R1960:Myo5a UTSW 9 75147857 missense probably damaging 1.00
R2050:Myo5a UTSW 9 75146874 missense probably benign 0.01
R2070:Myo5a UTSW 9 75181984 missense probably benign 0.03
R2075:Myo5a UTSW 9 75189918 missense probably benign 0.01
R2148:Myo5a UTSW 9 75180147 missense probably damaging 1.00
R2201:Myo5a UTSW 9 75217943 missense possibly damaging 0.51
R2337:Myo5a UTSW 9 75203801 missense probably damaging 1.00
R2357:Myo5a UTSW 9 75201365 missense probably damaging 0.99
R2392:Myo5a UTSW 9 75209239 missense probably benign 0.02
R2432:Myo5a UTSW 9 75212873 missense possibly damaging 0.89
R2568:Myo5a UTSW 9 75123040 missense probably damaging 1.00
R2568:Myo5a UTSW 9 75151897 missense probably damaging 1.00
R2932:Myo5a UTSW 9 75196136 missense possibly damaging 0.85
R2971:Myo5a UTSW 9 75116202 missense probably damaging 1.00
R4231:Myo5a UTSW 9 75189997 missense possibly damaging 0.67
R4293:Myo5a UTSW 9 75144171 missense probably benign
R4321:Myo5a UTSW 9 75217530 missense probably damaging 0.99
R4450:Myo5a UTSW 9 75167176 missense probably benign 0.00
R4573:Myo5a UTSW 9 75201297 synonymous probably null
R4577:Myo5a UTSW 9 75217545 missense probably damaging 1.00
R4601:Myo5a UTSW 9 75136388 missense probably damaging 1.00
R4690:Myo5a UTSW 9 75153823 missense probably damaging 0.99
R4691:Myo5a UTSW 9 75180156 missense probably damaging 0.99
R4764:Myo5a UTSW 9 75116336 intron probably benign
R4767:Myo5a UTSW 9 75144076 missense probably damaging 0.99
R4811:Myo5a UTSW 9 75141543 critical splice donor site probably null
R4829:Myo5a UTSW 9 75136407 missense probably damaging 1.00
R4863:Myo5a UTSW 9 75217507 missense probably damaging 1.00
R4902:Myo5a UTSW 9 75174078 missense probably benign
R4947:Myo5a UTSW 9 75123048 missense probably damaging 1.00
R5074:Myo5a UTSW 9 75174156 missense probably benign
R5095:Myo5a UTSW 9 75152020 missense probably damaging 1.00
R5095:Myo5a UTSW 9 75184389 nonsense probably null
R5254:Myo5a UTSW 9 75130120 missense probably damaging 1.00
R5267:Myo5a UTSW 9 75152010 missense probably damaging 1.00
R5419:Myo5a UTSW 9 75147897 missense probably damaging 1.00
R5514:Myo5a UTSW 9 75153766 missense probably damaging 1.00
R5629:Myo5a UTSW 9 75203845 missense possibly damaging 0.89
R5649:Myo5a UTSW 9 75171719 missense possibly damaging 0.92
R5661:Myo5a UTSW 9 75167206 missense probably benign 0.02
R5665:Myo5a UTSW 9 75144181 critical splice donor site probably null
R5719:Myo5a UTSW 9 75151931 missense probably damaging 1.00
R5964:Myo5a UTSW 9 75203833 missense probably benign 0.09
R6014:Myo5a UTSW 9 75167207 nonsense probably null
R6344:Myo5a UTSW 9 75160509 missense probably benign 0.09
R6345:Myo5a UTSW 9 75189913 missense possibly damaging 0.77
R6644:Myo5a UTSW 9 75146967 missense probably damaging 0.98
R6712:Myo5a UTSW 9 75212900 missense probably benign 0.12
R6838:Myo5a UTSW 9 75153883 critical splice donor site probably null
R6866:Myo5a UTSW 9 75140688 missense probably damaging 1.00
R6876:Myo5a UTSW 9 75160490 missense probably benign 0.04
R7108:Myo5a UTSW 9 75129992 missense probably damaging 1.00
R7159:Myo5a UTSW 9 75171563 missense probably benign 0.07
R7164:Myo5a UTSW 9 75180153 missense probably benign 0.00
R7219:Myo5a UTSW 9 75120770 missense probably damaging 1.00
X0010:Myo5a UTSW 9 75185905 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock Sperm, gDNA
Repository

none

Last Updated 2016-05-13 3:09 PM by Peter Jurek
Record Created unknown
Record Posted 2008-02-25
Phenotypic Description
Nut was identified as a visible phenotype among ENU-induced G3 mutant mice. Homozygous nut mice display a gray coat color and black eyes, as observed in concrete, new gray, and silver decerebrate mutants, as well as in the classical coat color mutant dilute (d) bearing a Myo5a mutation (1;2). Normal degranulation by natural killer (NK) cells from nut mice is observed after antibody stimulation of NKp46 or Ly49H receptors, after exposure to YAC-1 cells, or after PMA/ionomycin stimulation. No neurological defects are evident in homozygous nut mutants.

 

Nature of Mutation
The nut mutation corresponds to a G to A transition in the donor splice site of intron 9 (GTAAGT -> GTAAAT) of the Myo5a gene on Chromosome 9 (position 72979 in the Genbank genomic region NC_000075 for linear genomic DNA sequence of Myo5a). The mutation weakens the donor splice site, and results in skipping of exon 9 (out of 41 total exons) in a portion of the transcripts, as detected by sequencing of Myo5a from nut cDNA. Skipping of exon 9 destroys the reading frame of the encoded protein (aberrant amino acids after position 315), and creates a predicted premature stop codon that would truncate the protein after amino acid 325 (Figure 1).
       <--exon 8  <--exon 9 intron 9-->   exon 10-->
70322 ACTCTGCTGG……ACAATACCT GTAAGTTCA……………CCCAAGCACGAACCTCTTACCATCTTCTGTGA 75691
313   -T--L--L--……-T--I--P-               A--Q--A--R--T--S--Y--H--L--L--*  325
       correct     deleted                           aberrant
Figure 1. Domain structure of myosin Va.  The head domain contains the actin-binding and ATP-binding sites and generates force.  A central neck domain or light-chain binding domain contains six calmodulin binding IQ motifs.  The C-terminal half of myosin Va consists of the coiled coil (CC) segments responsible for myosin heavy chain dimerization and a globular tail domain (GTD) that mediates cargo binding.  The nut mutation results in skipping of exon 9, destroying the reading frame of the encoded protein (aberrant amino acids after position 315) and creating a predicted premature stop codon at amino acid 325 (red asterisk). This image is interactive. Click on the image to view other mutations found in Myo5a (red). Click on the mutations for more specific information.
Please see the record for new gray for information about Myo5a.
Putative Mechanism
The nut mutation results in the insertion of aberrant amino acids and premature truncation within the head region (aa 1-887) of myosin Va. However, a portion of transcripts is correctly spliced, suggesting that some wild type protein is produced in homozygous nut mutants. This conclusion is further supported by the lack of a neurological phenotype in nut mice. Null mutations of Myo5a cause both coat color and neurological phenotypes, because they affect both neuronal- and skin-specific isoforms of Myo5a (3-6), as does the nut mutation. However, in nut, sufficient functional myosin Va protein must exist to allow normal neurological function. Some work suggests that neuronal mechanisms exist to compensate for the partial loss of myosin Va function in the brain (7).
Primers Primers cannot be located by automatic search.
Genotyping
Nut genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.
 
Primers for PCR amplification
Nut(F): 5’-GTGTGTGATGTGGCAGGACATAGAC-3’
Nut(R): 5’-CTGCCTGTGAACGTACTTATGGTTGAA-3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               ∞
 
Primers for sequencing
Nut_seq(F): 5’- CCACATTGCTAAACTGCCTAGTATG-3’
Nut_seq(R): 5’- AAGAGATCCAATGTCCTCTTCTGG-3’
 
The following sequence of 1460 nucleotides (from Genbank genomic region NC_000075 for linear DNA sequence of Myo5α) is amplified:
 
72640                                           g tgtgtgatgt ggcaggacat
72661 agaccagatt aggcacactg tacaacccac attgctaaac tgcctagtat gttactgtct
72721 caaagatgaa agtgttgtta tatgtgacta tgaatgtact atgcacatct ggcaatattc
72781 aagaattaat aatagactta aaattttctt ataattactt tgttgctatt ctgacatcaa
72841 ttgcttgttt actctattct attccaggaa ttagtgaatc ttaccaaatg ggaatttttc
72901 gaatacttgc tggcattctt cacttaggca atgttggatt tgcatctcgg gattcagaca
72961 gctgcacaat acctgtaagt tcagaacaag cttaatgcga tggtggcctg tgtattagtt
73021 ttgtttgttt gtttgtttgt ttgtttcttt tactactggg gctagaacaa gtagaacaag
73081 ctaggggtct ctgcacatgc taggcaatca ctgtatttgt aacatgccac catgttagtc
73141 tttttgaaca tgattttggg gggcaaattc aggtctactt tatctactga gccatctccc
73201 tagatctaca gtagatttaa ttgcttcatt tatttgttta tttattattt tatttattct
73261 gtgtttgtac acatgtataa gcacacaggt acacaaagct gtatgtgtac agaggccaga
73321 agaggacatt ggatctctta gagctagagg ttcaggcagt agcttattac atgggtgcag
73381 gaacgcaaac tccagtcctg atattttgtg gcaagtactt ttcactgctg acctatctat
73441 tcaaccctgt tatttttact tgtgtgtttg tgtgtgtgtg tgtgtatgtg agtgctggca
73501 tgtatgtgcc acacatgtgg aatccaaagt acaacatttg ggagtcagtt ctcctcttcc
73561 accccattga ggcaggtctc tcttgttgct acctgctcat ggtattctag accgggaacc
73621 tttggccagt tctcctgcct tggctttcca tttcattgtg gagtactgac tgggattaga
73681 gatgattgcc atcatgccca gctttttacc tgtgtcctgg agattgaacg taggtcatca
73741 ggcttgtgtg gcttcaagct cttttgccca cttacccatc tctctggcct agtagttttt
73801 aaagatgaaa atgatggctc tgatttaaac ctctaatttc ttttaagaaa ataatcacac
73861 acacccccac ccactctttt ttcaaaatag agtcttgtct gtggcccagg ccggcctcaa
73921 acttgtgaca atctgggatt acaggagtgc ataatcacac ctagcaccag ttttttgttt
73981 tcgttttgtt ttgttttgtt tccaaaagca tattttattg agatataatt tagcaacacc
74041 aatatatggc tgtgattatg ctcatagata tgttcaacca taagtacgtt cacaggcag
 
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated G is shown in red text.
References
   2.  Markert, C. L. and Silvers, W. K. (1956) The Effects of Genotype and Cell Environment on Melanoblast Differentiation in the House Mouse, Genetics 41, 429-450.
   3.  Searle, A. G. (1952) A lethal allele of dilute in the house mouse, Heredity 6, 395-401.
Science Writers Eva Marie Y. Moresco
Illustrators Diantha La Vine
AuthorsCeline Eidenschenk, Bruce Beutler
Edit History
2011-01-07 9:26 AM (current)
2010-08-27 10:00 AM
2010-08-18 9:49 AM
2010-08-18 9:47 AM
2010-08-18 9:46 AM
2010-08-10 1:54 PM
2010-08-10 1:47 PM
2010-01-18 12:00 AM